CN102453084A

CN102453084A - Soybean photoreceptor GmPLP1 and coding gene and application thereof

Info

Publication number: CN102453084A
Application number: CN201010526005XA
Authority: CN
Inventors: 李文滨; 罗秋兰; 赵琳; 韩英鹏
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2010-10-25
Filing date: 2010-10-25
Publication date: 2012-05-16
Anticipated expiration: 2030-10-25
Also published as: CN102453084B

Abstract

The invention discloses a soybean photoreceptor GmPLP1 and a coding gene and application thereof. The protein provided by the invention is named GmPLP1 and is the protein of 1) or 2) as follows: 1) a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table; 2) protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence in the sequence 2, is related to plant traits and is derived from the protein in the step 1); the plant trait is at least one of the following 1) -10): 1) the number of branches; 2) flowering time; 3) the plant height; 4) the area of the blade; 5) pitch spacing; 6) root length; 7) the photosynthetic rate; 8) stress tolerance; 9) the diameter of the stem; 10) the number of the nodes. The photoreceptor gene GmPLP1 can be applied to changing the plant form, increasing the plant branches and changing the flowering and maturation time of plants, and has important significance for plant breeding and research on the function and action mechanism of the photoreceptor gene.

Description

Soybean Photoreceptors GmPLP1 and encoding sox thereof and application

Technical field

The present invention relates to a kind of soybean Photoreceptors GmPLP1 and encoding sox and application.

Background technology

Only influence growth and development of plants the most extensively, the most obvious, most important environmental factor.Illumination shows the regulation and control of plant: photosynthetic efficiency, respiration intensity, apical meristem are to the differentiation (photoperiodic reaction) of flower primordium, tropic movement etc.Photoperiodic reaction directly determines output, quality and the flexibility of crop.Also only be that Study on Molecular Mechanism to the photoresponse of model plant Arabidopis thaliana gets comparatively extensively with detailed up to now.

In photoresponse, plant is delivered to the diel rhythm master slave system through the optical signal in the Photoreceptors impression external world and with optical signal, thereby activation or inhibition photoperiod flowering time expression of gene are come the flowering time of controlling plant.Up to the present the Photoreceptors that in plant, has been found that has three kinds to be respectively: ruddiness/far-red light acceptor phytochrome (phytochrome; Abbreviation PHY), blue/uv-A acceptor comprises cryptochrome (cryptochrome; Be called for short CRY) and to photopigment (phototropin is called for short PHOT) and UV-light-A acceptor, UV-light-B acceptor.Phytochrome A absorptive red light and far-red light, cryptochrome and Xiang Guangsu absorb blue light simultaneously.Phytochrome and cryptochrome acting in conjunction are being regulated and control photosynthetic morphogenesis process and are being formed like: seed, bloom stem elongation and genetic expression; And phototropism, pore is open, and the distribution of chloroplast(id) and other phototropic movement are then controlled by Xiang Guangsu.

Soybean is the typical property measured short day crop, and is very responsive to photoperiodic reaction, the accommodation of each soybean varieties very narrow (latitude 1～1.50), and this characteristic has hindered the popularization of soybean varieties, influences effective performance of yield level.Soybean is accepted optical signals such as light intensity, light quality, direction of illumination and photoperiod and makes corresponding reaction, accepts and transduces through Photoreceptors and optical signal pathway.

Plant comprises Arabidopis thaliana at present, except these acceptors of Phytochrome, Cryptochrome, Phototropin and UV-A/B, also has other Photoreceptors to exist.The list of plant Photoreceptors remains incomplete.Although on soybean, cloned the gene of encode Cryptochrome, Phytochrome in recent years, the clone and the functional analysis of soybean Photoreceptors genoid to be studied also seldom, this respect also rarely has report.Especially soybean is accepted the mechanism that regulation and control are bloomed behind the optical signal, promptly behind the Photoreceptors receiving optical signals in intracellular conduction; Influence to plant endogenous tethelin; To regulate process of physiological activity etc. all know very little, demand urgently more furtheing investigate.

Summary of the invention

An object of the present invention is to provide a kind of soybean Photoreceptors GmPLP1 and encoding sox thereof.

The protein that provides of the present invention derives from the agricultural L13 in soybean (Glycine max (L.) Merrill.) late variety east, and called after GmPLP1 is following 1) or 2) protein:

1) protein of forming by the aminoacid sequence shown in the sequence in the sequence table 2;

2) with the aminoacid sequence of sequence 2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant with plant trait by 1) deutero-protein;

Said plant trait is following 1)-10) at least a:

1) branch amount; 2) flowering time; 3) plant height; 4) blade area; 5) internode distance; 6) root is long; 7) photosynthetic rate; 8) resistance of reverse; 9) diameter stem; 10) joint number.

Above-mentioned sequence 2 is made up of 1-390 amino acid, the replacement of wherein said one or several amino-acid residue and/or disappearance and/or be added to replacement and/or disappearance and/or the interpolation that is no more than 10 amino-acid residues.

Above-mentioned proteinic encoding sox also is the scope that the present invention protects.

Said encoding sox is following 1), 2), 3), 4) or 5) gene:

1) dna molecular shown in the sequence 1 in the sequence table;

2) in the sequence table sequence 1 from the dna molecular shown in 5 ' the terminal 3-1706 position Nucleotide;

3) in the sequence table sequence 1 from the dna molecular shown in 5 ' the terminal 345-1575 position Nucleotide;

4) under stringent condition with 1) or 2) or 3) dna molecule hybridize that limits and with the dna molecular of plant trait GAP-associated protein GAP encoding sox;

5) with 1) or 2) or 3) dna sequence dna that limits have at least 80% homology and with the dna molecular of plant trait GAP-associated protein GAP encoding sox;

Said plant trait is following 1)-10) at least a:

Above-mentioned sequence 1 is made up of 1766 Nucleotide, and its coding region is the 345-1575 position Nucleotide from 5 ' end.

The recombinant vectors, transgenic cell line, reorganization bacterium or the expression cassette that contain said encoding sox also are the scopes that the present invention protects.

Said recombinant vectors is between the BamHI of carrier pBI121 and Sac I recognition site, to insert the recombinant vectors that said encoding sox obtains; Said reorganization bacterium is for importing the reorganization bacterium that the host bacterium obtains with described recombinant vectors.

The said encoding sox total length that increases or arbitrary segmental primer are to also being the scope that the present invention protects.

Said primer is to as follows: a primer sequence is shown in sequence in the sequence table 4, and another primer sequence is shown in sequence in the sequence table 5.

Another object of the present invention provides the method for a kind of transgenic plant.

Method provided by the invention is for importing the transgenic plant that the purpose plant obtains with described encoding sox, and said transgenic plant are following 1)-6) at least a:

1) branch amount of said transgenic plant is more than said purpose plant;

2) flowering time of said transgenic plant is early than said purpose plant;

3) plant height of said transgenic plant is higher than said purpose plant;

4) blade area of said transgenic plant is greater than said purpose plant;

5) internode of said transgenic plant distance is greater than said purpose plant;

6) joint number of said transgenic plant is more than said purpose plant;

Said purpose plant is a short day plant, and said short day plant is preferably soybean.The kind of said soybean is black farming 44.

