CN102443594B

CN102443594B - Receptor activator of nuclear factor kappa B ligand (RANKL)-HBaAg expression constructing object, yeast, manufacture method as well as application

Info

Publication number: CN102443594B
Application number: CN 201010507578
Authority: CN
Inventors: 何成; 楼觉人
Original assignee: SHANGHAI INSTITUTE OF BIOLOGICAL PRODUCTS CO LTD
Current assignee: SHANGHAI INSTITUTE OF BIOLOGICAL PRODUCTS CO LTD
Priority date: 2010-10-15
Filing date: 2010-10-15
Publication date: 2013-08-07
Anticipated expiration: 2030-10-15
Also published as: CN102443594A

Abstract

The invention provides a constructing object for expressing receptor activator of nuclear factor kappa B ligand (RANKL)-HBaAg recombinant protein and a preparation method thereof. The constructing object comprises 1 to 15 expression boxes, wherein each expression box comprises an initiating signal element alternative oxidase (AOX) (a), RANKL-HBsAg recombinant protein coding sequences (b) and a termination signal element AOX (TT). The invention also provides yeast cells, virus-like particles and a purpose of the particles, wherein the yeast cells comprise the constructing object, the virus-like particles are generated by the yeast cells and comprise the RANKL-HBsAg recombinant protein. The yeast cells constructed in the invention can be used for generating a large amount of RANKL-HBsAg recombinant protein, so the RANKL-HBsAg recombinant protein is used for treating or preventing diseases or symptoms such as osteoporosis and the like relative to RANK/RANKL/ osteoprotegerin (OPG) systems.

Description

RANKL-HBsAg expression constructs, yeast, method for making and application

Technical field

The present invention relates to biotechnology and immune field, in particular to a kind of express recombinant NF-κ B receptor activation factor part (receptor activator of NF-κ B ligand, RANKL)-hepatitis B surface antigen (hepatitis Bsurface antigen, yeast cell HBsAg), the construction that is used for transformed yeast cell, their construction process and purposes.

Background technology

Bone is a dynamic organization, constantly makes up, absorbs, rebuilds in the whole life of biology.When scleroblast constantly forms new osteocyte, induce osteoclast again and constantly dissolve the absorption sclerotin.Osteoclast is attached at bone surface, dissolves sclerotin by discharging acidic medium and proteolytic enzyme, on the one hand, forms absorption lacuna and forms new osteocyte for scleroblast, on the other hand, keeps the pulp cavity volume and is not occupied by sclerotin.Thereby the meaning of bone process of reconstruction is the accumulation that prevents the osseous tissue fatigue damage and keeps the stable of biomechanics characteristic.

The NF-κ B receptor activation factor (RANK, receptor activator of NF-κ B), its part RANKL and protect ossein (OPG, osteoprotegerin) belong to tumour necrosis factor and receptor superfamily thereof, the RANK/RANKL signal is responsible for differentiation and the activation of osteoclast, OPG then is the false acceptor of RANKL, competitive in conjunction with RANKL, stop the combination between RANKL and the RANK, the process that differentiation and the activation of three by the regulation and control osteoclast influences bone resorption and reconstruction.The triangle regulation system that RANK/RANKL/OPG forms becomes basis (Rauner M etc., Osteoimmunology.Int Arch Allergy Immunol.2007,143 (1): 31-48) that bone is rebuild regulation and control.

Secondary cases osteopathy and disease that the unbalance and multiple bone metabolic disease of RANK/RANKL/OPG system and disease of immune system cause are closely related, include, but is not limited to: osteoporosis, rheumatoid arthritis (RA), part bone tumor (as giant cell tumor of bone, osteosarcoma, multiple myeloma), other tumour (as mammary cancer, prostate cancer), angiosteosis and relative disease (the Ann EK etc. such as (as arteriosclerosis, angiostenosis, cerebral embolism, myocardial infarction, kidney calcifications) that cause thereof, Endocr Rev.2008,29 (2): 155 192.).

Osteoporosis is that a kind of destruction with low bone amount and osseous tissue microstructure is feature, the metabolic osteopathy that causes sclerotin fragility to increase and be easy to fracture.About 200,000,000 people in the whole world suffer from osteoporosis at present, and its sickness rate has leapt to common disease, frequently-occurring disease the 7th, and the inland of China total prevalence rate is 12.4%, and ill ratio is above over half among the elderly, and the incidence of wherein fracturing is near 1/3rd.Osteoporosis is widely current in all over the world, and grievous injury patient body health influences its quality of life, brings heavy economical load for patient, family and society.Along with the arrival of world population aging trend, osteoporosis has become worldwide public health problem.

The generation development of osteoporosis is directly related with the RANK/RANKL/OPG system, and the RANK/RANKL/OPG system is subjected to the regulation and control from many-sided factors such as immunity system, endocrine system and hemopoietic systems.Along with the increase at age, human hormone's level can descend day by day, and especially postmenopausal women's oestrogenic hormon decline level is the most obvious.The decline of hormonal readiness can cause the rise of RANKL expression and the downward modulation that OPG expresses, and the RANKL/OPG ratio is unbalance.The RANKL that loses blocking-up activates osteoclast, makes the osseous tissue taken in excess, causes sclerotin to run off in a large number, causes osteoporosis.Therefore, block excessive pathogenic RANKL and become the important means that treatment comprises the unbalance disease of system of osteoporosis.

For example, Denosumab, a kind of high-affinity high specific RANKL monoclonal antibody, entered the clinical study of diseases such as osteoporosis, rheumatoid arthritis, multiple myeloma, mammary cancer and prostate cancer as the representative of anti-RANKL treatment, and its curative effect obtains (Edward MS certainly by the demonstration of a large amount of experiments and clinical data, Arthritis Res Ther.2007,9 Suppl 1:S7).

Yet, still press in this area to develop and can be used for osteopathia that effectively treatment is relevant with the RANK/RANKL/OPG system or the medicine of other disease.

HBsAg is the envelope protein of hepatitis B virus, and it can spontaneous assembling form the 22nm virus-like particle, has strong immunogenicity, and it has been applied to the expression of hepatitis C virus E 2 albumen hypervariable region and human papillomavirus E7 albumen etc. as protein carrier.Yet this area is used for being difficult to the causal organism albumen of challenge in conjunction with some as carrier proteins with HBsAg mostly, and attempts tolerating to break autoimmunization in conjunction with oneself protein with it.

In the expression of recombinant proteins field, the expression vector that obtain the high expression level amount depends on numerous factors.For example the character of expressed protein, the phraseology that adopts are relevant, arrangement mode of each copy etc. among each combination of elements mode, the high copy clone in each element in the expression cassette that adopts, expression cassette.Therefore, this area still needs to develop the recombinant protein production method that cost is cheaper, step is easier, expression amount is higher.

In sum, press in this area to develop and can be used for osteopathia that effectively treatment is relevant with the RANK/RANKL/OPG system or the medicine of other disease, and the effective ways of this medicine of generation are provided.

Summary of the invention

Main purpose of the present invention just providing a kind of stable high expression level RANKL-HBsAg recombinant protein construction, comprise yeast cell of this construction and preparation method thereof, and with this recombinant protein treatment or the prevention disease relevant with RANK/RANKL/OPG and method and the purposes of symptom.

