CN102443594A

CN102443594A - Receptor activator of nuclear factor kappa B ligand (RANKL)-HBaAg expression constructing object, yeast, manufacture method as well as application

Info

Publication number: CN102443594A
Application number: CN2010105075788A
Authority: CN
Inventors: 何成; 楼觉人
Original assignee: SHANGHAI INSTITUTE OF BIOLOGICAL PRODUCTS CO LTD
Current assignee: SHANGHAI INSTITUTE OF BIOLOGICAL PRODUCTS CO LTD
Priority date: 2010-10-15
Filing date: 2010-10-15
Publication date: 2012-05-09
Anticipated expiration: 2030-10-15
Also published as: CN102443594B

Abstract

The invention provides a constructing object for expressing receptor activator of nuclear factor kappa B ligand (RANKL)-HBaAg recombinant protein and a preparation method thereof. The constructing object comprises 1 to 15 expression boxes, wherein each expression box comprises an initiating signal element alternative oxidase (AOX) (a), RANKL-HBsAg recombinant protein coding sequences (b) and a termination signal element AOX (TT). The invention also provides yeast cells, virus-like particles and a purpose of the particles, wherein the yeast cells comprise the constructing object, the virus-like particles are generated by the yeast cells and comprise the RANKL-HBsAg recombinant protein. The yeast cells constructed in the invention can be used for generating a large amount of RANKL-HBsAg recombinant protein, so the RANKL-HBsAg recombinant protein is used for treating or preventing diseases or symptoms such as osteoporosis and the like relative to RANK/RANKL/ osteoprotegerin (OPG) systems.

Description

RANKL-HBsAg expression constructs, yeast, method for making and application

Technical field

The present invention relates to biotechnology and immune field; In particular to a kind of express recombinant NF-κ B receptor activation factor part (receptor activator of NF-κ B ligand; RANKL)-hepatitis B surface antigen (hepatitis Bsurface antigen, yeast cell HBsAg), the construction that is used for transformed yeast cell, their construction process and purposes.

Background technology

Bone is a dynamic organization, in the whole life of biology, constantly makes up, absorbs, rebuilds.When scleroblast constantly forms new osteocyte, induce osteoclast again and come constantly to dissolve the absorption sclerotin.Osteoclast is attached at bone surface, dissolves sclerotin through discharging acidic medium and proteolytic enzyme, on the one hand, forms absorption lacuna and supplies scleroblast to form new osteocyte, on the other hand, keeps the pulp cavity volume and is not occupied by sclerotin.Thereby the meaning of bone process of reconstruction is the accumulation that prevents the osseous tissue fatigue damage and keeps the stable of biomechanics characteristic.

The NF-κ B receptor activation factor (RANK; Receptor activator of NF-κ B), its part RANKL and protect ossein (OPG osteoprotegerin) belongs to tumour necrosis factor and receptor superfamily thereof, and the RANK/RANKL signal is responsible for the differentiation and the activation of osteoclast; OPG then is the false acceptor of RANKL; The competitive RANKL that combines stops combining between RANKL and the RANK, and the three is through the differentiation of regulation and control osteoclast and the process that activation influences bone resorption and reconstruction.The triangle regulation system that RANK/RANKL/OPG forms becomes basis (Rauner M etc., Osteoimmunology.Int Arch Allergy Immunol.2007,143 (1): 31-48) that bone is rebuild regulation and control.

Secondary cases osteopathy and disease that the unbalance and multiple bone metabolic disease of RANK/RANKL/OPG system and disease of immune system cause are closely related; Include, but is not limited to: osteoporosis, rheumatoid arthritis (RA), part bone tumor (like giant cell tumor of bone, osteosarcoma, multiple myeloma), other tumour (like mammary cancer, prostate cancer), angiosteosis and relative disease (the Ann EK etc. such as (like arteriosclerosis, angiostenosis, cerebral embolism, myocardial infarction, kidney calcifications) that cause thereof; Endocr Rev.2008,29 (2): 155 192.).

Osteoporosis is that a kind of destruction with low bone amount and osseous tissue microstructure is characteristic, the metabolic osteopathy that causes sclerotin fragility to increase and be easy to fracture.About 200,000,000 people in the whole world suffer from osteoporosis at present, and its sickness rate has leapt to common disease, frequently-occurring disease the 7th, and the inland of China total prevalence rate is 12.4%, and ill ratio is above over half among the elderly, and the incidence of wherein fracturing is near 1/3rd.Osteoporosis is widely current in all over the world, and the heavy damage patient body is healthy, influences its quality of life, brings heavy economical load for patient, family and society.Along with the arrival of world population aging trend, osteoporosis has become worldwide public health problem.

The incidence and development of osteoporosis is directly related with the RANK/RANKL/OPG system, and the RANK/RANKL/OPG system receives the regulation and control from many-sided factors such as immunity system, endocrine system and hemopoietic systems.Along with the increase at age, human hormone's level can descend day by day, and especially postmenopausal women's oestrogenic hormon decline level is the most obvious.The decline of hormonal readiness can cause the rise of RANKL expression and the downward modulation that OPG expresses, and the RANKL/OPG ratio is unbalance.The RANKL that loses blocking-up activates osteoclast, makes the osseous tissue taken in excess, causes sclerotin to run off in a large number, causes osteoporosis.Therefore, block excessive morbific RANKL and become the important means that treatment comprises the unbalance disease of system of osteoporosis.

For example; Denosumab; A kind of high-affinity high specific RANKL monoclonal antibody got into the clinical study of diseases such as osteoporosis, rheumatoid arthritis, multiple myeloma, mammary cancer and prostate cancer as the representative of anti-RANKL treatment, and its curative effect obtains to affirm (Edward MS through the demonstration of a large amount of experiments and clinical data; Arthritis Res Ther.2007,9 Suppl 1:S7).

Yet, still press in this area to develop and can be used for the osteopathia that effectively treatment is relevant with the RANK/RANKL/OPG system or the medicine of other disease.

HBsAg is the envelope protein of hepatitis B virus, and it can spontaneous assembling form the 22nm virus-like particle, has strong immunogenicity, and it has been applied to the expression of hepatitis C virus E 2 albumen hypervariable region and human papillomavirus E7 albumen etc. as protein carrier.Yet this area is used to combine some to be difficult to the causal organism albumen of challenge with HBsAg as carrier proteins mostly, and does not attempt combining oneself protein to break the autoimmunization tolerance with it.

In the expression of recombinant proteins field, the expression vector that obtain the high expression level amount depends on numerous factors.Arrangement mode of each copy etc. among each combination of elements mode, the high copy clone in each element in the expression cassette that for example expressed proteinic character, the phraseology that is adopted is relevant, adopted, the expression cassette.Therefore, the recombinant protein working method that cost is cheaper, step is easier, expression amount is higher still need be developed in this area.

In sum, press in this area to develop and can be used for the osteopathia that effectively treatment is relevant with the RANK/RANKL/OPG system or the medicine of other disease, and the effective ways of this medicine of generation are provided.

Summary of the invention

Main purpose of the present invention just providing a kind of stable high expression level RANKL-HBsAg recombinant protein construction, comprise yeast cell of this construction and preparation method thereof, and with this recombinant protein treatment or the prevention disease relevant and the method and the purposes of symptom with RANK/RANKL/OPG.

In first aspect of the present invention; A kind of construction that is used to express the RANKL-HBsAg recombinant protein is provided; Said construction contains the expression cassette of 1 expression cassette or 2-15 arranged in series, and each said expression cassette comprises following element: (a) start signal element AOX; (b) RANKL-HBsAg recombinant protein encoding sequence; Said RANKL-HBsAg recombinant protein encoding sequence is by forming with the lower section: (i) RANKL albumen coded sequence; (ii) HBsAg encoding sequence, and (iiii) the optional connection peptides encoding sequence between RANKL and HBsAg encoding sequence; (c) termination signal element AOX (TT).