The 3rd purpose of the present invention provides the method for a kind of transgenic plant.

Method provided by the invention is described encoding sox is imported the transgenic plant that the purpose plant obtains, and said transgenic plant are following 1)-8) at least a:

1) branch amount of said transgenic plant is more than said purpose plant;

2) flowering time of said transgenic plant is later than said purpose plant;

3) plant height of said transgenic plant is lower than said purpose plant;

4) blade area of said transgenic plant is less than said purpose plant;

5) internode of said transgenic plant is apart from being shorter than said purpose plant;

6) diameter stem of said transgenic plant is less than said purpose plant;

7) photosynthetic rate of said transgenic plant is higher than said purpose plant;

8) resistance of reverse of said transgenic plant is lower than said purpose plant.

The branch amount of said transgenic plant all is higher than said purpose plant more than the hormone-content that said purpose plant materials is embodied in the said transgenic plant; Said hormone is indolylacetic acid, Plant hormones regulators,gibberellins, dormin or zein;

The chlorophyll that the photosynthetic rate of said transgenic plant is higher than the present said transgenic plant blade of said purpose plant materials is higher than said purpose plant;

Said resistance of reverse is an anti-high salt, drought-resistant, high temperature resistant and/or low temperature resistant;

It is following 1 that the resistance of reverse of said transgenic plant is lower than said purpose plant)-3) at least a:

1) said transgenic plant proline content is lower than said purpose plant;

2) said transgenic plant root system vigor is lower than said purpose plant;

2) said transgenic plant superoxide-dismutase (SOD) enzymic activity is lower than said purpose plant;

Said high temperature is 42 ℃, and said low temperature is 4 ℃;

Said purpose plant is a long day plant, and said long day plant is preferably tobacco.The kind of said tobacco is Petite Havana SR1.

The application of said protein in plant species improvement; Or the application of said encoding sox in plant species improvement; Or the application of said recombinant vectors in plant species improvement, or the application of said reorganization bacterium in plant species improvement, be the scope that the present invention protects.

Of the present invention experiment showed, imports long day plant tobacco (kind is Petite Havana SR1) with GmPLP1, obtains transgenic plant; These transgene tobaccos are compared with wild-type tobacco; Branch amount increases, and flowering time is postponed, and influences the influence of plant endogenous tethelin; GmPLP1 is imported in the short day plant soybean (kind for black farming 44), and these genetically engineered soybeans are compared with the wild-type soybean, and branch amount increases, and flowering time and has proterties such as plant height increase in advance, for breed improvement provides the foundation.

Description of drawings

Fig. 1 is the RACE amplification of GmPLP1

Fig. 2 is the cDNA total length amplification of GmPLP1

Fig. 3 is the whole genome amplification result of GmPLP1

Fig. 4 different light is handled down, and GmPLP1 expresses the abundance variation in soybean

Fig. 5 is a leaf dish method transformation of tobacco whole process

Fig. 6 is the PCR qualification result of tobacco transgenic progeny

Fig. 7 is the RT-PCR qualification result of tobacco transgenic progeny

Fig. 8 is the Southern analytical results

Fig. 9 is that the phenotype of transgene tobacco and blank is observed

Figure 10 transgene tobacco and blank are handled the back phenotype at short day and are changed

Figure 11 transgene tobacco and blank variation under high salt and drought condition

The size of Figure 12 scanning electron microscopic observation transgene tobacco and barren blade cell

Figure 13 is a During Agrobacterium hypocotyl method soybean transformation whole process

Figure 14 is the PCR detected result of genetically engineered soybean

Figure 15 is the RT-PCR detected result of genetically engineered soybean

Figure 16 transgenic and the display form of interfering GmPLP1 soybean positive plant

Embodiment

Employed experimental technique is ordinary method like no specified otherwise among the following embodiment.

Used material, reagent etc. among the following embodiment like no specified otherwise, are to buy from routine biochemistry reagent shop and obtain.Marker is all available from the precious biotech firm in Dalian.

% among the following embodiment like no specified otherwise, is the quality percentage composition.Quantitative test in following examples all is provided with repeated experiments three times, results averaged.

The clone of embodiment 1, GmPLP1

1, the clone of GmPLP1

1) extraction of the total RNA of plant

(Lin Zhao and Wenbin Li* (2008) A RAV-like transcription factor control photosynthesis and senescencein soybean.Planta.227:1389-1399, the public can obtain from Northeast Agricultural University the agricultural L13 in soybean (Glycine max (L.) Merrill.) late variety east.), have unlimited pod bearing habit, be incubated at 25 ℃ of illumination boxs, 250 μ mol m ^-2Sec ^-1White light is grown under long day (LD) (16h/8h light/dark) condition, treats that first ternately compound leaf launches back (emerging back the 10th day); Beginning short day (SD) photoperiod handles, and (8h/16h light/dark) was cultivated after processing the 15th day, when dark/illumination is alternately located; Sample is drawn materials; The 3rd ternately compound leaf of clip, liquid nitrogen flash freezer ,-80 ℃ of preservations are used for total RNA and extract.Method according to Trizol is extracted the total RNA of soybean;

2) design of primers

Design following primer, be used for the RACE amplification of GmPLP1 gene:

Table 1 is used for the primer sequence of RACE amplification

Positive antisense of gene and nested primer (sp) primer sequence (5 ' → 3 ')

5 ' RACE Auele Specific Primer (5 ' sp1) CAGGAATGCTGGACCTCTTT

5 ' RACE antisense primer (5 ' sp2) CCTCACTGTAATGGGTTAGCAC

5 ' RACE nested primer (5 ' sp3) TTCGCTTCTCATCATCACTCGC

3 ' RACE sense primer (3 ' sp5) GTGAGGCGAGTGATGATGAGAA

3 ' RACE nested primer (3 ' nsp) GCGAAGTGCTGTTACTGCCA

3) the first chain cDNA's is synthetic

According to Roche 5/3 RACE Kit, 2nd Generation carries out

In 2 centrifuge tubes, add following composition respectively

5’-RACE-Ready?cDNA

CDNA synthesizes damping fluid (vial 1) 4 μ L

RNA sample 1～5 μ L (0.2～2 μ g)

dNTP?Mix(via3) 2μL

CDNA synthesizes special primer SP1 (12.5 μ M) 1 μ L

ThermoScript II (via2) 1 μ L

3’-RACE-Ready?cDNA

CDNA synthesizes damping fluid (vial 1) 4 μ L

RNA sample 1～5 μ L (0.2～2 μ g)

dNTP?Mix(via3) 2μL

Oligo dT-joint primer (vial 8) 1 μ L

ThermoScript II (via2) 1 μ L

Add deionized water to 20 μ L, the pressure-vaccum mixing is centrifugal fast up and down, and 55 ℃ of temperature are bathed 1h on the PCR appearance, and 85 ℃ of temperature are bathed 5min, and the centrifugal fast reactant that makes places the pipe end.