In a first aspect of the present invention, provide a kind of for the construction of expressing the RANKL-HBsAg recombinant protein, described construction contains the expression cassette of 1 expression cassette or 2-15 arranged in series, and each described expression cassette comprises following element: (a) start signal element AOX; (b) RANKL-HBsAg recombinant protein encoding sequence, described RANKL-HBsAg recombinant protein encoding sequence is by forming with the lower section: (i) RANKL albumen coded sequence, (ii) HBsAg encoding sequence, and (iiii) the optional connection peptides encoding sequence between RANKL and HBsAg encoding sequence; (c) termination signal element AOX (TT).

In a preference, corresponding, described RANKL-HBsAg recombinant protein is made up of optional RANKL albumen and the HBsAg albumen that connects by connection peptides.

In an embodiment of the invention, the aminoacid sequence of described RANKL-HBsAg recombinant protein is shown in SEQID NO:8.

In a preference, described RANKL encoding sequence has sequence shown in SEQ ID NO:3 or 5, or is their homologous sequence, is preferably sequence shown in the SEQ ID NO:5.In another preference, described HBsAg albumen coded sequence has sequence shown in the SEQ ID NO:1 or is its homologous sequence, sequence shown in the preferred SEQ ID NO:1.In another preference, described construction is fundamental construction with the pPIC3.5K plasmid.

In a second aspect of the present invention, a kind of yeast cell of the RANKL-HBsAg of expression recombinant protein is provided, it is characterized in that, be integrated with the construction of expressing the RANKL-HBsAg recombinant protein in the karyomit(e) of described yeast cell, described construction contains the expression cassette of 1 expression cassette or 2-15 arranged in series, and each described expression cassette comprises following element: (a) start signal element AOX; (b) RANKL-HBsAg recombinant protein encoding sequence, described RANKL-HBsAg recombinant protein encoding sequence is by forming with the lower section: (i) RANKL albumen coded sequence, (ii) HBsAg encoding sequence, and (iiii) the optional connection peptides encoding sequence between RANKL and HBsAg encoding sequence; (c) termination signal element AOX (TT); Wherein, described yeast cell is being induced expression RANKL-HBsAg recombinant protein down, and the being made by manufacturers or users in described yeast of described recombinant protein becomes virus-like particle.

In a preference, described inducing is to induce with glycerine mixing feed supplement with methyl alcohol or methyl alcohol, particular methanol is induced with glycerine mixing feed supplement and (so-called mixed feed supplement and refer to that stream adds two kinds of feed liquids simultaneously, two kinds of feed supplement speed all can be regulated in real time according to fermentation parameter, rather than carry out feed supplement after mixing by a certain percentage).

In an embodiment of the invention, described yeast cell is selected from: pichia spp, yeast saccharomyces cerevisiae or debaryomyces hansenii.

In a preference, described yeast cell is pichia spp.In another preference, described yeast cell is preferably GS115 bacterial strain, SMD1163 bacterial strain or KM71 bacterial strain, more preferably GS115 bacterial strain.In another preference, contain 3-12 in the described construction, more preferably 4-10 is individual, most preferably the hepatitis B surface antigen expression cassette of 5-8 arranged in series.

In yet another embodiment of the present invention, described virus-like particle is showed in the surface with RANKL, and can stimulate immune system to produce anti-RANKL antibody.

In a third aspect of the present invention, a kind of RANKL-HBsAg of comprising recombinant protein virus-like particle is provided, described virus-like particle is that yeast cell of the present invention produces.

In a preference, described virus-like particle is showed in the surface with RANKL, and can stimulate immune system to produce anti-RANKL antibody.

In a fourth aspect of the present invention, a kind of method of the RANKL-HBsAg of preparation recombinant protein is provided, it comprises: (i) under conditions suitable for the expression, cultivate yeast cell of the present invention, thereby make it express the RANKL-HBsAg recombinant protein; (ii) separation and purification RANKL-HBsAg recombinant protein from described yeast cell.

In a preference, the condition of the described suitable expression in the step (i) comprises: adopt mixture or their combination of methyl alcohol, glycerine, methyl alcohol and glycerine to carry out feed supplement, preferably adopt the glycerine feed supplement at earlier fermentation, the mixture of middle and later periods with methyl alcohol and glycerine carries out feed supplement fermenting.In a preference, step (ii) comprises: bacterial cell disruption, sample pre-treatments, precipitation, centrifugal, filtration, chromatography or their combination.Preferably, described bacterial cell disruption is high-pressure homogeneous fragmentation.Preferably, described sample pre-treatments is to add Triton X-100 and/or DNase in the thalline of fragmentation.Preferably, described precipitation is to adopt ammonium sulfate to precipitate.Preferably, described chromatography is hydrophobic chromatography, ion exchange chromatography or their combination.Preferably, describedly be filtered into micro-filtration, ultrafiltration or their combination.

In a preference, described method also comprise to step (ii) the recombinant protein that obtains of separation and purification identify that preferred described evaluation adopts methods such as Western blotting, N end order-checking evaluation, protein concn BCA assay method to carry out.

In a fifth aspect of the present invention, a kind of RANKL-HBsAg recombinant protein is provided, described recombinant protein is expressed by construction of the present invention and is produced, produced by yeast cell of the present invention, or prepare by method of the present invention.

In a sixth aspect of the present invention, the purposes of yeast cell of the present invention, virus-like particle or RANKL-HBsAg recombinant protein is provided, it is for the preparation of the vaccine of prevention or treatment RANK/RANKL/OPG system's relative disease or symptom.

In an embodiment of the invention, described RANK/RANKL/OPG system's relative disease or symptom are selected from: the disease that osteoporosis, rheumatoid arthritis, bone tumor, mammary cancer, prostate cancer, angiosteosis or angiosteosis cause and symptom.

In a preference, described bone tumor is selected from: giant cell tumor of bone, osteosarcoma or multiple myeloma.In another preference, relative disease and symptom that described angiosteosis causes are selected from: arteriosclerosis, angiostenosis, cerebral embolism, myocardial infarction or kidney calcification.

In a seventh aspect of the present invention, a kind of vaccine composition is provided, it comprises: (a) RANKL-HBsAg recombinant protein of the present invention; And (b) acceptable carrier and/or adjuvant on the immunology.In a preference, described vaccine composition also comprises Thiomersalate, formaldehyde or physiological saline.

In a eighth aspect of the present invention, the method that makes up construction of the present invention is provided, described method comprises: (1) is inserted RANKL-HBsAg recombinant protein encoding sequence fixed point and is comprised in the plasmid of start signal element AOX and termination signal element AOX (TT), to obtain single copy expression plasmid; (2) described single copy expression plasmid is transformed to obtain complete expression cassette; (3) described expression cassette is repeated to insert in the described plasmid, thereby acquisition contains the construction of the described expression cassette of 2-15 arranged in series.

In a preference, described plasmid is selected from: pPIC3.5 (K) plasmid, pAO815 or pHIL-D2.In another preference, in the step (2) described single copy expression plasmid transformed by PCR and undertaken.In another preference, in the step (3) described expression cassette repeated to insert in the described plasmid to insert by the isocaudarner fixed point and carry out.In another preference, described method also comprises the construction with intestinal bacteria amplification gained.

In a ninth aspect of the present invention, provide the present invention to express the preparation method of the yeast cell of RANKL-HBsAg recombinant protein, described method comprises step: with construction transformed yeast cell of the present invention, described construction is integrated in the yeast chromosomal, thereby obtains yeast cell of the present invention.In a preference, described conversion is undertaken by electricity conversion, protoplast transformation.