In a preference, corresponding, said RANKL-HBsAg recombinant protein is made up of optional RANKL albumen and the HBsAg albumen that connects through connection peptides.

In an embodiment of the invention, the aminoacid sequence of said RANKL-HBsAg recombinant protein is shown in SEQID NO:8.

In a preference, said RANKL encoding sequence has sequence shown in SEQ ID NO:3 or 5, or is their homologous sequence, is preferably sequence shown in the SEQ ID NO:5.In another preference, said HBsAg albumen coded sequence has sequence shown in the SEQ ID NO:1 or is its homologous sequence, sequence shown in the preferred SEQ ID NO:1.In another preference, said construction is a fundamental construction with the pPIC3.5K plasmid.

In second aspect of the present invention; A kind of yeast cell of the RANKL-HBsAg of expression recombinant protein is provided; It is characterized in that; Be integrated with the construction of expressing the RANKL-HBsAg recombinant protein in the karyomit(e) of said yeast cell, said construction contains the expression cassette of 1 expression cassette or 2-15 arranged in series, and each said expression cassette comprises following element: (a) start signal element AOX; (b) RANKL-HBsAg recombinant protein encoding sequence; Said RANKL-HBsAg recombinant protein encoding sequence is by forming with the lower section: (i) RANKL albumen coded sequence; (ii) HBsAg encoding sequence, and (iiii) the optional connection peptides encoding sequence between RANKL and HBsAg encoding sequence; (c) termination signal element AOX (TT); Wherein, said yeast cell is being induced expression RANKL-HBsAg recombinant protein down, and the being made by manufacturers or users in said yeast of described recombinant protein becomes virus-like particle.

In a preference; Said inducing is to induce with glycerine mixing feed supplement with methyl alcohol or methyl alcohol; Particular methanol is induced with glycerine mixing feed supplement and (so-called mixed feed supplement and be meant that stream adds two kinds of feed liquids simultaneously; Two kinds of feed supplement speed all can be carried out real-time regulated according to fermentation parameter, rather than carry out feed supplement after mixing by a certain percentage).

In an embodiment of the invention, said yeast cell is selected from: pichia spp, yeast saccharomyces cerevisiae or debaryomyces hansenii.

In a preference, said yeast cell is a pichia spp.In another preference, said yeast cell is preferably GS115 bacterial strain, SMD1163 bacterial strain or KM71 bacterial strain, more preferably GS115 bacterial strain.In another preference, contain 3-12 in the said construction, more preferably 4-10 is individual, most preferably the hepatitis B surface antigen expression cassette of 5-8 arranged in series.

In yet another embodiment of the present invention, said virus-like particle is showed in the surface with RANKL, and can stimulate immune system to produce anti-RANKL antibody.

In the third aspect of the invention, a kind of RANKL-HBsAg of comprising recombinant protein virus-like particle is provided, said virus-like particle is that yeast cell of the present invention produces.

In a preference, said virus-like particle is showed in the surface with RANKL, and can stimulate immune system to produce anti-RANKL antibody.

In fourth aspect of the present invention, a kind of method of the RANKL-HBsAg of preparation recombinant protein is provided, it comprises: (i) be fit to cultivate yeast cell of the present invention under the condition of expressing, thereby making it express the RANKL-HBsAg recombinant protein; (ii) separation and purification RANKL-HBsAg recombinant protein from said yeast cell.

In a preference; The condition of the said suitable expression in the step (i) comprises: adopt the mixture or their combination of methyl alcohol, glycerine, methyl alcohol and glycerine to carry out feed supplement; Preferably adopt the glycerine feed supplement at earlier fermentation, the mixture of middle and later periods with methyl alcohol and glycerine carries out feed supplement fermenting.In a preference, step (ii) comprises: bacterial cell disruption, sample pre-treatments, deposition, centrifugal, filtration, chromatography or their combination.Preferably, said bacterial cell disruption is high-pressure homogeneous fragmentation.Preferably, said sample pre-treatments is in the thalline of fragmentation, to add Triton X-100 and/or DNase.Preferably, said deposition is to adopt ammonium sulfate to precipitate.Preferably, said chromatography is hydrophobic chromatography, ion exchange chromatography or their combination.Preferably, saidly be filtered into micro-filtration, ultrafiltration or their combination.

In a preference, said method also comprise to step (ii) the recombinant protein that obtains of separation and purification identify that preferred said evaluation adopts methods such as Western blotting, N end order-checking evaluation, protein concn BCA assay method to carry out.

In aspect the of the present invention the 5th, a kind of RANKL-HBsAg recombinant protein is provided, said recombinant protein is expressed by construction of the present invention and is produced, produced by yeast cell of the present invention, or prepare through method of the present invention.

In aspect the of the present invention the 6th, the purposes of yeast cell of the present invention, virus-like particle or RANKL-HBsAg recombinant protein is provided, it is used to prepare the vaccine of prevention or treatment RANK/RANKL/OPG system's relative disease or symptom.

In an embodiment of the invention, said RANK/RANKL/OPG system's relative disease or symptom are selected from: disease that osteoporosis, rheumatoid arthritis, bone tumor, mammary cancer, prostate cancer, angiosteosis or angiosteosis cause and symptom.

In a preference, said bone tumor is selected from: giant cell tumor of bone, osteosarcoma or multiple myeloma.In another preference, relative disease and symptom that said angiosteosis causes are selected from: arteriosclerosis, angiostenosis, cerebral embolism, myocardial infarction or kidney calcification.

In aspect the of the present invention the 7th, a kind of vaccine composition is provided, it comprises: (a) RANKL-HBsAg recombinant protein of the present invention; And (b) acceptable carrier and/or adjuvant on the immunology.In a preference, said vaccine composition also comprises Thiomersalate, formaldehyde or saline water.

In eight aspect of the present invention; The method that makes up construction of the present invention is provided; Said method comprises: (1) is inserted RANKL-HBsAg recombinant protein encoding sequence fixed point and is comprised in the plasmid of start signal element AOX and termination signal element AOX (TT), to obtain single copy expression plasmid; (2) said single copy expression plasmid is transformed to obtain complete expression cassette; (3) said expression cassette is repeated to insert in the said plasmid, thereby acquisition contains the construction of the said expression cassette of 2-15 arranged in series.

In a preference, said plasmid is selected from: pPIC3.5 (K) plasmid, pAO815 or pHIL-D2.In another preference, in the step (2) said single copy expression plasmid transformed through PCR and carry out.In another preference, in the step (3) said expression cassette repeated to insert in the said plasmid to insert through the isocaudarner fixed point and carry out.In another preference, said method also comprises the construction with intestinal bacteria amplification gained.

In aspect the of the present invention the 9th; Provide the present invention to express the preparation method of the yeast cell of RANKL-HBsAg recombinant protein; Said method comprises step: with construction transformed yeast cell of the present invention; Described construction is integrated in the yeast chromosomal, thereby obtains yeast cell of the present invention.In a preference, said conversion is carried out through electricity conversion, protoplast transformation.

In should be understood that within the scope of the present invention, above-mentioned each technical characterictic of the present invention and specifically described each technical characterictic can mutual combination in (like embodiment) hereinafter, thus constitute new or optimized technical scheme.As space is limited, this tired no longer one by one stating.

Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.

Description of drawings

Shown in Figure 1 is overlapping extension PCR point mutation synoptic diagram (1A) and sudden change reconstruction structure figure (1B).

Shown in Figure 2 is that overlapping extension PCR gene fragment merges synoptic diagram (2A) and electrophorogram (2B).

Shown in Figure 3 is electrophorogram (3A) and the structural representation (3B) thereof that single copy plasmid is identified through double digestion.

Shown in Figure 4ly cut evaluation figure (4B) for the building process synoptic diagram (4A) of high copy expression plasmid and enzyme.