4) carry out the cDNA first chain purifying according to the QIAquick PCR Purification Kit of QIAGEN company

5) the cDNA end adds the polyA end reaction

In the 0.2ml tubule, add following composition successively:

Reagent composition add-on (μ L)

CDNA first chain 19 that purifying is good

10 * tailing reaction buffer (vial5) 2.5

2mM?dATP(vial4) 2.5

Shake abundant mixing, simply centrifugal, make each composition be sunken to the pipe end, hatch 3min for 94 ℃; Ice bath cooling rapidly, simple each composition of centrifugation adds 1ul tailing enzyme (80U/ul), (vial 6); 37 ℃ of incubation 20min behind the mixing are heated to 70 ℃ of 10min and make the tailing enzyme deactivation, place on ice.

6) preparation PCR Master mixture

PCR level water 36.5 μ L

Oligo dT-joint primer (vial 8) 1 μ L

dNTP?Mix(10mM)(vial?3) 1μL

10 * LA PCR damping fluid, 5 μ L

LA Taq archaeal dna polymerase 5U/ul 0.5 μ L

TV 44 μ L

Annotate: 5 ' RACE adds 1 μ L, 5 ' sp2 primer (12.5 μ M) and 5 μ L add polyA tail cDNA; 3 ' RACE then adds 1 μ L, 3 ' sp5 primer (12.5 μ M) and purifying cDNA.

7) carry out pcr amplification:

94℃2min

10 circulations: 94 ℃ of 30s, 65 ℃ of 30s, 72 ℃ of 40s

25 circulations: 94 ℃ of 30s, 65 ℃ of 30s, 72 ℃ of 3min

72℃7min

8) first round PCR product is pressed 1: 50 dilution proportion, as the nest-type PRC template, the reaction system deficiency adds water supplies, and carries out nest-type PRC, and each sample is respectively got 8 μ L and carried out 1% agarose gel electrophoresis analytical results such as Fig. 1 ,-20 ℃ of preservations.

9) purifying of PCR product and glue reclaim

A small amount of glue according to Shanghai China Shun biotechnology ltd reclaims test kit recovery dna segment, and the PCR product is connected to pGEM-T Vector (promega company), and transformed into escherichia coli DH5a selects the positive colony order-checking.

10) acquisition of full length cDNA sequence and genic system evolutionary analysis

The design primer is introduced BamHI and Sac I restriction enzyme site respectively primer centering; The full-length gene order design of primers is as described in Table 2:

Table 2GmPLP1 total length amplimer

Full-length gene primer primer sequence (5 ' → 3 ')

GmPLP1 sense primer GCCGGATCCTTGCTGCGTAGGGGAATG (sequence 4)

GmPLP1 antisense primer CGCGAGCTCCAACAGAGAATGTTTTCTTAC (sequence 5)

Add following PCR reacted constituent in order:

The every pipe add-on of reagent (μ L)

3 ' RACE cDNA, first chain 1

10 * PCR damping fluid 5

dNTP?Mix(10mM) 1

GmPLP1 sense primer 1

GmPLP1 antisense primer 1

PCR level water 40.5

LA Taq enzyme 0.5

TV 50

Carry out the PCR reaction, condition is:

94 ℃ of 5min; 35 circulations: 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 2.5min; 72 ℃ of 5min

Each sample is respectively got 8 μ L and is carried out 0.8% agarose gel electrophoresis analytical results and see Fig. 2, obtains the fragment of big or small 1784bp.

11) acquisition of GmPLP1 total length ORF district gene DNA sequence

With the eastern agricultural L13 blade genomic dna of a large amount of extracting soybean of improved method of CTAB (Glycine max (L.) Merrill.) as template; Carry out pcr amplification with GmPLP1 sense primer GCCGGATCCTTGCTGCGTAGGGGAATG, GmPLP1 antisense primer CGCGAGCTCCAACAGAGAATGTTTTCTTAC again, the PCR reaction conditions is 94 ℃ of 5min of elder generation; 35 circulations again: 94 ℃ of 30s, 64 ℃ of 30s, 72 ℃ of 3min; 72 ℃ of 5min again; The fragment of the 3996bp that obtains, through electrophoresis detection, the result sees shown in Figure 3 with the PCR product.

Above-mentioned PCR product is checked order; The sequence of this PCR product gene is that sequence 1 in the sequence table is from 5 ' terminal 3-1706 position Nucleotide; With this unnamed gene is GmPLP1; The coding region of this gene be in the sequence table sequence 1 from 5 ' terminal 345-1575 position nucleotide sequence, the albumen called after GmPLP1 of this genes encoding, the sequence 2 in this proteic aminoacid sequence such as the sequence table.

This PCR product is connected among the carrier pGEMT (promega company), obtains intermediate carrier pGEMT-GmPLP1, this intermediate carrier of warp order-checking is for to be inserted into sequence in the sequence table 1 among the carrier pGEMT from 5 ' terminal 3-1706 position nucleotide sequence.

2, the detection of GmPLP1 expression

First ternated compound seedling appears in eastern agricultural L13 with soybean (Glycine max (L.) Merrill.); Carry out processing like table 3; Extract RNA respectively; Prime ScriptTM RT-SYBR Green kit according to TaKaRa company carries out quantitative PCR detection, and primer is GmPLP1 sense primer GCCGGATCCTTGCTGCGTAGGGGAATG, GmPLP1 antisense primer CGCGAGCTCCAACAGAGAATGTTTTCTTAC, and the result of quantitative PCR is shown in Fig. 4 and table 4.

Table 3 is that day long, light quality, light intensity, hormone etc. influence the genetic expression of soybean Photoreceptors

Transfer to short day (SD) under the photoperiod (8h/16h light/dark),

After the

transfer

3,6,9,12,15,18,21,24h, simultaneously

Day long process is drawn materials to LD (8h/16h light/dark) and SD blade, and changes over to

Dark fully and

complete illumination

0,1,2,3,4,5, the 6d blade

Draw materials

Transfer to the material of 3d under the short day condition, respectively to root, stem,

The position leaf of drawing materials is drawn materials; When treating under the long day condition soybean blossoming, lack day again

According to handling 3d, plant skin and seed and draw materials respectively to flower

Soybean is applied exogenous hormone, comprise growth hormone, phytokinin,

Hormone induction

Ethene and Plant hormones regulators,gibberellins etc., blade is drawn materials

Gene relative expression abundance changed when table 4 was in the dark managed for the soybean Different Organs

The position relative expression's multiple of the drawing materials position relative expression's multiple of drawing materials

8h spends 22.42 8h roots 0.0001865

16h spends 9.956 16h roots 20.31

8h kind skin 189.9 8h stems 4.82

16h kind skin 111.4 16h stems 339.7

8h seed 31.16 8h leaves 41.22

16h seed 46.72 16h leaves 7.852

8h bud 0.09304 16h bud 8.294

Wherein SD and LD are illustrated respectively in short day and the long day processing variation of soybean leaves GmPLP1 gene abundance down among Fig. 4 A; Light and Dark represent that respectively soybean leaves GmPLP1 gene gene abundance under complete illumination and complete dark condition changes among Fig. 4 B; Consolidated statement 4 can find out that with Fig. 4 this gene is accumulating under the short day condition in blade, flower and kind skin, then present downward modulation at other positions and express;, illumination condition presents periodically changed when changing; When short day is handled 9 hours, reach the highest, GmPLP1 genetic expression is risen rapidly under complete dark condition, reaches the highest at the 2nd day.