In should be understood that within the scope of the present invention, above-mentioned each technical characterictic of the present invention and in below (eg embodiment) specifically described each technical characterictic can make up mutually, thereby constitute new or optimized technical scheme.As space is limited, this tired stating no longer one by one.

Other side of the present invention is because the disclosure of this paper is apparent to those skilled in the art.

Description of drawings

Figure 1 shows that overlapping extension PCR point mutation synoptic diagram (1A) and sudden change reconstruction structure figure (1B).

Figure 2 shows that overlapping extension PCR gene fragment merges synoptic diagram (2A) and electrophorogram (2B).

Figure 3 shows that electrophorogram (3A) and structural representation (3B) thereof that single copy plasmid is identified through double digestion.

The building process synoptic diagram (4A) and the enzyme that Figure 4 shows that the high copy expression plasmid are cut evaluation figure (4B).

Figure 5 shows that the ELISA of recombination form synoptic diagram (5A), RH and the RH8C expression amount of recombinant expressed group of pichia spp RANKL-HBsAg compares the electron microscopic observation result (5C) of (5B) and RANKL-HBsAg virus-like particle.

Figure 6 shows that methanol feeding and the comparison that mixes feed supplement in the fermentation of 15L fermentor tank pilot scale.

Figure 7 shows that SDS-PAGE and the western blotting result (sample before 7B:1, the purifying of preferred RANKL-HBsAg purifying flow process (7A) and sample purifying front and back; 2, sample behind the purifying; 3, negative control).

Figure 8 shows that the collection of illustrative plates of RANKL recombinant plasmid.

Figure 9 shows that the purifying flow process (9A) of RANKL and SDS-PAGE and western blotting result (9B:1, the negative control before and after the sample purifying; 2, sample before the purifying; 3, sample behind the purifying).

Figure 10 shows that the situation that induces (10A) of different RANKL-HBsAg immunizing dose group antagonism RANKL antibody and the antibody titers mensuration (10B) of mixed immunity serum.

Figure 11 shows that immune serum blocking-up RANKL that mtt assay is measured suppresses TRAP dyeing observations (11B) and the timely result of osteoclast (11C) of the RAW264.7 cytodifferentiation experiment that RAW264.7 cel l proliferation (11A), immune serum blocking-up RANKL induce.

Figure 12 shows that the result of study that acts in the OPG knock out mice of the RANKL-HBsAg body, comprising: the result (12A) who detects the anti-RANKL antibody producing of mice serum situation with indirect ELISA; Mouse femur results of three (12B and 12C); And micro-(40 times) structure observation (Figure 12 D) of mouse shin bone embedded section.

Embodiment

The present inventor is through long-term and deep research, screened the expression cassette that is constituted by different elements in a large number, made up and can be used for efficiently expressing RANKL-HBsAg Recombinant Protein Expression box, and obtain to comprise the yeast cell of single copy or this expression cassette of multiple copied, make its high expression level have immunocompetent RANKL-HBsAg albumen.The contriver discovers that further RANKL-HBsAg albumen of the present invention can induce the object generation at the neutralizing antibody of RANKL, thereby can be used for treating RANK/RANKL/OPG system relevant disease and symptom.On this basis, the inventor has finished the present invention.

Particularly, the contriver extracts mRNA and carries out RT-PCR from the scleroblast that BMP-2 induces human mesenchymal stem cell to be differentiated to form, obtain the cDNA of RANKL.By overlapping extension PCR the N that the RANKL gene fragment is blended in the HBsAg gene fragment is held, middle continuous with the connection peptides gene order.The RANKL-HBsAg fragment is inserted during plasmid pPIC3.5K changes, and obtained the high copy number expression plasmid by the mode of inserting the RANKL-HBsAg expression cassette repeatedly.Then, plasmid is transformed in the pichia spp GS115 bacterial strain, obtains the high copy number expression strain.Use the 15L fermentor tank that the engineering bacteria methanol induction is fermented.The contriver has confirmed that by means such as SDS-PAGE, ELISA, Western Blot Electronic Speculum and the order-checkings of N end RANKL-HBsAg is correctly expressed and the spontaneous formation virus-like particle of energy.

Subsequently, the contriver carries out purification steps such as fragmentation, centrifugal, ammonium sulfate precipitation, micro-filtration, ultrafiltration, hydrophobic chromatography and ion exchange chromatography to the thalline sample of results and investigates, and sums up and draws the purification process of optimization, has obtained the RANKL-HBsAg of purifying.

The contriver adopts and with sample mix aluminium adjuvant behind the purifying Balb/c mouse is carried out immunity, detects anti-RANKL antibody generation situation in its immune serum, confirms that RANKL-HBsAg can induce the body generation at the antibody of RANKL.Detect immune serum and RANKL is induced the influence of RAW264.7 cytodifferentiation and inhibited proliferation, to investigate the extracorporeal neutralizing activity of anti-RANKL antibody, confirmed that the anti-RANKL antibody of immune generation can be blocked RAW264.7 cytodifferentiation and the propagation inhibition phenomenon that RANKL induces.With RANKL-HBsAg immunity OPG knock out mice osteoporosis model, by measuring and observe the cylinder therapeutic effect that bone density, biomechanics of bone parameter and bone micro-structure etc. have been determined the osteoporosis of RANKL-HBsAg.

On the basis of above-mentioned research, the contriver thinks that the recombinant expressed RANKL-HBsAg of the present invention can induce body to produce anti-RANKL antibody, the antibody that produces has the neutralization activity at RANKL, can block the RANK/RANKL path, thereby can be used for preventing and/or treating the disease relevant with this path or symptom, for example osteoporosis etc.

As used herein, have comprised " containing ", " having " or " comprising " " comprising ", " mainly by ... constitute ", " basically by ... constitute " and " by ... constitute "; " mainly by ... constitute ", " basically by ... constitute " and " by ... formation " belong to the subordinate concept of " containing ", " having " or " comprising ".

As used herein, " separation " or " separation and purification " refers to that material separates (if natural substance, primal environment namely is natural surroundings) from its primal environment.Do not have separation and purification as the polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.

Hepatitis B surface antigen (HBsAg) and NF-κ B receptor activation factor part (RANKL)

As used herein; term " hepatitis B surface antigen " or " HBsAg " are used interchangeably; all refer to comprise hepatitis B surface antigen aminoacid sequence as known in the art (for example aminoacid sequence shown in the SEQ ID NO:2), its conservative property variant protein matter or its active fragments or aminoacid sequence wherein through 1-20 (preferred 1-10; more preferably 1-5) replacement, disappearance or the interpolation of amino-acid residue form; and can induce body to produce the protectiveness neutralizing antibody, with the antigen of prevention HBV infection.

As used herein, term " NF-κ B receptor activation factor part " or " RANKL " are used interchangeably, all refer to comprise RANKL aminoacid sequence as known in the art (for example aminoacid sequence shown in SEQ ID NO:4 or the SEQ ID NO:6), its conservative property variant protein matter or its active fragments or aminoacid sequence wherein through 1-20 (preferred 1-10, more preferably 1-5) replacement, disappearance or the interpolation of amino-acid residue form, and have the antigen of the ability of being combined with RANK.