Shown in Figure 5 is the ELISA electron microscopic observation result (5C) of (5B) and RANKL-HBsAg virus-like particle relatively of recombination form synoptic diagram (5A), RH and the RH8C expression amount of recombinant expressed group of pichia spp RANKL-HBsAg.

Shown in Figure 6 is methanol feeding and the comparison that mixes feed supplement in the fermentation of 15L fermentor tank pilot scale.

Shown in Figure 7 is the SDS-PAGE and the western blotting result (sample before 7B:1, the purifying of preferred RANKL-HBsAg purifying flow process (7A) and sample purifying front and back; 2, sample behind the purifying; 3, negative control).

Shown in Figure 8 is the collection of illustrative plates of RANKL recombinant plasmid.

Shown in Figure 9 is the purifying flow process (9A) of RANKL and SDS-PAGE and western blotting result (9B:1, the negative control before and after the sample purifying; 2, sample before the purifying; 3, sample behind the purifying).

Shown in Figure 10 is that the situation that induces (10A) of different RANKL-HBsAg immunizing dose groups antagonism RANKL antibody and the antibody titers of mixed immunity serum are measured (10B).

The immune serum blocking-up RANKL that measures for mtt assay shown in Figure 11 suppresses RAW264.7 cel l proliferation (11A), immune serum is blocked TRAP dyeing observations (11B) and the timely result of osteoclast (11C) that RANKL inductive RAW264.7 cytodifferentiation is tested.

Shown in Figure 12 is the result of study of RANKL-HBsAg to acting in the OPG knock out mice body, comprising: the result (12A) who detects the anti-RANKL antibody producing of mice serum situation with indirect ELISA; Mouse femur results of three (12B and 12C); And micro-(40 times) structure observation (Figure 12 D) of mouse shin bone embedded section.

Embodiment

Contriver of the present invention is through long-term and deep research; Screened the expression cassette that constitutes by different elements in a large number; Made up and can be used for efficiently expressing RANKL-HBsAg Recombinant Protein Expression box; And obtain to comprise the yeast cell of single copy or this expression cassette of multiple copied, make its high expression level have immunocompetent RANKL-HBsAg albumen.The contriver discovers that further RANKL-HBsAg albumen of the present invention can induce object to produce the neutralizing antibody to RANKL, thereby can be used for treating RANK/RANKL/OPG system relevant disease and symptom.On this basis, the inventor has accomplished the present invention.

Particularly, the contriver extracts mRNA and carries out RT-PCR from the scleroblast that BMP-2 induces human mesenchymal stem cell to be differentiated to form, obtain the cDNA of RANKL.Through overlapping extension PCR the N that the RANKL gene fragment is blended in the HBsAg gene fragment is held, middle continuous with the connection peptides gene order.The RANKL-HBsAg fragment is inserted during plasmid pPIC3.5K changes, and obtained the high copy number expression plasmid through the mode of inserting the RANKL-HBsAg expression cassette repeatedly.Then, plasmid is transformed in the pichia spp GS115 bacterial strain, obtains the high copy number expression strain.Use the 15L fermentor tank that the engineering bacteria methanol induction is fermented.The contriver has confirmed that through means such as SDS-PAGE, ELISA, Western Blot Electronic Speculum and the order-checkings of N end RANKL-HBsAg is correctly expressed and the spontaneous formation virus-like particle of ability.

Subsequently, the contriver carries out purification steps such as fragmentation, centrifugal, ammonium sulfate precipitation, micro-filtration, ultrafiltration, hydrophobic chromatography and ion exchange chromatography to the thalline sample of results and investigates, and sums up and draws the purification process of optimization, has obtained the RANKL-HBsAg of purifying.

The contriver adopts and with sample mix aluminium adjuvant behind the purifying Balb/c mouse is carried out immunity, detects anti-RANKL antibody generation situation in its immune serum, confirms that RANKL-HBsAg can induce body to produce the antibody to RANKL.Detect immune serum and RANKL is induced the influence of RAW264.7 cytodifferentiation and inhibited proliferation; To investigate the extracorporeal neutralizing activity of anti-RANKL antibody, confirmed that the anti-RANKL antibody of immune generation can be blocked RANKL inductive RAW264.7 cytodifferentiation and propagation inhibition phenomenon.With RANKL-HBsAg immunity OPG knock out mice osteoporosis model, confirmed the cylinder therapeutic effect of RANKL-HBsAg to osteoporosis through measuring and observe bone density, biomechanics of bone parameter and bone micro-structure etc.

On the basis of above-mentioned research; The contriver thinks that the recombinant expressed RANKL-HBsAg of the present invention can induce body to produce anti-RANKL antibody; The antibody that is produced has to the neutralization of RANKL active; Can block the RANK/RANKL path, thereby can be used for preventing and/or treating disease relevant or symptom, for example osteoporosis etc. with this path.

As used herein, have comprised " containing ", " having " or " comprising " " comprising ", " mainly by ... constitute ", " basically by ... constitute " and " by ... constitute "; " mainly by ... constitute ", " basically by ... constitute " belong to the subordinate concept of " containing ", " having " or " comprising " with " by ... formation ".

As used herein, " isolating " or " separation and purification " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification like polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.

Hepatitis B surface antigen (HBsAg) and NF-κ B receptor activation factor part (RANKL)

As used herein; Term " hepatitis B surface antigen " or " HBsAg " interchangeable use; All refer to comprise hepatitis B surface antigen aminoacid sequence as known in the art (the for example aminoacid sequence shown in the SEQ ID NO:2), its conservative property variant protein matter or its active fragments or aminoacid sequence wherein through 1-20 (preferred 1-10; More preferably 1-5) replacement, disappearance or the interpolation of amino-acid residue form; And can induce body to produce the protectiveness neutralizing antibody, with the antigen of prevention HBV infection.

As used herein; Term " NF-κ B receptor activation factor part " or " RANKL " interchangeable use; All refer to comprise RANKL aminoacid sequence as known in the art (the for example aminoacid sequence shown in SEQ ID NO:4 or the SEQ ID NO:6), its conservative property variant protein matter or its active fragments or aminoacid sequence wherein through 1-20 (preferred 1-10; More preferably 1-5) replacement, disappearance or the interpolation of amino-acid residue form, and have the antigen with RANK bonded ability.

Should understand through conservative substituted sequence mentioned above and also can be used for the present invention; Preferred reactive derivative refers to compare with the original acid sequence, has 5 at the most, preferably at the most 3; More preferably at the most 2,1 amino acid is replaced by similar performance or close amino acid and is formed polypeptide best.

As used herein; Term " hbsag gene/encoding sequence ", " HBsAg gene " interchangeable use all refer to comprise the sequence shown in the SEQ ID NO:1 of the present invention or it is through nucleotide sequence genetic engineering modified and that can express generation hepatitis B surface antigen of the present invention.As used herein; Term " RANKL gene ", " RANKL encoding sequence " interchangeable use; All refer to comprise the sequence shown in the SEQ ID NO:3 of the present invention or its through genetic engineering modified (like SEQ ID NO:5), and can express and produce the proteic nucleotide sequence of RANKL of the present invention.

In an embodiment of the invention; Can obtain described encoding sequence through conventional molecular biology method; Said method can be according to people such as normal condition such as Sambrook; Condition described in " molecular cloning: lab guide " (New York:Cold Spring Harbor Laboratory Press, 1989) is carried out.

RANKL-HBsAg recombinant protein and encoding sequence thereof

As used herein; Term " RANKL-HBsAg recombinant protein " or " RH recombinant protein " are meant and obtain through genetic engineering means; Be blended in HBsAg gene or its segmental N end by RANKL gene or its fragment; And optional therebetween by the connection peptides encoding sequence formed recombinant protein that links to each other, shown in recombinant protein have the activity of inducing anti-RANKL antibody.Preferred recombinant protein of the present invention is nucleotide sequence coded by SEQ ID NO:7's, and its aminoacid sequence is shown in SEQ ID NO:8.