The acquisition of the transgenic tobacco plant of embodiment 2, overexpression GmPLP1 gene and phenotype research

One, changes the acquisition of GmPLP1 tobacco

1, the structure of Agrobacterium binary expression vector

The intermediate carrier pGEMT-GmPLP1 that will be obtained by embodiment 1 is with BamHI and Sac I double digestion; The pBI121 of small segment that obtains and the same double digestion of process is (available from Beijing Baeyer enlightening Bioisystech Co., Ltd; Product article No.: the connection that the carrier that MP-091) obtains is large stretch of; The connection product transformed into escherichia coli DH5 α that obtains, the transformant that obtains carry out bacterium liquid PCR and identify that primer is GmPLP1 sense primer and GmPLP1 antisense primer; Obtain the positive transformant of 1784bp size; Positive transformant is extracted plasmid carry out BamHI and the evaluation of Sac I double digestion, obtain the segmental plasmid of 1768bp size, send to order-checking again; The plasmid of result for obtaining between the restriction enzyme site of this plasmid for the RamHI and the Sac I that sequence in the sequence table 1 are inserted into pBI121 from 5 ' terminal 3-1706 position Nucleotide is with this plasmid called after pBI121-GmPLP1.PBI121-GmPLP1 is transformed Agrobacterium LBA4404 (available from Ying Jun company; PIN: 18313015); Through resistance screening; The transformant that obtains extracts plasmid and checks order, and the result will contain the transformant called after LBA4404/pBI121-GmPLP1 of this plasmid for this plasmid is pBI121-GmPLP1.

2, change the acquisition (tobacco leaf disc conversion) of GmPLP1 tobacco

With aseptic tobacco (Nicotiana tabacum, kind is Petite Havana SR1, available from LEHLE SEEDS, PIN: NT-02 below is called wild-type tobacco.) blade cuts edge and main vein, is cut into big or small 1cm ²Explant; Explant soaks 10min in the above-mentioned LBA4404/pBI121-GmPLP1 bacterium liquid that gets; Blot the bacterium liquid on vegetable material surface with aseptic filter paper; Vanelets is placed in bud division culture medium (the MS+1.0mg/L 6-benzyl aminopterin-induced syndrome+0.2mg/L naphthylacetic acid+100 μ M Syringylethanone+3% sucrose+0.8% agar that is covered with one deck filter paper; PH5.8;) on carry out common cultivation, 25 ℃ of dark cultivations 3 days; To pass through the tobacco explant of common cultivation and transfer to resistant buds screening culture medium (MS+1.0mg/L 6-benzyl aminopterin-induced syndrome+0.2mg/L naphthylacetic acid+300mg/L kantlex+500mg/ ceftriaxone sodium+3% sucrose+0.8% agar; PH5.8;) cultivate, periodicity of illumination is 16h/8h (illumination/dark), during subculture once; Can sprout after January; Treat that resistant buds grows to 1cm when high, downcut budlet and change root media (1/2MS+50mg/L kantlex+500mg/L ceftriaxone sodium+3% sucrose+0.8% agar, pH5.8 over to.) middle root induction, just have adventive root after the week and form, obtain 40 strain T ₀In generation, changeed the GmPLP1 tobacco seedling, and detailed process is seen Fig. 5, and A is that the inducing of transgene tobacco bud, C are that grow thickly bud, D of transgene tobacco is the regeneration plant of transgene tobacco for cultivation period tobacco leaf disc, B altogether.

3, change the evaluation of GmPLP1 tobacco

T ₀After generation commentaries on classics GmPLP1 tobacco seedling is transplanted a week, take blade and extract genomic dna, carry out PCR and identify (GmPLP1 sense primer: GCCGGATCCTTGCTGCGTAGGGGAATG; GmPLP1 antisense primer: CGCGAGCTCCAACAGAGAATGTTTTCTTAC).Reaction conditions: 94 ℃ of 5min of elder generation; 35 circulations again: 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 2.5min; 72 ℃ of 5min again.With the wild-type tobacco is contrast.The result sees Fig. 6, and among the figure, M is DL2000, and 1-11 is T ₀In generation, changeed the GmPLP1 tobacco, and ck is a wild-type tobacco, and the result obtains size to be the positive T of purpose fragment of 1784bp ₀In generation, changeed the GmPLP1 tobacco, obtains 20 strain T altogether ₀In generation, changeed the GmPLP1 tobacco plant.

Extract T ₀In generation, changeed GmPLP1 tobacco plant young leaflet tablet RNA, carries out RT-PCR with GmPLP1 sense primer, GmPLP1 antisense primer and detect, and the result sees shown in Figure 7, and 1 and 2 is T ₀In generation, changeed the RT-PCR result of GmPLP1 tobacco, and ck is a wild-type tobacco, and the result obtains size to be the purpose fragment of 1784bp, can find out that GmPLP1 is at T ₀Express in the generation commentaries on classics GmPLP1 tobacco.

With T ₀The seed that generation is changeed GmPLP1 tobacco plant selfing generation reaches the plant called after T by it grew up to ₁In generation, changeed the GmPLP1 tobacco plant, with T ₁In generation, changeed GmPLP1 tobacco plant self progeny called after T ₂In generation, changeed the GmPLP1 tobacco plant.

Adopting uses the same method changes empty carrier pBI121 in the aseptic tobacco (Nicotiana tabacum, kind is Petite Havana SR1) over to, obtains T ₀In generation, changeed the pBI121 tobacco plant, with T ₀The seed that generation is changeed pBI121 tobacco plant selfing generation reaches the plant called after T by it grew up to ₁In generation, changeed the pBI121 tobacco plant, with T ₁In generation, changeed pBI121 tobacco plant self progeny called after T ₃In generation, changeed the pBI121 tobacco plant.Adopt aforesaid method to carry out PCR and identify (GmPLP1 sense primer, GmPLP1 antisense primer), the result does not change in the pBI121 tobacco plant for the GmPLP1 of external source.

4, the Southern of GmPLP1 gene transgenic tobacco analyzes

With above-mentioned T ₂In generation, changeed the GmPLP1 tobacco plant, wild-type tobacco extracts total DNA respectively and uses RamHI respectively; HindIII carries out enzyme and cuts; Enzyme is cut product and is carried out 0.7% agarose gel electrophoresis (30-50V; O/N) ordinary method is handled running gel on shaking table, with 20 * SSC with southern blotting technique to nylon membrane, probe mark, hybridization, prehybridization, wash film and all carry out according to DIGHigh Prime DNA Labeling and Detection Starter Kit II (Roche).Under dark, the X-ray sheet is made public.With T ₂In generation, changes the pBI121 tobacco plant and is contrast.(on behalf of the HindIII enzyme, M cut the molecular weight standard of λ DNA for result such as Fig. 8; P is BamHI and HindIII double digestion pBI121-GmPLP1 plasmid; 1 and 2 is the transgenic positive plant, and ck is a wild-type tobacco) shown in, obtain the band of 1784bp, can find out that the GmPLP1 foreign gene is inserted in the genome of tobacco with single copy form.T ₂The result that generation is changeed pBI121 tobacco plant and wild-type tobacco does not have significant difference.