Should understand through the conservative sequence mentioned above that replaces and also can be used for the present invention, preferred reactive derivative refers to compare with the original acid sequence, has 5 at the most, preferably at the most 3, more preferably at the most 2,1 amino acid is replaced by similar performance or close amino acid and is formed polypeptide best.

As used herein, term " hbsag gene/encoding sequence ", " HBsAg gene " are used interchangeably, and all refer to comprise the sequence shown in the SEQ ID NO:1 of the present invention or its through genetic engineering modified and can express the nucleotide sequence that produces hepatitis B surface antigen of the present invention.As used herein, term " RANKL gene ", " RANKL encoding sequence " are used interchangeably, all refer to comprise the sequence shown in the SEQ ID NO:3 of the present invention or its through genetic engineering modified (as SEQ ID NO:5), and can express the nucleotide sequence that produces RANKL albumen of the present invention.

In an embodiment of the invention, can obtain described encoding sequence by conventional molecular biology method, described method can be according to people such as normal condition such as Sambrook, condition described in " molecular cloning: lab guide " (New York:Cold Spring Harbor Laboratory Press, 1989) is carried out.

RANKL-HBsAg recombinant protein and encoding sequence thereof

As used herein, term " RANKL-HBsAg recombinant protein " or " RH recombinant protein " refer to obtain by genetic engineering means, be blended in the N end of HBsAg gene or its fragment by RANKL gene or its fragment, and optional by the connection peptides encoding sequence formed recombinant protein that links to each other therebetween, shown in recombinant protein have the activity of inducing anti-RANKL antibody.Preferred recombinant protein of the present invention is nucleotide sequence coded by SEQ ID NO:7's, and its aminoacid sequence is shown in SEQ ID NO:8.

Recombinant protein of the present invention can have or not have connection peptides.When connection peptides existed, it comprised 1-25 amino acid usually, preferred 5-20 amino acid, and more preferably 8-15 amino acid, preferred described connection peptides sequence is GGGGSGGGGGS (the 180-190aa place of SEQ ID NO:8).

In system of the present invention, the encoding sequence of RANKL-HBsAg recombinant protein can be efficiently expressed, to produce required RANKL-HBsAg recombinant protein.RANKL in this encoding sequence and HBsAg sequence can be through genetic engineering modified (as point mutation) with the structure that is more suitable for expression cassette and expression but still keep its due activity.The fusion of gene fragment can adopt usual manner as known in the art to carry out.

Express construction and the structure thereof of RANKL-HBsAg recombinant protein

As used herein, term " RANKL-HBsAg expression cassette " or " RH expression cassette " refer to the expression cassette with following element by the inventive method acquisition: (a) start signal element AOX; (b) RANKL-HBsAg recombinant protein encoding sequence; (c) termination signal element AOX (TT).

The preparation method of expression cassette of the present invention comprises the steps: that (1) comprises the encoding sequence fixed point insertion of RANKL-HBsAg recombinant protein in the plasmid of start signal element AOX and termination signal element AOX (TT), to obtain single copy expression plasmid; (2) described single copy expression plasmid is transformed to obtain complete RANKL-HBsAg expression of recombinant proteins box.

In preferred implementation of the present invention, the plasmid that adopts can be: pPIC3.5 (K), pAO815 or pHIL-D2 etc., as long as it contains start signal element AOX and termination signal element AOX (TT); Preferred pPIC3.5 (K) plasmid.

The encoding sequence fixed point of RANKL-HBsAg recombinant protein can be inserted between the 5AOX1 and 3AOX (TT) of plasmid, preferably be inserted between EcoRI restriction enzyme site and the NotI restriction enzyme site.Can adopt the amplification from the single copy expression plasmid that has made up of ordinary method such as PCR method to have the expression cassette of termination signal element 3AOX (TT), and change the restriction enzyme site at two ends.In preferred implementation of the present invention, preferred fragment 5 ends are the BglII site, and 3 ends are the BamHI site, and this fragment is inserted the BamHI site, obtain to have at 3 ends of 3AOX (TT) single copy expression plasmid in BamHI site.Use other isocaudarners such as EcoRI/MunI as need, then need plasmid and fragment are further transformed.

As used herein, term " construction ", " construction of the present invention " and " expressing the construction of RANKL-HBsAg albumen " are used interchangeably, and all refer to the construction by the RANKL-HBsAg protein expression box of the present invention that contains 1 or 2-15 arranged in series of molecular biology method structure.In a preference of the present invention, preferably contain 3-12 in the described construction, more preferably 4-10 is individual, most preferably the expression cassette of the present invention of 5-8 arranged in series.

Can be by expression cassette mentioned above being repeated to insert the construction that makes up RANKL-HBsAg protein expression box of the present invention in the plasmid.In preferred implementation of the present invention, adopt methods such as isocaudarner, flat terminal connection that described expression cassette is repeated to insert in the described plasmid, preferably adopt isocaudarner.In another preferred implementation of the present invention, described method also comprises the construction with intestinal bacteria amplification gained.

Yeast cell and the preparation thereof of high expression level RANKL-HBsAg recombinant protein

As used herein, term " RANKL-HBsAg expresses yeast cell " or " yeast cell of the present invention " are used interchangeably, all refer to have the yeast cell of the expression RANKL-HBsAg recombinant protein of following feature: be integrated with the construction of the present invention of expressing RANKL-HBsAg in the described yeast cell, and described yeast cell is suitably being induced expression RANKL-HBsAg down, and forms virus-like particle.

The preparation method that RANKL-HBsAg of the present invention expresses yeast cell comprises step: with construction transformed yeast cell of the present invention, to obtain to express the yeast cell of RANKL-HBsAg.Described conversion can adopt the method for transformation of routines of the present invention such as electricity conversion, protoplast transformation to carry out.The virus-like particle that is produced by yeast cell of the present invention has the epitope close with natural RANKL, and can stimulate immune system to produce the protectiveness neutralizing antibody.

In preferred implementation of the present invention, can adopt the yeast cell that is selected from down group: pichia spp, yeast saccharomyces cerevisiae or debaryomyces hansenii, preferably adopt pichia spp, for example GS115 bacterial strain, SMD1163 bacterial strain, KM71 bacterial strain (preferred GS115 bacterial strain).The RANKL-HBsAg expression amount of yeast cell of the present invention can reach the 20-1000mg/L fermented liquid, preferred 50-300mg/L fermented liquid.

Vaccine composition

The invention provides a kind of vaccine composition, it contains significant quantity (as 0.000001-50wt%; Preferable 0.00001-20wt%; Better, RANKL-HBsAg recombinant protein of the present invention (preferably purified) 0.0001-10wt%), and acceptable carrier on the immunology.Vaccine composition of the present invention can be used for by the influence of RANK/RANKL/OPG system being treated, alleviated or improving the disease relevant with this approach or symptom.In addition, vaccine composition of the present invention also can be united use with other therapeutical agent or assistant agent simultaneously.

As used herein, the composition of " acceptable on the immunology " is applicable to people and/or Mammals and does not have excessive bad side reaction (as toxicity, stimulation and transformation reactions), namely has the material of rational benefit/risk ratio.Term " acceptable carrier on the immunology " refers to the carrier for the immune-active agent administration, comprises various vehicle and thinner.

This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Usually vaccine preparation should be complementary with administering mode, and vaccine composition of the present invention can be made into the injection form, for example with physiological saline or contain glucose and the aqueous solution of other assistant agent is prepared by ordinary method.Described vaccine composition should be made under aseptic condition.The dosage of activeconstituents is treatment or prevention significant quantity.Preparation of the present invention also can be made into sustained release preparation.