Recombinant protein of the present invention can have or not have connection peptides.When connection peptides existed, it comprised 1-25 amino acid usually, preferred 5-20 amino acid, and more preferably 8-15 amino acid, preferred said connection peptides sequence is GGGGSGGGGGS (the 180-190aa place of SEQ ID NO:8).

In system of the present invention, the encoding sequence of RANKL-HBsAg recombinant protein can be able to efficiently express, to produce required RANKL-HBsAg recombinant protein.RANKL in this encoding sequence and HBsAg sequence can be passed through genetic engineering modified (like point mutation) with the structure that is more suitable for expression cassette and expression but still keep its due activity.The fusion of gene fragment can adopt usual manner as known in the art to carry out.

Express the construction and the structure thereof of RANKL-HBsAg recombinant protein

As used herein, term " RANKL-HBsAg expression cassette " or " RH expression cassette " are meant the expression cassette with following element that obtains through the inventive method: (a) start signal element AOX; (b) RANKL-HBsAg recombinant protein encoding sequence; (c) termination signal element AOX (TT).

The preparation method of expression cassette of the present invention comprises the steps: that (1) comprises the encoding sequence fixed point insertion of RANKL-HBsAg recombinant protein in the plasmid of start signal element AOX and termination signal element AOX (TT), to obtain single copy expression plasmid; (2) said single copy expression plasmid is transformed to obtain complete RANKL-HBsAg expression of recombinant proteins box.

In preferred implementation of the present invention, the plasmid that is adopted can be: pPIC3.5 (K), pAO815 or pHIL-D2 etc., as long as it contains start signal element AOX and termination signal element AOX (TT); Preferred pPIC3.5 (K) plasmid.

Can the encoding sequence fixed point of RANKL-HBsAg recombinant protein be inserted between the 5AOX1 and 3AOX (TT) of plasmid, preferably insert between EcoRI restriction enzyme site and the NotI restriction enzyme site.Can adopt the amplification from the single copy expression plasmid that has made up of ordinary method such as PCR method to have the expression cassette of termination signal element 3AOX (TT), and change the restriction enzyme site at two ends.In preferred implementation of the present invention, preferred fragment 5 ends are the BglII site, and 3 ends are the BamHI site, and this fragment is inserted the BamHI site, obtain to have at 3 ends of 3AOX (TT) single copy expression plasmid in BamHI site.Use other isocaudarners such as EcoRI/MunI like need, then need plasmid and fragment are further transformed.

As used herein; Term " construction ", " construction of the present invention " and " expressing the proteic construction of RANKL-HBsAg " interchangeable use all refer to the construction through the RANKL-HBsAg protein expression box of the present invention that contains 1 or 2-15 arranged in series of molecular biology method structure.In a preference of the present invention, preferably contain 3-12 in the said construction, more preferably 4-10 is individual, most preferably the expression cassette of the present invention of 5-8 arranged in series.

Can be through expression cassette mentioned above being repeated to insert the construction that makes up RANKL-HBsAg protein expression box of the present invention in the plasmid.In preferred implementation of the present invention, adopt methods such as isocaudarner, flat terminal connection that said expression cassette is repeated to insert in the said plasmid, preferably adopt isocaudarner.In another preferred implementation of the present invention, said method also comprises the construction with intestinal bacteria amplification gained.

The yeast cell and the preparation thereof of high expression level RANKL-HBsAg recombinant protein

As used herein; Term " RANKL-HBsAg expresses yeast cell " or " yeast cell of the present invention " interchangeable use; All refer to have the yeast cell of the expression RANKL-HBsAg recombinant protein of following characteristic: be integrated with the construction of the present invention of expressing RANKL-HBsAg in the said yeast cell; And said yeast cell is suitably being induced expression RANKL-HBsAg down, and forms virus-like particle.

The preparation method that RANKL-HBsAg of the present invention expresses yeast cell comprises step: with construction transformed yeast cell of the present invention, to obtain to express the yeast cell of RANKL-HBsAg.Said conversion can adopt the conventional method for transformation of the present invention such as electricity conversion, protoplast transformation to carry out.The virus-like particle that is produced by yeast cell of the present invention has the epitope close with natural RANKL, and can stimulate immune system to produce the protectiveness neutralizing antibody.

In preferred implementation of the present invention, can adopt the yeast cell that is selected from down group: pichia spp, yeast saccharomyces cerevisiae or debaryomyces hansenii, preferably adopt pichia spp, for example GS115 bacterial strain, SMD1163 bacterial strain, KM71 bacterial strain (preferred GS115 bacterial strain).The RANKL-HBsAg expression amount of yeast cell of the present invention can reach the 20-1000mg/L fermented liquid, preferred 50-300mg/L fermented liquid.

Vaccine composition

The invention provides a kind of vaccine composition, it contains significant quantity (like 0.000001-50wt%; Preferable 0.00001-20wt%; Better, RANKL-HBsAg recombinant protein of the present invention (preferably purified) 0.0001-10wt%), and acceptable carrier on the immunology.Vaccine composition of the present invention can be used for through the influence of RANK/RANKL/OPG system being treated, alleviated or improving disease relevant with this approach or symptom.In addition, vaccine composition of the present invention also can be united use with other therapeutical agent or assistant agent simultaneously.

As used herein, the composition of " acceptable on the immunology " is applicable to people and/or Mammals and does not have excessive bad side reaction (like toxicity, stimulation and transformation reactions), promptly has the material of rational benefit/risk ratio.Term " acceptable carrier on the immunology " refers to be used for the carrier of immune-active agent administration, comprises various vehicle and thinner.

This type carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Usually vaccine preparation should be complementary with administering mode, and vaccine composition of the present invention can be made into the injection form, for example with saline water or contain glucose and the aqueous solution of other assistant agent prepares through ordinary method.Described vaccine composition should be made under aseptic condition.The dosage of activeconstituents is treatment or prevention significant quantity.Preparation of the present invention also can be made into sustained release preparation.

The significant quantity of immune-active agent can change with the severity of the pattern of administration and disease to be treated etc. in the present composition.The selection of preferred significant quantity can be confirmed (for example through clinical trial) according to various factors by those of ordinary skills.Described factor includes but not limited to: the pharmacokinetic parameter biological example utilization ratio of immune-active agent, metabolism, transformation period etc.; The patient the severity, patient's body weight, patient's immune state, the approach of administration etc. of the disease that will treat.For example, by an urgent demand of treatment or prevention situation, but give the dosage that several times separate every day, or dosage is reduced pari passu.

PH in the present composition or carrier etc. can be as indicated above, and can be selected with general knowledge as required by those of ordinary skills.

The administering mode of vaccine composition of the present invention has no particular limits, can be whole body or partial.Preferably; Vaccine composition of the present invention can give object through the mode of intramuscular injection; Usually, when the dosage of immune-active agent of the present invention with about 0.00001-50mg/kg the weight of animals (preferable 0.0001-10mg/kg the weight of animals) gives, can obtain gratifying effect.Also can adopt the means of gene therapy to carry out administration, such as can be directly with immune-active agent through delivering medicine to the experimenter such as methods such as injections; Perhaps can be delivered on the target spot, and make it to express RANKL-HBsAg albumen of the present invention through the ceneme (such as expression vector or virus etc.) that certain approach will carry immune-active agent.

Can directly give Mammals (such as the people) with described RANKL-HBsAg albumen; Perhaps; Can the proteic gene of coding RANKL-HBsAg be cloned in the appropriate carriers (like conventional protokaryon or carrier for expression of eukaryon or virus vector such as herpesvirus vector or adenovirus carrier) through the method for routine; Described carrier is imported in the cell that can express said albumen or polypeptide, make described cell expressing RANKL-HBsAg albumen.Can realize the proteic expression of RANKL-HBsAg through an amount of said cell being incorporated into the suitable position of body of mammals.