Two, the phenotype of GmPLP1 gene transgenic tobacco is observed

1, GmPLP1 gene transgenic tobacco deformation analysis

Positive T with results ₂In generation, changeed GmPLP1 tobacco plant and wild-type tobacco seed kind in the earth that contains 10% (quality percentage composition) turfy soil, and 25 ℃, 250 μ mol m ^-2Sec ^-1White light, long day (16h/8h light/dark) illumination box condition was cultivated 100 days, obtained the ripe plant of tobacco, the form (see figure 9) of observing the ripe plant of tobacco.Add up positive T ₂In generation, changeed the form of GmPLP1 tobacco plant and wild-type tobacco plant, comprises plant height, blade size (leaf area), and joint number, the internode distance, flowering time, diameter stem, the difference of branch situation is with T ₂In generation, changes the PBI121 tobacco and is contrast, wherein, and positive T ₂In generation, changeed totally 8 strains of GmPLP1 tobacco plant; Numbering is respectively GmPLP1-A, GmPLP1-B, GmPLP1-C, GmPLP1-D, GmPLP1-E, GmPLP1-F, GmPLP1-G-GmPLP1-H; Wild-type tobacco is totally 7 strains, and numbering is respectively ck-1, ck-2, ck-3, ck-4, ck-5, ck-6, ck-7; T ₂In generation, changeed totally 7 strains of PBI121 tobacco.

Concrete variate is seen table 5:

The phenotype of table 5 transgene tobacco is observed

Apart from leaf area diameter stem joint number flowering time whether numbering plant height internode

(cm) (cm) (cm2) (mm) (my god) branch

Ck-1 65.8 3.1 89.21 9.2 29 95 is not

Ck-2 62.5 2.8 92.54 8.6 25 90 is not

Ck-3 61.2 2.9 90.5 8.2 28 93 is not

Ck-4 59.7 2.9 87.37 8.3 28 92 is not

Ck-5 60.1 2.7 86.83 9.0 27 90 is not

Ck-6 66.3 3.2 93.46 9.4 25 94 is not

Ck-7 58.2 2.8 83.69 8.2 25 91 is not

GmpPLP1-A 45.8 1.6 63.6 6.2 26 122 is not

GmpPLP1-B 50.2 2.1 58.2 6.5 24 119 is not

GmpPLP1-C 46.7 1.9 55.4 5.9 25 108 is

GmpPLP1-D 44.3 1.6 59.1 6.1 25 118 is

GmpPLP1-E 47.2 1.9 60.8 6.1 27 120 is not

GmpPLP1-F 43.4 1.5 53.3 6 26 115 is

GmpPLP1-G 47.5 1.8 56.5 6.6 25 117 is not

GmpPLP1-H 44.6 1.5 52.2 6.4 27 112 is

Wild-type tobacco and T ₂Generation is changeed PBI121 tobacco plant result does not have significant difference.

Take pictures to observe and see shown in Figure 9ly, wherein, among the figure, 3 strains are wild-type tobacco plant (CK) before the left, remain the positive T of 4 strains ₂In generation, changeed the GmPLP1 tobacco plant.What wherein, draw a circle is branched position.

Associative list 5 and Fig. 9 can find out with wild-type tobacco and compare, T ₂Change that the GmPLP1 tobacco plant is short and small generation, blade diminishes simultaneously, and internode is apart from shortening, and flowering time prolongs, and branch occurs, and branch amount accounts for 50% ratio two or above plant.Wild-type tobacco and T ₂Generation is changeed PBI121 tobacco plant result does not have significant difference.

2, the deformation analysis after the reason of GmPLP1 gene transgenic tobacco dark place

Above-mentioned in the earth of 10% turfy soil, 25 ℃, 250 μ molm ²Sec ^-1White light, 30 days positive T of long day (16h/8h light/dark) illumination box condition growth ₂In generation, changeed the GmPLP1 tobacco and wild-type tobacco is respectively got 5 strains, transfers to 25 ℃, 250 μ mol m ^-2Sec ^-1White light continues to cultivate after 15 days in short day (8h/16h light/dark) illumination box, adds up long day and short day under at this moment blade area and internode distance respectively as follows, and results averaged is with T ₂In generation, changes the PBI121 tobacco and is contrast.

Short day is handled positive T down ₂It is 32.9cm that generation is changeed GmPLP1 tobacco plant blade area ², internode is apart from being 0.6cm, the wild-type tobacco blade area is 13.8cm ², the internode distance is 0.4cm, and the positive T of long day condition growth in following 45 days ₂It is 18.8cm that generation is changeed GmPLP1 tobacco plant blade area ², internode is apart from being 1.1cm, the wild-type tobacco blade area is 24.2cm ², internode can be found out positive T apart from being 1.6cm ₂The wild-type tobacco plant leaf reduces for changeing the GmPLP1 tobacco plant to handle the blade increase through short day, and the degree that the internode distance is dwindled is but less than the wild-type tobacco plant.

It is shown in figure 10 to take pictures, and is followed successively by from left that short day is handled the wild-type tobacco plant, short day is handled positive T ₂In generation, changeed the GmPLP1 tobacco, wild-type tobacco under the long day, positive T under the long day ₂In generation, changeed the GmPLP1 tobacco.Find out from Figure 10, compare that the root system of the plant that short day is handled is all little and lack with the plant that the long day handles.Wild-type tobacco and T ₂Generation is changeed PBI121 tobacco plant result does not have significant difference.

Three, change the physiological detection of GmPLP1 tobacco

1, changes the mensuration (growth conditions of photosynthetic rate and tobacco is relevant) of GmPLP1 tobacco photosynthetic rate

In the earth with 10% turfy soil, 25 ℃, 80 days positive T of long day (16h/8h light/dark) illumination box condition growth ₂In generation, changeed the GmPLP1 tobacco plant and the wild-type plant is cultivated storehouse (light intensity 250 μ molm at artificial climate ^-2Sec ^-1) carry out the mensuration of photosynthetic rate, select for use Lico-6400 photosynthetic rate appearance to measure, triplicate is with T ₂In generation, changes the PBI121 tobacco and is contrast, measures each eight strain of plant.

Method is: use this photosynthetic rate appearance directly to carry out the blade somatometry and get final product.Detected result is following: positive T ₂The photosynthetic rate that generation is changeed the GmPLP1 tobacco plant is 3.452 ± 0.026 μ mol dm ^-2h ^-1, wild-type plant photosynthetic rate is 3.246 ± 0.071 μ mol dm ^-2h ^-1, positive T ₂In generation, changes GmPLP1 tobacco plant photosynthetic rate and compares T ₂It is high that generation is changeed the PBI121 tobacco plant.Wild-type tobacco and T ₂Generation is changeed PBI121 tobacco plant result does not have significant difference.