The significant quantity of immune-active agent can change with severity of the pattern of administration and disease to be treated etc. in the present composition.The selection of preferred significant quantity can be determined (for example by clinical trial) according to various factors by those of ordinary skills.Described factor includes but not limited to: the pharmacokinetic parameter biological example utilization ratio of immune-active agent, metabolism, transformation period etc.; The severity of the disease that the patient will treat, patient's body weight, patient's immune state, the approach of administration etc.For example, by an urgent demand for the treatment of or prevention situation, but give the dosage that several times separate every day, or dosage is reduced pari passu.

PH in the present composition or carrier etc. can be as indicated above, and can be selected with general knowledge as required by those of ordinary skills.

The administering mode of vaccine composition of the present invention has no particular limits, can be whole body or local.Preferably, vaccine composition of the present invention can give object by the mode of intramuscular injection, usually, when the dosage of immune-active agent of the present invention with about 0.00001-50mg/kg the weight of animals (preferable 0.0001-10mg/kg the weight of animals) gives, can obtain gratifying effect.Also can adopt the means of gene therapy to carry out administration, such as can be directly with immune-active agent by delivering medicine to the experimenter such as methods such as injections; Perhaps can be delivered on the target spot by the ceneme (such as expression vector or virus etc.) that certain approach will carry immune-active agent, and make it to express RANKL-HBsAg albumen of the present invention.

Can directly give Mammals (such as the people) with described RANKL-HBsAg albumen, perhaps, the gene of coding RANKL-HBsAg albumen can be cloned in the appropriate carriers (as conventional protokaryon or carrier for expression of eukaryon or virus vector such as herpesvirus vector or adenovirus carrier) by the method for routine, described carrier is imported in the cell that can express described albumen or polypeptide, make described cell expressing RANKL-HBsAg albumen.Can realize the expression of RANKL-HBsAg albumen by an amount of described cell being incorporated into the suitable position of body of mammals.

Advantage of the present invention

The invention has the advantages that:

1. the yeast cell that obtains by recombinant technology insertion list or high copy number RANKL-HBsAg expression cassette of the present invention has obtained high expression level amount and expression product unexpectedly and has had high reactivity, is suitable for suitability for industrialized production thus;

2. yeast cell production RANKL-HBsAg recombinant protein of the present invention can effectively induce body to produce anti-RANKL antibody, thereby for improving and treating because of the RANKL/OPG ratio unbalance disease that causes of rise or symptom.

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition (for example can with reference to usually according to normal condition described in " molecular cloning: lab guide " (the same) condition or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Unless otherwise defined, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any method similar or impartial to described content and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.

The structure of embodiment 1. single copy expression plasmids

Human mesenchymal stem cell, BMP-2 recombinant adenovirus, plasmid pPIC3.5K change (getting in the transformation of the basis of the pPIC3.5K of invitrogen company plasmid) available from Shanghai Vaccine and Serum Institute; Intestinal bacteria TOP10 strain, pichia spp GS115 strain are available from invitrogen company.

1.RANKL the preparation of cDNA

Cultivator mescenchymal stem cell (available from Shanghai Vaccine and Serum Institute) according to a conventional method, going down to posterity back the 2nd day, add 500 μ l BMP-2 recombinant adenovirus in the nutrient solution and induce human mesenchymal stem cell to be divided into scleroblast, change liquid after 3 days and digest results after 1/3,7 day.Total RNA of extracting cell adopts the RT-PCR method to obtain RANKLcDNA.Identify that through agarose electrophoresis gained cDNA really is RANKL cDNA.

2.RANKL the point mutation transformation

Use overlapping extension PCR, RANKL is transformed, rite-directed mutagenesis (shown in Figure 1A and 1B) takes place in the site that makes the follow-up enzyme of influence cut operation, and the primer is as shown in table 1:

Table 1.

3.RANKL-HBsAg the fusion of gene fragment

Adopt overlapping extension PCR that RANKL and HBsAg gene fragment are merged, middle genes encoding with connection peptides GGGGSGGGGGS links to each other (shown in Fig. 2 A), and it is carried out electrophoresis check (shown in Fig. 2 B).The primer is as shown in table 2:

Table 2.

SEQ ID NO	Title	Sequence
			19	Joint HBsAg	GGTGGTGGTGGTAGTGGTGGTGGTGGTGGTAGTGAG
20	HBsAg NotI R	CGCGGCCGCTTAAATGTATACCCAGAGACA

4. single copy plasmid pPIC3.5K changes-structure of RH

Change the gene fragment with RANKL-HBsAg with EcoRI, NotI double digestion plasmid pPIC3.5K, enzyme is cut product and is carried out agarose electrophoresis, cuts plasmid and fragment that enzyme is cut, uses AXYGEN glue to reclaim test kit and reclaims.The digested plasmid that reclaims is connected 2 hours with fragment for 22 ℃ with the T4 ligase enzyme.Connect product and mix intestinal bacteria TOP10 competent cell, ice bath 30 minutes, 42 ℃ 90 seconds, ice bath is coated LB amp flat board, 37 ℃ of constant incubator overnight incubation.Bacterium colony with on the sterilization toothpick picking flat board is inoculated in 3ml LB amp substratum, and 37 ℃ of shaking table 250rpm are cultured to saturated with the amplification bacterium colony.

Bacterium liquid uses AXYGEN plasmid extraction test kit extracting plasmid in a small amount.EcoRI, NotI double digestion plasmid carry out agarose electrophoresis and identify (as shown in Figure 3A).To identify that correct clone bacterium liquid send evaluations of checking order of the English Weihe River prompt base (Shanghai) trade Co., Ltd, uses universal sequencing primer thing 5 ' AOX and the two-way survey of 3 ' AOX to lead to.

500 μ l are identified that correct clone bacterium liquid adds 500 μ l glycerine, mixing ,-80 ℃ of refrigerator preservations.

The structure of gained plasmid is shown in Fig. 3 B.

The structure of embodiment 2. high copy expression plasmids

Utilize the isocaudarner principle, the expressed intact box that will have 5 ' AOX, RANKL-HBsAg gene and transcription terminator inserts in the plasmid repeatedly, obtained pPIC3.5K to change-RH (single copy), pPIC3.5K to change-RH2C (2 copy), pPIC3.5K change-RH4C (4 copy) changes-RH8C the plasmid (shown in Fig. 4 A) of four kinds of different copy numbers such as (8 copy) with pPIC3.5K.Detailed process is as follows:

The plasmid pPIC3.5K of gained among the embodiment 1 is changed-RH uses BglII, MluI and BamHI, MluI double digestion respectively.The plasmid glue of BamHI, MluI double digestion reclaims big fragment, and BglII, MluI double digestion plasmid reclaim small segment.Two groups of endonuclease bamhis are connected, and BamHI and BglII are isocaudarners, connect back restriction enzyme site disappearance, thereby finish the connection of two expression cassettes.Connect product and transform picking colony amplification cultivation, extracting plasmid.BglII, BamHI double digestion plasmid, agarose electrophoresis is identified, is identified that correct plasmid is pPIC3.5K and changes-RH2C.Repeat said process, finish pPIC3.5K to change-RH4C and pPIC3.5K change-structure of RH8C.The BamHI of different copy number plasmids, the evaluation of BglII double digestion and BamHI single endonuclease digestion qualification result are shown in Fig. 4 B.