Advantage of the present invention

The invention has the advantages that:

1. the yeast cell that obtains through recombinant technology insertion list or high copy number RANKL-HBsAg expression cassette of the present invention has obtained high expression level amount and expression product unexpectedly and has had high reactivity, is suitable for suitability for industrialized production thus;

2. yeast cell of the present invention is produced the RANKL-HBsAg recombinant protein and can effectively be induced body to produce anti-RANKL antibody, thereby is used to improve and treat because of RANKL/OPG ratio unbalance disease that causes of rise or symptom.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example usually (for example can be with reference to usually according to condition or the condition of according to manufacturer advising of normal condition described in " molecular cloning: lab guide " (the same) according to normal condition.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.

The structure of embodiment 1. single copy expression plasmids

Human mesenchymal stem cell, BMP-2 recombinant adenovirus, plasmid pPIC3.5K change (transform and get) available from Shanghai Vaccine and Serum Institute on the basis of the pPIC3.5K of invitrogen company plasmid; Intestinal bacteria TOP10 strain, pichia spp GS115 strain are available from invitrogen company.

1.RANKL the preparation of cDNA

By ordinary method culturing human mescenchymal stem cell (available from Shanghai Vaccine and Serum Institute); Going down to posterity back the 2nd day; In nutrient solution, add 500 μ l BMP-2 recombinant adenovirus and induce human mesenchymal stem cell to be divided into scleroblast, change liquid after 3 days and digest results after 1/3,7 day.Total RNA of extracting cell adopts the RT-PCR method to obtain RANKLcDNA.Identify that through agarose electrophoresis gained cDNA really is RANKL cDNA.

2.RANKL the point mutation transformation

Use overlapping extension PCR, RANKL is transformed, rite-directed mutagenesis (shown in Figure 1A and 1B) takes place in the site that makes the follow-up enzyme of influence cut operation, and the primer is as shown in table 1:

Table 1.

3.RANKL-HBsAg the fusion of gene fragment

Adopt overlapping extension PCR that RANKL and HBsAg gene fragment are merged, middle genes encoding with connection peptides GGGGSGGGGGS links to each other (shown in Fig. 2 A), and it is carried out electrophoresis check (shown in Fig. 2 B).The primer is as shown in table 2:

Table 2.

SEQ?ID?NO	Title	Sequence
			19	Joint HBsAg	GGTGGTGGTGGTAGTGGTGGTGGTGGTGGTAGTGAG
20	HBsAg?NotI?R	CGCGGCCGCTTAAATGTATACCCAGAGACA

4. single copy plasmid pPIC3.5K changes-structure of RH

Change the gene fragment with RANKL-HBsAg with EcoRI, NotI double digestion plasmid pPIC3.5K, enzyme is cut product and is carried out agarose electrophoresis, cuts plasmid and fragment that enzyme is cut, uses AXYGEN glue to reclaim test kit and reclaims.The digested plasmid that reclaims is connected 2 hours with fragment for 22 ℃ with the T4 ligase enzyme.Connect product and mix intestinal bacteria TOP10 competent cell, ice bath 30 minutes, 42 ℃ 90 seconds, ice bath, it is dull and stereotyped to coat LB amp, 37 ℃ of constant incubator overnight cultures.Bacterium colony with on the sterilization toothpick picking flat board is inoculated in 3ml LB amp substratum, and 37 ℃ of shaking table 250rpm are cultured to saturated with the amplification bacterium colony.

Bacterium liquid uses AXYGEN plasmid extraction test kit extracting plasmid in a small amount.EcoRI, NotI double digestion plasmid carry out agarose electrophoresis and identify (shown in Fig. 3 A).With identifying that correct clone bacterium liquid send evaluations of checking order of the English Weihe River prompt base (Shanghai) trade Co., Ltd, uses universal sequencing primer thing 5 ' AOX and the two-way survey of 3 ' AOX to lead to.

500 μ l are identified that correct clone bacterium liquid adds 500 μ l glycerine, mixing ,-80 ℃ of refrigerator preservations.

The structure of gained plasmid is shown in Fig. 3 B.

The structure of embodiment 2. high copy expression plasmids

Utilize the isocaudarner principle; The expressed intact box that will have 5 ' AOX, RANKL-HBsAg gene and transcription terminator inserts in the plasmid repeatedly, obtained pPIC3.5K to change-RH (single copy), pPIC3.5K to change-RH2C (2 copy), pPIC3.5K changes-RH4C (4 copy) changes-RH8C the plasmid (shown in Fig. 4 A) of four kinds of different copy numbers such as (8 copy) with pPIC3.5K.Detailed process is following:

The plasmid pPIC3.5K of gained among the embodiment 1 is changed-RH uses BglII, MluI and BamHI, MluI double digestion respectively.The plasmid glue of BamHI, MluI double digestion reclaims big fragment, and BglII, MluI double digestion plasmid reclaim small segment.Two groups of endonuclease bamhis are connected, and BamHI and BglII are isocaudarners, connect back restriction enzyme site disappearance, thereby accomplish the connection of two expression cassettes.Connect product and transform picking colony amplification cultivation, extracting plasmid.BglII, BamHI double digestion plasmid, agarose electrophoresis is identified, is identified that correct plasmid is pPIC3.5K and changes-RH2C.Repeat said process, accomplish pPIC3.5K to change-RH4C and pPIC3.5K change-structure of RH8C.The BamHI of different copy number plasmids, the evaluation of BglII double digestion and BamHI single endonuclease digestion qualification result are shown in Fig. 4 B.

The structure and the expression of embodiment 3. pichia spp reorganization RANKL-HBsAg expression strain

Through the electric shock with recombinant plasmid transformed to the yeast born of the same parents, plasmid in the yeast born of the same parents with yeast genes group generation homologous recombination, thereby RANKL-HBsAg is incorporated into (like Fig. 5 A) in the yeast genes group.Particularly:

With SalI digested plasmid pPIC3.5K change, pPIC3.5K changes-RH and pPIC3.5K change-RH8C makes plasmid linearization.Get linearization plasmid and 80 μ l yeast competent cells (by the competence yeast cell GS115 of ordinary method preparation) that 10 μ l obtain through above-mentioned steps, mixing is transferred in the electric shock cup of precooling.Using electric shock appearance (eppendorf) 1500V to carry out electricity for 5 milliseconds transforms.

Transform back bacterium liquid to electricity and add 1ml 1M sorbyl alcohol dilution bacterium liquid rapidly, and coat the RDB flat board, 28 ℃ of constant incubators were cultivated 3-5 days.Picking recombination yeast bacterium colony is inoculated in 5ml BMGY substratum, and 28 ℃ of shaking table 250rpm are cultured to OD ₆₀₀Reach 2-6.Adjustment bacterium liquid measure, centrifugal 5 minutes of 2500rpm abandons supernatant, and thalline is resuspended with 10ml BMMY, guarantees resuspended back OD ₆₀₀Be 1.28 ℃ of shaking table 250rpm cultivated 3-5 days, added 0.5% methyl alcohol every day.Results bacterium liquid, centrifugal 5 minutes of 4000rpm abandons supernatant.Add the broken damping fluid of 1ml, 500 μ l granulated glass spherees and 1 steel ball, use the broken bacterium machine concussion of concussion 2 minutes, the ice bath cooling repeats 3 times.Centrifugal 10 minutes of 12000rpm draws supernatant.

Adopt SDS-PAGE method and ELISA method to identifying through the product of above-mentioned steps abduction delivering.GS115-pPIC3.5K changes-RH abduction delivering 3 days, and the bacterial cell disruption supernatant is identified with SDS-PAGE and is found the expection band.GS115-pPIC3.5K changes-and ELISA (HBsAg) reading of inducing bacterial cell disruption supernatant after 3 days of RH is as shown in table 3:

Table 3.