2, the mensuration of transgene tobacco chlorophyll content

In order to verify whether can photosynthetic rate strengthen, and carried out measuring chlorophyll content.With 80 days the positive T of growth that obtains in above-mentioned 1 ₂In generation, change the GmPLP1 tobacco plant and the wild-type tobacco plant avoids the vein fresh blade of clip 0.2g respectively; Mill the back with 80% acetone (volumn concentration) extracting chlorophyll; Add 80% acetone constant volume to 25ml, be determined at light absorption value under wavelength 665nm, 649nm, the 470nm respectively with spectrophotometer.According to formula C _a=12.21A ₆₆₃-2.81A ₆₄₆C _b=20.13A ₆₄₆-5.03A ₆₆₃Chloroplast pigment massfraction (mg/g)=25ml * C * 10 ^-3* W calculates, with T ₂In generation, changes the PBI121 tobacco and is contrast.

The positive T of result ₂Total chlorophyll total content that generation is changeed the GmPLP1 tobacco plant is 1.428 ± 0.012mg/g, and total chlorophyll content 1.357 ± 0.013mg/g of wild-type plant finds out, positive T2 is slightly higher than the chlorophyll content of wild-type tobacco plant for changeing the GmPLP1 tobacco plant.Wild-type tobacco and T2 do not have significant difference for changeing PBI121 tobacco plant result.

3, the mensuration of all kinds of hormone-contents of transgene tobacco

To change the reason that this gene plant branch increases in order disclosing, to have measured positive T ₂In generation, changeed the variation of GmPLP1 tobacco plant and all kinds of hormone-contents of wild-type tobacco plant.Adopting enzyme-linked immunosorbent assay (ELISA) to carry out hormone-content measures.With T ₂In generation, changes the PBI121 tobacco and is contrast.

Get in the earth of 10% turfy soil, 25 ℃, 50 days T of long day (16h/8h light/dark) illumination box condition growth ₂Add 2ml sample extracting solution (80% methyl alcohol includes the 1mmol/L toluene di-tert-butyl phenol) for the GmPLP1 transgenic with each 0.5g of the fresh blade of contrast tobacco, ice bath grinds to form homogenate, changes in the 10mL test tube; Extract in placing 4 ℃ and spend the night, 3500rpm is centrifugal, and 8min gets supernatant, crosses the C-18 solid-phase extraction column; Cross the column purification sample and change in the 5mL pipe, dry up with nitrogen, (the 500mL phosphoric acid buffer adds 0.5mL Tween-20 with sample diluting liquid; 0.5g gelatin) be settled to 5mL, the enzyme plate (being a day Bioisystech Co., Ltd available from the farming of north, Beijing) that contains each hormone antibody is gone up appearance 50uL on every hole, 37 ℃ of competition 0.5h; Wash plate; Add the substrate colour developing, on the enzyme linked immunological spectrophotometer, measure light absorption value, calculate the content of each hormone according to typical curve.

Respectively get 3 samples, three repetitions are averaged ± standard deviation.Mensuration result is as shown in table 6:

Table 6 transgene tobacco hormone-content

Hormone-content (ng/gfw)

Type indolylacetic acid Plant hormones regulators,gibberellins dormin zein

Transgene tobacco 5185.13 ± 14.02 6127.73 ± 34.86 8166.50 ± 14.96 722.96 ± 20.99

Blank tobacco 3783.43 ± 7.40 5735.63 ± 24.53 6826.02 ± 21.00 818.52 ± 12.44

Can find out from last table, compare T with the wild-type tobacco plant ₂The various hormonal readinesses that generation is changeed the GmPLP1 tobacco plant rise at most except other several dormins all on the rise of zein.Wild-type tobacco and T ₂Generation is changeed PBI121 tobacco plant result does not have significant difference.

Four, the environment stress of transgene tobacco

In order to confirm whether this gene can start the adverse circumstance responsing reaction, the adverse circumstance experiment below having carried out:

With positive T ₂For changeing GmPLP1 tobacco plant and wild-type tobacco plant in the earth of 10% turfy soil, 25 ℃, long day (16h/8h light/dark) illumination box condition growth is done following processing after 50 days again;

Untreated fish group: above-mentioned seedling continues in illumination box, to cultivate 24h without any processing

0.5M NaCl treatment group: with above-mentioned seedling wash clean earth, avoid damaging root as far as possible, transfer to oxygenation water planting in the complete culture solution (containing a large amount of salt of MS substratum and molysite composition) that contains 0.5M NaCl, 24h is cultivated in the constant continuation of other conditions;

The 20%PEG treatment group: with above-mentioned seedling wash clean earth, avoid damaging root as far as possible, transfer to oxygenation water planting in the complete culture solution (containing a large amount of salt of MS substratum and molysite composition) that contains 20%PEG, 24h is cultivated in the constant continuation of other conditions; (PEG is kind of a permeate agent, can change the inside and outside osmotic pressure of plant materials, stops the plant suction, is the equal of that arid is handled)

High temperature (42 ℃) treatment group: it is in 42 ℃ the high-temperature cultivation case that above-mentioned seedling is moved on to temperature, and 24h is cultivated in the constant continuation of other culture condition;

Low temperature (4 ℃) treatment group: it is in 4 ℃ the low temperature incubator that above-mentioned seedling is moved on to temperature, and 24h is cultivated in the constant continuation of other culture condition;

More than each the group all with T ₂In generation, changes the PBI121 tobacco plant and is contrast.

A: observation plant wilting degree result sees shown in Figure 11,

Among the figure be two groups, two on the left side is high salt treatment group, and two on the right is arid treatment group, T ₂It is GmPLP1 that generation is changeed the GmPLP1 tobacco plant, and the wild-type tobacco plant is CK, can find out that 0.5M NaCl handles T behind the 24h ₂Generation commentaries on classics GmPLP1 tobacco is seriously wilted, and wild-type tobacco has just begun to occur the wilting phenomenon, and 20%PEG handles the T behind the 24h ₂In generation, changes the GmPLP1 tobacco leaf and occurs wilting, and the wild-type tobacco growth is normal, all shows the T of overexpression GmPLP1 gene ₂In generation, changeed the resistivity reduction of GmPLP1 tobacco to high salt and arid.Wild-type tobacco and T2 do not have significant difference for changeing PBI121 tobacco plant result.

B: the observation of transgene tobacco blade cell size and stomatal frequency

With positive T ₂In generation, changeed GmPLP1 tobacco plant and wild-type tobacco plant in the earth of 10% turfy soil, and 25 ℃, long day (16h/8h light/dark) illumination box condition growth 50 days, the blade of getting the 4th joint place is respectively avoided vein and is cut into big or small about 1cm ²The blade of size is put into the LUTARALDEHYDE stationary liquid, and vacuum is 24h fixedly, after the displacement of 20%, 30%, 50%, 80%, 90%, 100% ethanol, through trimethyl carbinol displacement, uses scanning electron microscopic observation after the lyophilize more respectively.With T ₂In generation, changes the PBI121 tobacco plant and is contrast.Observations sees that (open duck eye one by one is exactly a pore to Figure 12 among Figure 12, and open stoma number is directly relevant with drought resistance function, if the words stoma number of drought resisting can reduce.), among the figure, blank tobacco is a wild-type tobacco, the positive T of GmPLP1 transgene tobacco ₂In generation, changeed the GmPLP1 tobacco, can find out, compares positive T with the wild-type tobacco plant ₂In generation, changes GmPLP1 tobacco plant cell and obviously diminishes, and therefore, infers, transgene tobacco and offspring are short and small to be because cell diminishes made.Stoma number and no change reconfirm that this gene do not participate in drought resisting reaction on the transgene tobacco blade unit surface.Wild-type tobacco and T ₂Generation is changeed PBI121 tobacco plant result does not have significant difference.