Structure and the expression of embodiment 3. pichia spp reorganization RANKL-HBsAg expression strain

By the electric shock with recombinant plasmid transformed to the yeast born of the same parents, plasmid in the yeast born of the same parents with yeast genes group generation homologous recombination, thereby RANKL-HBsAg is incorporated into (as Fig. 5 A) in the yeast genes group.Particularly:

With SalI digested plasmid pPIC3.5K change, pPIC3.5K changes-RH and pPIC3.5K change-RH8C makes plasmid linearization.Get linearization plasmid and 80 μ l yeast competent cells (Zhi Bei competence yeast cell GS115 according to a conventional method) that 10 μ l obtain by above-mentioned steps, mixing is transferred in the electric shock cup of precooling.Using electric shock instrument (eppendorf) 1500V to carry out electricity for 5 milliseconds transforms.

Transform back bacterium liquid to electricity and add 1ml 1M sorbyl alcohol dilution bacterium liquid rapidly, and coat the RDB flat board, 28 ℃ of constant incubators were cultivated 3-5 days.Picking recombination yeast bacterium colony is inoculated in 5ml BMGY substratum, and 28 ℃ of shaking table 250rpm are cultured to OD ₆₀₀Reach 2-6.Adjust the bacterium liquid measure, centrifugal 5 minutes of 2500rpm abandons supernatant, and thalline is resuspended with 10ml BMMY, guarantees resuspended back OD ₆₀₀Be 1.28 ℃ of shaking table 250rpm cultivated 3-5 days, added 0.5% methyl alcohol every day.Results bacterium liquid, centrifugal 5 minutes of 4000rpm abandons supernatant.Add the broken damping fluid of 1ml, 500 μ l granulated glass spherees and 1 steel ball, use the broken bacterium machine concussion of concussion 2 minutes, the ice bath cooling repeats 3 times.Centrifugal 10 minutes of 12000rpm draws supernatant.

Adopt SDS-PAGE method and ELISA method to identifying by the product of above-mentioned steps abduction delivering.GS115-pPIC3.5K changes-RH abduction delivering 3 days, and the bacterial cell disruption supernatant is identified with SDS-PAGE and is found the expection band.GS115-pPIC3.5K changes-and ELISA (HBsAg) reading of inducing bacterial cell disruption supernatant after 3 days of RH is as shown in table 3:

Table 3.

The clone	Negative control	1	2	3	4
						OD ₄₅₀	0.127	0.832	0.750	0.105	0.742

GS115-pPIC3.5K changes-and RH and GS115-pPIC3.5K change-each four strain positive colony abduction delivering of RH8C 3 days, and the bacterial cell disruption supernatant compares with the expression amount of the RANKL-HBsAg of ELISA.Shown in Fig. 5 B, the expression amount of 8 copy plasmid transformants will be significantly higher than single copy plasmid transformant.

The method bacterial cell disruption supernatant of electron microscopic observation send East China Normal University's Electron Microscopy Room to carry out electron microscopic observation, and sample adopts acetic acid uranium just to dye (Fig. 5 C).The result shows, uses the RANKL-HBsAg of Pichia anomala expression can spontaneous formation virus-like particle, because the RANKL of particle surface itself has the characteristic that forms homotrimer, it is more obvious that RANKL-HBsAgVLP forms string polymers tendency than HBsAg VLP.

Embodiment 4.15L scale pilot scale fermentation

The GS115-pPIC3.5K of preparation among the embodiment 3 is changed-the recombinant expressed strain of RH8C is inoculated in 500ml BMGY substratum, and 28 ℃ of shaking table 250rpm are cultured to OD ₆₀₀Reach 2-6.Bacterium liquid is inoculated in 4.5L inorganic salt fermented liquid, culture condition: 28 ℃, to add ammoniacal liquor and keep pH 5.00, dissolved oxygen is controlled about 30%, and rotating speed progressively is promoted to 600rpm with growing state.

Be cultured to about 20 hours and add glycerine, the feed supplement flow velocity progressively improves, and about feed supplement 800ml, stops feed supplement.Treat that glycerine exhausts back 30 minutes, begin to add methanol induction or carry out methyl alcohol glycerine mixing feed supplement that feed supplement speed progressively improves, and induces about 60 hours, stops feed supplement.In the feed supplement process, note to prevent the methyl alcohol accumulation.After treating that methyl alcohol exhausts, stop fermentation, results bacterium liquid.Centrifugal 15 minutes of 4000rpm abandons supernatant, and thalline is stored in-80 ℃ of refrigerators.

With the sample 1ml that each time point in the fermenting process is gathered, centrifugal 1 minute of 12000rpm abandons supernatant, surveys the thalline weight in wet base.Use ELISA to measure expression amount behind the bacterial cell disruption.Measurement result as shown in Figure 6, the result shows that the cell density that mixes feed supplement significantly improves than the single feed supplement of methyl alcohol, the RANKL-HBsAg expression amount is corresponding raising also.

The separation and purification of embodiment 5. reorganization RANKL-HBsAg

RANKL-HBsAg can't be secreted into outside the born of the same parents because formation VLP is bulky, thereby has adopted the mode of expressing in the born of the same parents.

According to the flow process shown in Fig. 7 A sample is carried out purifying: at first, adopt high-pressure homogeneous crusher machine yeast body, in bacterial cell disruption liquid, add an amount of Triton X-100 and DNase and carry out pre-treatment, subsequently centrifugal removal cell debris.Add 30% ammonium sulfate in the sample behind the centrifugal clarification and carry out ammonium sulfate precipitation.Sample hydrophobic chromatography (Butyl post through the ammonium persulphate processing, available from Bo Gelong, sample on 7.5% ammonium sulfate, water elution) carries out preliminary purification, elution samples use again ion exchange chromatography (the SP post, available from GE, the last sample of pH6.0PB, collect stream and wear liquid) be further purified, thus obtained the RANKL-HBsAg of purifying.

(primary antibodie: how anti-the anti-RANKL of rabbit is, available from Abcam to adopt Western blotting; Two is anti-: Gt X Rb HRP mark IgG (H+L), available from Millipore) identify, confirmed that the albumen that purifying obtains is RANKL-HBsAg (Fig. 7 B).Purification of samples master tape N end sequencing result is: MIRAE, and consistent with expected sequence.Detect purification of samples with the determination of protein concentration method, recording sample concentration is 1.549mg/ml.

The expression and purification of embodiment 6. intestinal bacteria reorganization RANKL

In order to verify the generation of anti-RANKL antibody, the contriver has made up the recombinant expressed RANKL bacterial strain of intestinal bacteria.The recombinant expressed strain of RANKL is carried out separation and purification through the IPTG abduction delivering by steps such as bacterial cell disruption, nickel ion affinity chromatograph, ion exchange chromatographies, has obtained the reorganization RANKL of purifying.Use the RANKL bag of purifying by 96 orifice plates, set up the ELISA method for quick of anti-RANKL antibody and learned, antibody generates situation and antibody titers is provided convenience in order to study.Particularly:

Bacterial strain uses therefor, carrier are as follows: intestinal bacteria TOP10 strain (available from invitrogen company), e. coli bl21 (DE3) and plasmid pET28a (available from Merck company).

In the normal condition RANKL gene fragment that increases downwards, template used for pPIC3.5K changes-RH, primer is as shown in table 4 by PCR:

Table 4.