The clone	Negative control	1	2	3	4
						OD ₄₅₀	0.127	0.832	0.750	0.105	0.742

GS115-pPIC3.5K changes-and RH and GS115-pPIC3.5K change-each four strain positive colony abduction delivering of RH8C 3 days, the bacterial cell disruption supernatant compares the expression amount of RANKL-HBsAg with ELISA.Shown in Fig. 5 B, the expression amount of 8 copy plasmid transformants will be significantly higher than single copy plasmid transformant.

The method bacterial cell disruption supernatant of electron microscopic observation send East China Normal University's Electron Microscopy Room to carry out electron microscopic observation, and samples using acetic acid uranium just dyes (Fig. 5 C).The result shows, uses the RANKL-HBsAg of Pichia anomala expression can spontaneous formation virus-like particle, because the RANKL of particle surface itself has the characteristic that forms homotrimer, it is more obvious that RANKL-HBsAgVLP forms string polymers tendency than HBsAg VLP.

Embodiment 4.15L scale pilot scale fermentation

The GS115-pPIC3.5K of preparation among the embodiment 3 is changed-the recombinant expressed strain of RH8C is inoculated in 500ml BMGY substratum, and 28 ℃ of shaking table 250rpm are cultured to OD ₆₀₀Reach 2-6.Bacterium liquid is inoculated in 4.5L inorganic salt fermented liquid, culture condition: 28 ℃, to add ammoniacal liquor and keep pH 5.00, dissolved oxygen is controlled at about 30%, and rotating speed progressively is promoted to 600rpm with growing state.

Be cultured to about 20 hours and add glycerine, the feed supplement flow velocity progressively improves, and about feed supplement 800ml, stops feed supplement.Treat that glycerine exhausts back 30 minutes, begin to add methanol induction or carry out methyl alcohol glycerine mixing feed supplement that feed supplement speed progressively improves, and induces about 60 hours, stops feed supplement.In the feed supplement process, note to prevent the methyl alcohol accumulation.After treating that methyl alcohol exhausts, stop fermentation, results bacterium liquid.Centrifugal 15 minutes of 4000rpm abandons supernatant, and thalline is stored in-80 ℃ of refrigerators.

With the sample 1ml that each time point in the fermenting process is gathered, centrifugal 1 minute of 12000rpm abandons supernatant, surveys the thalline weight in wet base.Use ELISA to measure expression amount behind the bacterial cell disruption.Mensuration result is as shown in Figure 6, and the result shows that the cell density that mixes feed supplement significantly improves the also corresponding raising of RANKL-HBsAg expression amount than the single feed supplement of methyl alcohol.

The separation and purification of embodiment 5. reorganization RANKL-HBsAg

RANKL-HBsAg can't be secreted into outside the born of the same parents because formation VLP is bulky, thereby has adopted the mode of expressing in the born of the same parents.

Flow process according to shown in Fig. 7 A is carried out purifying to sample: at first, adopt high-pressure homogeneous crusher machine yeast body, in bacterial cell disruption liquid, add an amount of Triton X-100 and DNase and carry out pre-treatment, centrifugal subsequently removal cell debris.Add 30% ammonium sulfate in the sample behind centrifugal clarification and carry out ammonium sulfate precipitation.(the Butyl post is available from Bo Gelong, on 7.5% ammonium sulfate kind with hydrophobic chromatography for the sample of handling through ammonium persulphate; Water elution) carries out preliminary purification; Elution samples use again ion exchange chromatography (the SP post, available from GE, the last appearance of pH6.0PB; Collect stream and wear liquid) be further purified, thus obtained the RANKL-HBsAg of purifying.

(one is anti-: how anti-the anti-RANKL of rabbit is, available from Abcam to adopt Western blotting; Two is anti-: Gt X Rb HRP mark IgG (H+L), available from Millipore) identify, confirmed that the albumen that purifying obtains is RANKL-HBsAg (Fig. 7 B).Purification of samples master tape N end sequencing result is: MIRAE, and consistent with expected sequence.Detect purification of samples with the determination of protein concentration method, recording sample concentration is 1.549mg/ml.

The expression and purification of embodiment 6. intestinal bacteria reorganization RANKL

In order to verify the generation of anti-RANKL antibody, the contriver has made up the recombinant expressed RANKL bacterial strain of intestinal bacteria.The recombinant expressed strain of RANKL is carried out separation and purification through the IPTG abduction delivering through steps such as bacterial cell disruption, nickel ion affinity chromatograph, ion exchange chromatographies, has obtained purified recombinant RANKL.Use the RANKL of purifying to encapsulate 96 orifice plates, set up the ELISA method for quick of anti-RANKL antibody and learned, antibody generates situation and antibody titers is provided convenience in order to study.Particularly:

Bacterial strain uses therefor, carrier are following: intestinal bacteria TOP10 strain (available from invitrogen company), e. coli bl21 (DE3) and plasmid pET28a (available from Merck company).

In the normal condition RANKL gene fragment that increases downwards, template used for pPIC3.5K changes-RH, primer is as shown in table 4 through PCR:

Table 4.

SEQ?ID?NO	Title	Sequence
			21	RANKLNcoI?F	GCCATGGGCATCAGA
22	RANKLXhoI?R	GCTCGAGATCTATAT

With NcoI, XhoI double digestion plasmid pET28a and RANKL gene fragment, enzyme is cut product and is carried out agarose electrophoresis, downcuts plasmid and fragment that enzyme is cut, uses AXYGEN glue to reclaim test kit and reclaims.The digested plasmid that glue is reclaimed is connected 2 hours with fragment for 22 ℃ with the T4 ligase enzyme.Connect product and mix intestinal bacteria TOP10 competent cell, ice bath 30 minutes, 42 ℃ 90 seconds, ice bath, it is dull and stereotyped to coat LB kan, 37 ℃ of constant incubator overnight cultures.The amplification bacterium colony uses the plasmid in the AXYGEN a small amount of plasmid extraction test kit extracting bacterium liquid then.NcoI, XhoI double digestion plasmid, digested plasmid carry out agarose electrophoresis to be identified.With identifying that correct clone bacterium liquid send evaluations of checking order of the English Weihe River prompt base (Shanghai) trade Co., Ltd, uses universal sequencing primer thing T7 promoter primer and the two-way survey of T7 terminator primer to lead to.

The collection of illustrative plates of gained pET28a-RANKL recombinant plasmid is as shown in Figure 8.

PET28a-RANKL plasmid 1 μ l is mixed with e. coli bl21 (DE3) competent cell, ice bath 30 minutes, 42 ℃ 90 seconds, ice bath, it is dull and stereotyped to coat LB kan, 37 ℃ of constant incubator overnight cultures.Bacterium colony with on the sterilization toothpick picking flat board is inoculated in 1ml LB kan substratum, and it is saturated that 37 ℃ of shaking table 250rpm are cultured to, and with the amplification bacterium colony, obtains BL21 (DE3)-pET28a-RANKL expression strain.

Adopt following method express recombinant RANKL: in 5ml LB kan substratum, 37 ℃ of shaking table 250rpm are cultured to OD with bacterial classification inoculation ₆₀₀0.6 about.Add 1M IPTG at 1: 1000,28 ℃ of shaking table 250rpm induced 6 hours.Centrifugal 1 minute of bacterium liquid 12000rpm keeps supernatant.Bacterial sediment is resuspended with 500 μ l PBS, keeps 100 μ l.Remain resuspended bacterium liquid with ultrasonic disruption 5 minutes, centrifugal 10 minutes of 12000rpm keeps supernatant.Precipitate resuspended with 500 μ l PBS.Nutrient solution supernatant, the complete resuspended liquid of bacterium, broken bacterium supernatant, broken bacterium precipitate that resuspended liquid carries out SDS-PAGE and western blotting is identified and (used RANKL-HBsAg mouse immune pooled serum anti-as one, thinning ratio 1: 1000; Gt X Ms HRP mark IgG/IgM is anti-as two, thinning ratio 1: 5000).