The mensuration of C, transgene tobacco proline content, root system vigor, SOD tongue property

Measured positive T under high temperature (42 ℃), low temperature (4 ℃), 20%PEG, 5M NaCl handle respectively ₂In generation, changeed proline content, root system vigor, the active variation of SOD of GmPLP1 tobacco plant and wild-type tobacco plant.Measuring method with reference to " plant physiology experiment instruction " (Hao Zaibin, the storehouse is brilliant, Xu Zhong. press of Harbin Institute of Technology, February in 2006 the 2nd edition.) all put down in writing proline content, root system vigor, the active detailed detection method of SOD in this book), respectively there are 5 strains in each strain system, experiment triplicate, results averaged ± standard deviation.Mensuration result is as shown in table 7, and CK is the wild-type tobacco plant, the positive T of transfer-gen plant ₂In generation, changeed the GmPLP1 tobacco plant.Wild-type tobacco and T ₂Generation is changeed PBI121 tobacco plant result does not have significant difference.

Table 7 high salt, arid, transfer-gen plant under high temperature and the coldcondition

Proline content, root system vigor and SOD activity change

Treatment process

20%PEG 5MNaCl low temperature high temperature is untreated

Physiological value becomes changes the basic basic base commentaries on classics base commentaries on classics base that changes that changes

Change CK because of cigarette CK because of cigarette CK because of cigarette CK because of cigarette CK because of cigarette

Carelessly careless

Proline(Pro) contains 13.81 12.22 14.80 10.25 15.75 7.95 19.76 11.92 14.55 4.87

Amount (μ g/g) ± ± ± ± ± ± ± ± ± ±

0.36 0.23 0.36 0.38 0.30 0.09 0.30 0.31 0.31 0.26

Root system vigor 0.268 0.207 0.284 0.216 0.321 0.287 0.560 0.542 0.296 0.282

mg/g·h ± ?± ?± ?± ?± ?± ?± ?± ?± ?±

0.009 0.015 0.005 0.007 0.007 0.006 0.014 1.012 0.003 0.003

SOD active 0.815 0.614 1.234 1.150 1.105 0.924 0.814 0.733 1.754 1.646

U/g ± ± ± ± ± ± ± ± ± ±

0.042 0.011 0.028 0.033 0.078 0.029 0.008 0.002 0.020 0.007

The result is presented at high salt; Arid, under high temperature and the coldcondition, the proline content of transgene tobacco is lower than wild-type tobacco plant; Root system vigor increasing degree is also less than the wild-type tobacco plant; SOD enzymic activity vigor is littler than wild-type tobacco plant, has verified once more to have reduced plant by this gene of overexpression (under environment stress, proline(Pro), root system vigor, SOD enzymic activity all should increase substantially to resist the destruction of poor environment to vegetable cell to the adverse circumstance adaptive faculty; It is few more that these values raise, just low more to the adaptive faculty of adverse circumstance.)。

Acquisition of the genetically engineered soybean plant of embodiment 3, overexpression GmPLP1 gene and phenotype research

One, GmPLP1 crosses the acquisition of expressing soybean

1, hypocotyl conversion method

(the black farming 44 of kind available from Great Northern Wilderness kind industry Group Co.,Ltd, below becomes the wild-type soybean with soybean (Glycine max (L.) Merrill.).) chlorination is after 16 hours, plants that (MS+3% sucrose+0.8% agar pH5.8), cuts the long hypocotyl of 1cm as explant after seven days, soak 30min in the LBA4404/pBI121-GmPLP1 bacterium liquid that in by embodiment 2, obtains in germination medium; Blot the bacterium liquid on vegetable material surface with aseptic filter paper; Hypocotyl is lain in common culture medium (a large amount of salt of 1/2MS+MS molysite+1.67mg/L 6-benzyl aminopterin-induced syndrome+40 μ M Syringylethanones+1mg/L Sulfothiorine+1mg/L halfcystine+1.0mg/L WR 34678+3% sucrose+0.8% agar that are covered with one deck filter paper; PH5.6) on; 25 ℃ of dark cultivations 3 days; Hypocotyl after cultivating altogether is transferred to bud division culture medium (a large amount of salt of 1/2MS+MS molysite+3mg/L 6-BA+3% sucrose+20mg/L ceftriaxone sodium+0.8% agar; PH5.8); Vegetative point inserts in the substratum up, cultivates a week, and periodicity of illumination is 16h/8h (illumination/dark); Be transferred to bud screening culture medium (a large amount of salt of 1/2MS+MS molysite+1mg/L 6-benzyl aminopterin-induced syndrome+0.2mg/L indole-3-butyric acid+75mg/L kantlex+20mg/L ceftriaxone sodium+3% sucrose+0.8% agar afterwards; PH5.8;) cultivate the 1-2 month, during every at a distance from 10 days subcultures once, grow to 1cm when high until resistant buds; Downcut budlet and change root media (a large amount of salt of 1/2MS+MS molysite+1mg/L indole-3-butyric acid+75mg/L kantlex+20mg/L ceftriaxone sodium+3% sucrose+0.8% agar over to; PH5.8), form adventive root after 15 days, transplant and obtain 12 strain T ₀For overexpression GmPLP1 soybean seedling, process is seen Figure 13.

2, Molecular Identification

T ₀After transplanting a week for overexpression GmPLP1 soybean seedling, take blade and extract genomic dna, carry out PCR and identify.Owing in the soybean gene group, have the GmPLP1 gene, so PCR identifies that the primer that adopts is that 35SCaMV promotor and gene combine primer (sense primer: ATGACGCACAATCCCACTATCC; Antisense primer: GAACCCGAAATCCCTCACTCC).Reaction conditions: 94 ℃ of 5min; 35 circulations: 94 ℃ of 20s, 58 ℃ of 30s, 72 ℃ of 1min; 72 ℃ of 5min.The result sees Figure 14, and plasmid is pBI121-GmPLP1, and 1-5 is T ₀For overexpression GmPLP1 soybean plant strain, ck is the wild-type soybean, obtains size and is the positive T of fragment of 668bp ₀For overexpression GmPLP1 soybean plant strain, obtain the positive T of 3 strains altogether ₀For overexpression GmPLP1 soybean plant strain, with T ₀The seed that generation is changeed GmPLP1 soybean plant strain selfing generation reaches the plant called after T by it grew up to ₁For overexpression GmPLP1 soybean plant strain, with T ₁For overexpression GmPLP1 soybean plant strain self progeny called after T ₂For overexpression GmPLP1 soybean plant strain.

Adopting uses the same method changes empty carrier pBI121 in the soybean (black farming 44) over to, obtains T ₀In generation, changeed the pBI121 soybean plant strain, with T ₀The seed that generation is changeed GmPLP1 soybean plant strain selfing generation reaches the plant called after T by it grew up to ₁In generation, changeed the pBI121 soybean plant strain, with T ₁In generation, changeed pBI121 soybean plant strain self progeny called after T ₂In generation, changeed the pBI121 soybean plant strain.Adopt aforesaid method to carry out PCR and identify (sense primer: ATGACGCACAATCCCACTATCC; Antisense primer: GAACCCGAAATCCCTCACTCC), the result does not change in the pBI121 soybean plant strain for the GmPLP1 of external source.