SEQ ID NO	Title	Sequence
			21	RANKLNcoI F	GCCATGGGCATCAGA
22	RANKLXhoI R	GCTCGAGATCTATAT

With NcoI, XhoI double digestion plasmid pET28a and RANKL gene fragment, enzyme is cut product and is carried out agarose electrophoresis, downcuts plasmid and fragment that enzyme is cut, uses AXYGEN glue to reclaim test kit and reclaims.The digested plasmid that glue is reclaimed is connected 2 hours with fragment for 22 ℃ with the T4 ligase enzyme.Connect product and mix intestinal bacteria TOP10 competent cell, ice bath 30 minutes, 42 ℃ 90 seconds, ice bath is coated LB kan flat board, 37 ℃ of constant incubator overnight incubation.The amplification bacterium colony uses the plasmid in the AXYGEN a small amount of plasmid extraction test kit extracting bacterium liquid then.NcoI, XhoI double digestion plasmid, digested plasmid carry out agarose electrophoresis to be identified.To identify that correct clone bacterium liquid send evaluations of checking order of the English Weihe River prompt base (Shanghai) trade Co., Ltd, uses universal sequencing primer thing T7 promoter primer and the two-way survey of T7 terminator primer to lead to.

The collection of illustrative plates of gained pET28a-RANKL recombinant plasmid as shown in Figure 8.

PET28a-RANKL plasmid 1 μ l is mixed with e. coli bl21 (DE3) competent cell, ice bath 30 minutes, 42 ℃ 90 seconds, ice bath is coated LB kan flat board, 37 ℃ of constant incubator overnight incubation.Bacterium colony with on the sterilization toothpick picking flat board is inoculated in 1ml LB kan substratum, and it is saturated that 37 ℃ of shaking table 250rpm are cultured to, and with the amplification bacterium colony, obtains BL21 (DE3)-pET28a-RANKL expression strain.

Adopt following method express recombinant RANKL: in 5ml LB kan substratum, 37 ℃ of shaking table 250rpm are cultured to OD with bacterial classification inoculation ₆₀₀0.6 about.Add 1M IPTG at 1: 1000,28 ℃ of shaking table 250rpm induced 6 hours.Centrifugal 1 minute of bacterium liquid 12000rpm keeps supernatant.Bacterial sediment is resuspended with 500 μ l PBS, keeps 100 μ l.Remain resuspended bacterium liquid and use ultrasonic disruption 5 minutes, centrifugal 10 minutes of 12000rpm keeps supernatant.Precipitate resuspended with 500 μ l PBS.Nutrient solution supernatant, the complete resuspended liquid of bacterium, broken bacterium supernatant, broken bacterium precipitate that resuspended liquid carries out SDS-PAGE and western blotting is identified and (used RANKL-HBsAg mouse immune pooled serum as primary antibodie, thinning ratio 1: 1000; Gt X Ms HRP mark IgG/IgM is anti-as two, thinning ratio 1: 5000).

Adopt the flow process shown in Fig. 9 A that RANKL is carried out purifying: intestinal bacteria cross the clarification of 0.45 μ m millipore filtration micro-filtration after fragmentation is centrifugal.Use nickel ion affinity chromatograph (chelating post earlier, available from GE, sample on the 20mM imidazoles, 20mM-250mM imidazoles linear elution) carries out preliminary purification, re-use ion exchange chromatography (Q post, SP post, available from GE, the last sample of pH6.5PB, 0.3M the NaCl wash-out) be further purified, thereby obtained the RANKL of purifying.

(primary antibodie: how anti-the anti-RANKL of rabbit is, available from Abcam to adopt Western blotting; Two is anti-: Gt X Rb HRP mark IgG (H+L), available from Millipore) identify, confirmed that the albumen that purifying obtains is RANKL (Fig. 9 B).Detect purification of samples with the determination of protein concentration method, recording sample concentration is 56.72 μ g/ml.

The immunity of embodiment 7.RANKL-HBsAg inducing mouse produces anti-RANKL neutralizing antibody

In the RANKL-HBsAg sample stoste of purifying, add formaldehyde solution with 1: 1000 (volume ratio), place detoxification in 3 days for 37 ℃.Sample stoste is diluted to three concentration of 320,80,20 μ g/ml through the PBS serial dilution.To doubly adding aluminium adjuvant, 1: 200 (volume ratio) adds the 1mg/ml Thiomersalate, and aluminium adjuvant absorption is spent the night, and makes the immunogen of three kinds of dosage of 10,40,160 μ g/ml.

To clean level 4 week Balb/c female mices in age (available from Shanghai Slac Experimental Animal Co., Ltd.) and be divided into four groups, 10 every group.One group of negative control group, injection PBS 1ml, the immunogen 1ml of other three groups of difference

abdominal injections

10,40, three dosage of 160 μ g/ml.Per 2 all immunity once are total to immunity three times.After last immune two weeks, pluck eyeball and get blood.With blood sample be placed on 37 ℃ 1 hour, centrifugal 30 minutes of 1500rpm keeps upper serum.Every part of immune serum got 20 μ l, as mixed immunity serum, puts-20 ℃ of refrigerators and preserves behind the mixing.

Get the RANKL of the purifying that makes among the embodiment 6, by 96 orifice plates, detect the generation situation (antibody titers) of anti-RANKL antibody in the immune serum with 100ng/ hole bag with indirect method ELISA.Be enough to reach the upper limit of detection (Fig. 9 A) of ELISA even if the result shows the antibody of the immunizing dose generation of adopting 10 μ g/ml, proved that RANKL-HBsAg can produce anti-RANKL antibody by the effective stimulus body really.The antibody titers of mixed immunity serum is about 10 after measured ^-4～10 ^-5(Fig. 9 B).

The research of embodiment 8. anti-RANKL mouse immune serum extracorporeal blocking RAW264.7 cytodifferentiation

In order to study the extracorporeal neutralizing activity of the anti-RANKL antibody that RANKL-HBsAg induces, the inventor uses RAW264.7 cell (available from Chinese Academy of Sciences's Shanghai cell bank) as main research object.The RAW264.7 cell is a kind of mononuclear macrophage leukemia cell, and it has the characteristic similar to the osteoclast precursor cell, can break up, merge under the stimulation of RANKL, forms multinucleated osteoclast.This research adds the mouse pooled serum after the RANKL-HBsAg immunity in the substratum when RANKL induces stimulation.By mtt assay and TRAP dyeing, observe cell inhibitory effect that anti-RANKL antibody blocking RANKL induces and the situation of cytodifferentiation.

1. immune serum blocking-up RANKL suppresses RAW264.7 cel l proliferation (mtt assay)

Behind the conventional RAW264.7 cell of cultivating of digestion, cell is counted, and be diluted to 10 with nutrient solution (DMEM that contains 10% foetal calf serum) ⁴Individual/ml, be inoculated in 96 orifice plates, every hole adds 200 μ l, 5%CO ₂37 ℃ of overnight incubation of constant incubator.Every hole adds RANKL (10 μ g/ml) 1 μ l, and blank well does not add.

Immune Balb/c mouse is got immune serum and dilutes with 1: 10,1: 100,1: 1000 with nutrient solution as described in example 7 above, adds former times of serum or each extent of dilution serum 2 μ l respectively in corresponding aperture, and negative hole does not add.5%CO ₂37 ℃ of cultivations of constant incubator were changed liquid to the 3rd day, added RANKL and immune serum according to the above ratio.Cultivated the 6th day, and detected the cell proliferation situation with mtt assay.