Adopt the flow process shown in Fig. 9 A that RANKL is carried out purifying: intestinal bacteria cross the clarification of 0.45 μ m millipore filtration micro-filtration after fragmentation is centrifugal.Elder generation's use nickel ion affinity chromatograph (the chelating post, available from GE, appearance on the 20mM imidazoles; 20mM-250mM imidazoles linear elution) carries out preliminary purification; Re-use ion exchange chromatography (Q post, SP post, available from GE, the last appearance of pH6.5PB; 0.3M the NaCl wash-out) be further purified, thereby obtained the RANKL of purifying.

(one is anti-: how anti-the anti-RANKL of rabbit is, available from Abcam to adopt Western blotting; Two is anti-: Gt X Rb HRP mark IgG (H+L), available from Millipore) identify, confirmed that the albumen that purifying obtains is RANKL (Fig. 9 B).Detect purification of samples with the determination of protein concentration method, recording sample concentration is 56.72 μ g/ml.

The immunity of embodiment 7.RANKL-HBsAg inducing mouse produces anti-RANKL neutralizing antibody

In the RANKL-HBsAg of purifying sample stoste, add formaldehyde solution, place detoxification in 3 days for 37 ℃ with 1: 1000 (volume ratio).Sample stoste is diluted to three concentration of 320,80,20 μ g/ml through the PBS serial dilution.To extraordinarily going into aluminium adjuvant, 1: 200 (volume ratio) adds the 1mg/ml Thiomersalate, and aluminium adjuvant absorption is spent the night, and processes the immunogen of three kinds of dosage of 10,40,160 μ g/ml.

To clean level 4 week Balb/c female mices in age (available from Shanghai Slac Experimental Animal Co., Ltd.) and be divided into four groups, 10 every group.One group of negative control group, injection PBS 1ml, the immunogen 1ml of three dosage of other three groups of difference abdominal injection 10,40,160 μ g/ml.Per 2 all immunity once are total to immunity three times.After last immune two weeks, pluck eyeball and get blood.With blood sample be placed on 37 ℃ 1 hour, centrifugal 30 minutes of 1500rpm keeps upper serum.Every part of immune serum got 20 μ l, as mixed immunity serum, puts-20 ℃ of refrigerators and preserves behind the mixing.

Get the RANKL of the purifying that makes among the embodiment 6, encapsulate 96 orifice plates, detect the generation situation (antibody titers) of anti-RANKL antibody in the immune serum with indirect method ELISA with the 100ng/ hole.Be enough to reach the upper limit of detection (Fig. 9 A) of ELISA even if the result shows the antibody of the immunizing dose generation of adopting 10 μ g/ml, proved that RANKL-HBsAg can produce anti-RANKL antibody by the effective stimulus body really.Antibody titers through measuring mixed immunity serum is about 10 ^-4～10 ^-5(Fig. 9 B).

The research of embodiment 8. anti-RANKL mouse immune serum extracorporeal blocking RAW264.7 cytodifferentiation

In order to study the extracorporeal neutralizing activity of the anti-RANKL antibody that RANKL-HBsAg induces, the inventor uses RAW264.7 cell (available from Chinese Academy of Sciences's Shanghai cell bank) as main research object.The RAW264.7 cell is a kind of mononuclear macrophage leukemia cell, and it has the characteristic similar with the osteoclast precursor cell, can under the stimulation of RANKL, break up, merge, and forms multinucleated osteoclast.This research adds the mouse pooled serum after the RANKL-HBsAg immunity in substratum when RANKL induces stimulation.Through mtt assay and TRAP dyeing, observe the situation of anti-RANKL antibody blocking RANKL inductive cell inhibitory effect and cytodifferentiation.

1. immune serum blocking-up RANKL suppresses RAW264.7 cel l proliferation (mtt assay)

Behind the conventional RAW264.7 cell of cultivating of digestion, pair cell is counted, and is diluted to 10 with nutrient solution (DMEM that contains 10% foetal calf serum) ⁴Individual/ml, be inoculated in 96 orifice plates, every hole adds 200 μ l, 5%CO ₂37 ℃ of overnight cultures of constant incubator.Every hole adds RANKL (10 μ g/ml) 1 μ l, and blank well does not add.

Immune Balb/c mouse described in embodiment 7 is got immune serum and dilutes with 1: 10,1: 100,1: 1000 with nutrient solution, in corresponding aperture, adds former times of serum or each extent of dilution serum 2 μ l respectively, and negative hole does not add.5%CO ₂37 ℃ of cultivations of constant incubator were changed liquid to the 3rd day, added RANKL and immune serum according to the above ratio.Cultivated the 6th day, and detected the cell proliferation situation with mtt assay.

The result is shown in Figure 11 A, and the result shows that the RANKL-HBsAg immune serum has the activity that blocking-up RANKL suppresses RAW264.7 cell proliferation.The reorganization RANKL-HBsAg of experiment proof Pichia anomala expression can induce body to produce anti-RANKL antibody, and the antibody that produces has the neutralization activity of blocking-up RANKL effect.

2. immune serum is blocked RANKL inductive RAW264.7 cytodifferentiation

Behind the conventional RAW264.7 cell of cultivating of digestion, pair cell is counted, and is diluted to 10 with nutrient solution (DMEM that contains 10% foetal calf serum) ⁴Individual/ml, be inoculated in 12 orifice plates, every hole adds 500 μ l, 5%CO ₂37 ℃ of overnight cultures of constant incubator.Every hole adds RANKL (10 μ g/ml) 2.5 μ l, and blank well does not add.

With dilution in 1: 10,1: 100,1: 1000, former times of serum and each extent of dilution added 5 μ l to immune serum in corresponding aperture with nutrient solution, and negative hole does not add.5%CO ₂37 ℃ of cultivations of constant incubator were changed liquid to the 3rd day, added RANKL and immune serum according to the above ratio.Be cultured to the 6th day, carry out TRAP dyeing, observation of cell differentiation situation.The result is shown in Figure 11 B.

Osteoclast is carried out cell counting: 5 visuals field of every hole picked at random, counting multinucleated osteoclast number (3 more than the nuclear), the cell count in 5 visuals field of adding up.The result is shown in Figure 11 C.

The above results shows, the RANKL-HBsAg immune serum has blocking-up RANKL, and to induce the RAW264.7 cytodifferentiation be the activity of osteoclast.The reorganization RANKL-HBsAg that Pichia anomala expression is confirmed in experiment once more induces the anti-RANKL antibody of body generation to have the neutralization activity of blocking-up RANKL effect.

The research of embodiment 9.RANKL-HBsAg to acting in the OPG knock out mice body

OPG can block RANKL and combine with RANK as the natural antagonistic molecule of RANKL, suppresses the formation and the activation of osteoclast, thereby keeps the reconstruction balance of skeletal system.Development along with transgenic technology; The physiological function research that the OPG knock out mice strain of utilizing embryonic stem cell gene knockout technology to set up is not merely research OPG provides platform, and it can also be used for the research of pathomechanism and treatment as the osteoporosis model.This research uses the recombinant expressed RANKL-HBsAg of pichia spp that the OPG knock out mice is carried out immunity; Observe its influence, assess result of treatment and the application prospect of RANKL-HBsAg as therapeutic vaccine with this to mouse bone density, bone biomechanical and bone micro-structure.

1. laboratory animal

3 the week age SPF level OPG gene knockout homozygote C57 mouse (OPG ^-/-) male and female each 4 available from Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd.; 3 ages in week each 4 of cleaning level C57BL/6 mouse male and female available from Shanghai Slac Experimental Animal Co., Ltd..