With the above-mentioned T that obtains ₂For overexpression GmPLP1 soybean young leaflet tablet, extract RNA and carry out RT-PCR.T ₂For the primer (concrete sequence see table 8) of overexpression GmPLP1 soybean plant strain with the selectable marker gene NPTII on the PBI121 carrier, qualification result is seen Figure 15, and among Figure 15, plasmid is pBI121-GmPLP1, and all the other swimming lanes are T ₂For overexpression GmPLP1 soybean plant strain, ck is the wild-type soybean, and the result is the fragment that obtains 661bp, shows, external source GmPLP1 can cross in soybean and express.

Table 8 genetically engineered soybean is identified the primer

NPTII gene primer primer sequence (5 ' → 3 ')

Sense primer GATTGCACGCAGGTTCTCC

Antisense primer CGGGTAGCCAACGCTATGTC

Two, the phenotype of GmPLP1 gene overexpression soybean is observed

With T ₂In the earth of 10% turfy soil, 25 ℃, T is observed in long day (16h/8h light/dark) illumination box condition growth 90 days for overexpression GmPLP1 soybean and wild-type soybean plant strain ₂For the morphological differences of overexpression GmPLP1 soybean plant strain and wild-type soybean plant strain, concrete data are following: statistics T ₂For the plant height of overexpression GmPLP1 plant and wild-type, blade size (leaf area), joint number, the internode distance, flowering time, diameter stem, the difference of branch situation is with T ₂In generation, changes the pBI121 soybean plant strain and is contrast, wherein, and positive T ₂For totally 3 strains of overexpression GmPLP1 tobacco plant, numbering is respectively GmPLP1-1, GmPLP1-2, GmPLP1-3, and the wild-type soybean is totally 3 strains, and numbering is respectively ck-1, ck-2, ck-3; T ₂In generation, changeed totally 3 strains of PBI121 soybean.

Concrete variate is seen table 9:

The phenotype of table 9 overexpression GmPLP1 soybean is observed

(cm) (cm) (cm2) (mm) (my god) branch

Ck-1 46.8 7.1 45.59 4.2 6 47 is not

Ck-2 46.9 6.5 48.13 4.5 5 46 is not

Ck-3 47.2 5.2 49.22 4.0 5 48 is not

GmPLP1-1 64.2 6.8 76.14 4.2 9 42 is

GmPLP1-2 68.4 8.1 60.26 4.0 8 39 is

GmPLP1-3 59.2 9.7 68.57 4.2 7 41 is not

Wild-type soybean and T ₂Generation is changeed PBI121 soybean plant strain result does not have significant difference.

It is shown in figure 16 to take pictures, and wherein, the positive T2 of A is for overexpression GmPLP1 soybean, and B is the wild-type soybean, and associative list 9 can be found out with Figure 16, compare T with the wild-type soybean plant strain ₂Increase for overexpression GmPLP1 soybean plant strain branch, but plant is tall and big, it is big that blade becomes, and florescence and ripening stage all shift to an earlier date.Ripening stage is meant complete stool 90% or 100% dried pod time, at T2 for overexpression GmPLP1 soybean plant strain during at about 95 days blade and pod begun yellow and got into the ripe phase, comparison is according to ripening stage of plant clearly ahead of time nearly about 7-10 days.Wild-type soybean (black farming 44) and T ₂The result that generation is changeed the PBI121 soybean plant strain does not have significant difference.

Can find out from above-mentioned experiment; Tobacco (the Nicotiana tabacum that transforms; Kind is a kind of long-day crop for Petite HavanaSR1) ((the black farming 44 of Glycine max (L.) Merrill. kind is a kind of short day crop) is two kinds of different photoperiodism plants, and the change to flowering time and plant forms on these two kinds of crops of this gene of overexpression is just in time opposite with soybean.

Claims

1. a protein is following 1) or 2) protein:

Said plant trait is following 1)-10) at least a:

2. the said proteinic encoding sox of claim 1.

3. according to claim 1 or 2 said encoding soxs, it is characterized in that: said encoding sox is following 1), 2), 3), 4) or 5) gene:

1) dna molecular shown in the sequence 1 in the sequence table;

Said plant trait is following 1)-8) at least a:

1) branch amount; 2) flowering time; 3) plant height; 4) blade area; 5) internode distance; 6) root is long; 7) photosynthetic rate; 8) resistance of reverse.

4. the recombinant vectors, transgenic cell line, reorganization bacterium or the expression cassette that contain claim 2 or 3 said encoding soxs.

5. recombinant vectors according to claim 4 or reorganization bacterium is characterized in that: the recombinant vectors that said recombinant vectors obtains for MCS insertion claim 2 or 3 said encoding soxs at carrier pBI121; Said reorganization bacterium is for importing the reorganization bacterium that the host bacterium obtains with the described recombinant vectors of claim 4.

6. amplification claim 2 or 3 said encoding sox total lengths or arbitrary segmental primer are right, and said primer is to as follows: a primer sequence is shown in sequence in the sequence table 4, and another primer sequence is shown in sequence in the sequence table 5.

7. method of cultivating transgenic plant, for claim 2 or 3 described encoding soxs are imported the transgenic plant that the purpose plants obtain, said transgenic plant are following 1)-6) at least a:

1) branch amount of said transgenic plant is more than said purpose plant;

2) flowering time of said transgenic plant is early than said purpose plant;

3) plant height of said transgenic plant is higher than said purpose plant;

4) blade area of said transgenic plant is greater than said purpose plant;

6) joint number of said transgenic plant is more than said purpose plant;

Said purpose plant is a short day plant, and said short day plant is preferably soybean.

8. method of cultivating transgenic plant, for claim 2 or 3 described encoding soxs are imported the transgenic plant that the purpose plants obtain, said transgenic plant are following 1)-8) at least a:

1) branch amount of said transgenic plant is more than said purpose plant;

2) flowering time of said transgenic plant is later than said purpose plant;

3) plant height of said transgenic plant is lower than said purpose plant;

4) blade area of said transgenic plant is less than said purpose plant;

6) diameter stem of said transgenic plant is less than said purpose plant;

9. method according to claim 8 is characterized in that:

The branch amount of said transgenic plant all is higher than said purpose plant more than the hormone-content in the present said transgenic plant of said purpose plant materials; Said hormone is indolylacetic acid, Plant hormones regulators,gibberellins, dormin or zein;

1) said transgenic plant proline content is lower than said purpose plant;

2) said transgenic plant root system vigor is lower than said purpose plant;

2) said transgenic plant superoxide-dismutase enzymic activity is lower than said purpose plant;

Said high temperature is 42 ℃, and said low temperature is 4 ℃;

Said purpose plant is a long day plant, and said long day plant is preferably tobacco.

10. the application of the said protein of claim 1 in breeding, or claim 2 or 3 application of said encoding sox in breeding, or claim 4 or 5 application of said recombinant vectors in breeding, or claim 4 or 5 application of said reorganization bacterium in breeding.