2. mouse immune flow process and sample preparation

The RANKL-HBsAg of purifying is prepared into the immunogen of 100 μ g/ml through Sterile Filtration, formaldehyde detoxification, aluminium adjuvant absorption.

OPG ^-/-Respectively be divided into two groups with the C57BL/6 mouse, every group of male and female half and half.One group of abdominal injection RANKL-HBsAg 1ml wherein, another group is control group, intraperitoneal injection of saline 1ml.Per 2 all immunity once are total to immunity three times.After the last immune week, abdominal injection tetracycline marker 30mg/kg, mouse is handled and injected once with same dosage in preceding 2 days again.

The blood of coring behind the mouse etherization is got bilateral femur, shin bone.Blood sample be placed on 37 ℃ 1 hour, centrifugal 30 minutes of 1500rpm keeps upper serum.The gauze parcel that femur soaked with saline water ,-20 ℃ of preservations.Shin bone fixing 2 days with 75% ethanol is immersed in 85%, 95%, 100% ethanol each 2 days then successively, and dehydration is stored in the absolute ethyl alcohol step by step.

3. the mensuration of serum anti RANKL antibody

RANKL with purifying encapsulates 96 orifice plates with the 100ng/ hole, induces the situation (ditto) of anti-RANKL antibody with RANKL-HBsAg in the indirect method ELISA detection mice serum.

Test-results is shown in Figure 12 A, and this result proves: with the recombinant expressed RANKL-HBsAg immunity OPG of pichia spp ^-/-Can make it produce anti-RANKL antibody with the C57BL/6 mouse.

4. bone biomechanical is measured

Mouse femur is taken out from refrigerator, after thawing naturally, carry out right side femur three point bending test with micro-control electronic universal tester (Shanghai Ninth People's Hospital Affiliated to Shanghai Jiao Tong University Sch provides use).

Measure earlier the minor axis and the length of major axis in femur stage casing with vernier callipers, adjust bearing then at a distance of 1cm, on two bearings, and the short-axis direction of femur is parallel with vertical direction with the relatively more uniform position and placed of femur.Masterpiece is used on the femur of two bearing mid points.Loading velocity 2mm/min, span 1cm measures femur maximum deflection load.

Test result is shown in Figure 12 B and 12C, and this result proves: the biomechanics of bone intensity of OPG knock out mice will significantly be lower than wild-type, and the OPG knock out mice is after the RANKL-HBsAg immunity, and its biomechanics of bone intensity has recovery to a certain degree.

5. the observation of mouse bone micro-structure

Get cillin bottle, handle inwall with silicone oil.Put into a small amount of polymethylmethacrylate piece, mouse shin bone sample and MMA MONOMER liquid.Vacuumized 4 hours, capped, 4 ℃ left standstill 4-7 days.Normal temperature continues down to place polymerization, until sclerosis.Sample is placed 40 ℃ of baking ovens, until sclerosis fully.Cillin bottle is smashed the back take out embedded block, accomplish suitable shape, be cut into 100～200 μ m section with slicing machine.

Mat glass sheet abrasive disc 2～3 minutes are used in section respectively, continue abrasive disc with P300, P800, P1200 sand paper again, remove the tool marks of tissue surface, are milled to 50～70 μ m.Section is fastened with glue on the synthetic glass slide glass, plastic covering paper, counterweight flattens, and places 24 hours.Throw off plastic paper, carry out abrasive disc, remove the glue vestige with P1200 sand paper.Behind the polishing powder mixing zero(ppm) water, pick with flannelette section is polished, to there not being obvious cut.

Place absolute ethyl alcohol to soak 2 hours section, put into the pinkish red staining fluid of TNP and dye, dry after the rinsing in the clear water, put then and observe bone micro-structure under 40 power microscopes.

40 power microscopes of mouse shin bone embedded section are observed bone micro-structure shown in Figure 12 D.From shin bone sections observation, OPG ^-/-The trabecular bone loss of control group is the most obvious, and OPG ^-/-The bone trabecula of immune group is similar with wild-type.The result shows; After using the RANKL-HBsAg immunity; Prevented the trabecular bone loss phenomenon that produces owing to the OPG defective, proved that anti-RANKL antibody that RANKL-HBsAg induces can substitute the effect of OPG really to a certain extent, avoided rebuilding the bone-loss that is caused because of excessive bone.

All documents in that the present invention mentions are all quoted as a reference in this application, are just quoted such as a reference separately as each piece document.Should be understood that in addition after having read above-mentioned teachings of the present invention, those skilled in the art can do various changes or modification to the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Claims

1. construction that is used to express the RANKL-HBsAg recombinant protein, said construction contains the expression cassette of 1 expression cassette or 2-15 arranged in series, and each said expression cassette comprises following element:

(a) start signal element AOX;

(b) RANKL-HBsAg recombinant protein encoding sequence, said RANKL-HBsAg recombinant protein encoding sequence is by forming with the lower section:

(i) RANKL albumen coded sequence,

(ii) the HBsAg encoding sequence and

(iiii) the connection peptides encoding sequence of choosing wantonly between RANKL and HBsAg encoding sequence;

(c) termination signal element AOX (TT).

2. construction as claimed in claim 1 is characterized in that, the aminoacid sequence of said RANKL-HBsAg recombinant protein is shown in SEQ ID NO:8.

3. yeast cell of expressing the RANKL-HBsAg recombinant protein; It is characterized in that; Be integrated with the construction of expressing the RANKL-HBsAg recombinant protein in the karyomit(e) of said yeast cell; Said construction contains the expression cassette of 1 expression cassette or 2-15 arranged in series, and each said expression cassette comprises following element:

(a) start signal element AOX;

(i) RANKL albumen coded sequence,

(ii) the HBsAg encoding sequence and

(c) termination signal element AOX (TT);

Wherein, said yeast cell is being induced expression RANKL-HBsAg recombinant protein down, and the being made by manufacturers or users in said yeast of described recombinant protein becomes virus-like particle.

4. yeast cell as claimed in claim 3 is characterized in that, said yeast cell is selected from: pichia spp, yeast saccharomyces cerevisiae or debaryomyces hansenii.

5. yeast cell as claimed in claim 3 is characterized in that said virus-like particle is showed in the surface with RANKL, and can stimulate immune system to produce anti-RANKL antibody.

6. one kind comprises RANKL-HBsAg recombinant protein virus-like particle, it is characterized in that, said virus-like particle is produced by the described yeast cell of claim 3.

7. a method for preparing the RANKL-HBsAg recombinant protein is characterized in that, said method comprises step:

(i) be fit to cultivate the described yeast cell of claim 3 under the condition of expressing, thereby making it express the RANKL-HBsAg recombinant protein; With

(ii) separation and purification RANKL-HBsAg recombinant protein from said yeast cell.

8. a RANKL-HBsAg recombinant protein is characterized in that, said recombinant protein be express to produce by the construction described in the claim 1, produce by the yeast cell described in the claim 3, or through the described method preparation of claim 7.

9. the purposes of the described yeast cell of claim 3, the described virus-like particle of claim 6 or the described RANKL-HBsAg recombinant protein of claim 8; It is characterized in that it is used to prepare the vaccine of prevention or treatment RANK/RANKL/OPG system's relative disease or symptom.

10. purposes as claimed in claim 9; It is characterized in that said RANK/RANKL/OPG system's relative disease or symptom are selected from: disease that osteoporosis, rheumatoid arthritis, bone tumor, mammary cancer, prostate cancer, angiosteosis or angiosteosis cause and symptom.

11. a vaccine composition, it comprises:

(a) the described RANKL-HBsAg recombinant protein of claim 8; And

(b) acceptable carrier and/or adjuvant on the immunology.