The result is shown in Figure 11 A, and the result shows that the RANKL-HBsAg immune serum has the activity that blocking-up RANKL suppresses RAW264.7 cell proliferation.The reorganization RANKL-HBsAg that experimental results show that Pichia anomala expression can induce body to produce anti-RANKL antibody, and the antibody that produces has the neutralization activity of blocking-up RANKL effect.

2. immune serum is blocked the RAW264.7 cytodifferentiation that RANKL induces

Behind the conventional RAW264.7 cell of cultivating of digestion, cell is counted, and be diluted to 10 with nutrient solution (DMEM that contains 10% foetal calf serum) ⁴Individual/ml, be inoculated in 12 orifice plates, every hole adds 500 μ l, 5%CO ₂37 ℃ of overnight incubation of constant incubator.Every hole adds RANKL (10 μ g/ml) 2.5 μ l, and blank well does not add.

With dilution in 1: 10,1: 100,1: 1000, former times of serum and each extent of dilution added 5 μ l to immune serum in corresponding aperture with nutrient solution, and negative hole does not add.5%CO ₂37 ℃ of cultivations of constant incubator were changed liquid to the 3rd day, added RANKL and immune serum according to the above ratio.Be cultured to the 6th day, carry out TRAP dyeing, observation of cell differentiation situation.The result is shown in Figure 11 B.

Osteoclast is carried out cell counting: 5 visuals field of every hole picked at random, counting multinucleated osteoclast number (3 more than the nuclear), the cell count in 5 visuals field of adding up.The result is shown in Figure 11 C.

The above results shows, the RANKL-HBsAg immune serum has blocking-up RANKL, and to induce the RAW264.7 cytodifferentiation be the activity of osteoclast.The reorganization RANKL-HBsAg that Pichia anomala expression is confirmed in experiment again induces the anti-RANKL antibody of body generation to have the neutralization activity of blocking-up RANKL effect.

The research that acts in the OPG knock out mice of the embodiment 9.RANKL-HBsAg body

OPG can block RANKL and be combined with RANK as the natural antagonistic molecule of RANKL, suppresses formation and the activation of osteoclast, thereby keeps the reconstruction balance of skeletal system.Development along with transgenic technology, utilize the OPG knock out mice strain of embryonic stem cell gene knockout technology foundation not only for the physiological function research of research OPG provides platform, it can also be used for the research of pathomechanism and treatment as the osteoporosis model.This research uses the recombinant expressed OPG knock out mice of RANKL-HBsAg of pichia spp to carry out immunity, observe it to the influence of mouse bone density, bone biomechanical and bone micro-structure, assess RANKL-HBsAg as result for the treatment of and the application prospect of therapeutic vaccine with this.

1. laboratory animal

3 the week age SPF level OPG gene knockout homozygote C57 mouse (OPG ^-/-) male and female each 4 available from Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd.; 3 ages in week each 4 of cleaning level C57BL/6 mouse male and female available from Shanghai Slac Experimental Animal Co., Ltd..

2. mouse immune flow process and sample preparation

The RANKL-HBsAg of purifying is prepared into the immunogen of 100 μ g/ml through Sterile Filtration, formaldehyde detoxification, aluminium adjuvant absorption.

OPG ^-/-Respectively be divided into two groups with the C57BL/6 mouse, every group of male and female half and half.One group of abdominal injection RANKL-HBsAg 1ml wherein, another group is control group, intraperitoneal injection of saline 1ml.Per 2 all immunity once are total to immunity three times.After the last immune week, abdominal injection tetracycline marker 30mg/kg, mouse is handled and injected once with same dosage in preceding 2 days again.

The blood of coring behind the mouse etherization is got bilateral femur, shin bone.Blood sample be placed on 37 ℃ 1 hour, centrifugal 30 minutes of 1500rpm keeps upper serum.The gauze parcel that femur soaked with physiological saline ,-20 ℃ of preservations.Shin bone is fixed 2 days with 75% ethanol, is immersed in 85%, 95%, 100% ethanol each 2 days then successively, and dehydration is stored in the dehydrated alcohol step by step.

3. the mensuration of the anti-RANKL antibody of serum

RANKL with purifying wraps by 96 orifice plates with the 100ng/ hole, induces the situation (ditto) of anti-RANKL antibody with RANKL-HBsAg in the indirect method ELISA detection mice serum.

Test-results is shown in Figure 12 A, and this result proves: with the recombinant expressed RANKL-HBsAg immunity OPG of pichia spp ^-/-Can make it produce anti-RANKL antibody with the C57BL/6 mouse.

4. bone biomechanical is measured

Mouse femur is taken out from refrigerator, after thawing naturally, carry out right side femur three point bending test with micro-control electronic universal tester (Shanghai Ninth People's Hospital Affiliated to Shanghai Jiao Tong University Sch provides use).

Measure the minor axis in femur stage casing and the length of major axis with vernier callipers earlier, adjust bearing then at a distance of 1cm, femur is placed on two bearings at the position relatively uniformly, and the short-axis direction of femur is parallel with vertical direction.Masterpiece is used on the femur of two bearing mid points.Loading velocity 2mm/min, span 1cm measures femur maximum deflection load.

Test result is shown in Figure 12 B and 12C, and this result proves: the biomechanics of bone intensity of OPG knock out mice will significantly be lower than wild-type, and the OPG knock out mice is after the RANKL-HBsAg immunity, and its biomechanics of bone intensity has recovery to a certain degree.

5. the observation of mouse bone micro-structure

Get cillin bottle, handle inwall with silicone oil.Put into a small amount of polymethylmethacrylate piece, mouse shin bone sample and methyl methacrylate monomer liquid.Vacuumized 4 hours, and covered bottle cap, 4 ℃ left standstill 4-7 days.Continue under the normal temperature to place polymerization, until sclerosis.Sample is placed 40 ℃ of baking ovens, until sclerosis fully.Cillin bottle is smashed the back take out embedded block, accomplish suitable shape, be cut into 100～200 μ m section with slicing machine.

Mat glass sheet abrasive disc 2～3 minutes are used in section respectively, continue abrasive disc with P300, P800, P1200 sand paper again, remove the tool marks of tissue surface, are milled to 50～70 μ m.Section is fastened with glue on the synthetic glass slide glass, plastic covering paper, counterweight flattens, and places 24 hours.Throw off plastic paper, carry out abrasive disc with P1200 sand paper, remove the glue vestige.Behind the polishing powder mixing distilled water, pick with flannelette section is polished, to there not being obvious cut.

Place dehydrated alcohol to soak 2 hours section, put into the pinkish red staining fluid of picric acid and dye, dry after the rinsing in the clear water, put then under 40 power microscopes and observe bone micro-structure.

40 power microscopes of mouse shin bone embedded section are observed bone micro-structure shown in Figure 12 D.From shin bone sections observation, OPG ^-/-The trabecular bone loss of control group is the most obvious, and OPG ^-/-The bone trabecula of immune group is similar to wild-type.The result shows, after using the RANKL-HBsAg immunity, prevented the trabecular bone loss phenomenon that produces owing to the OPG defective, proved that anti-RANKL antibody that RANKL-HBsAg induces can substitute the effect of OPG really to a certain extent, avoided rebuilding the bone-loss that causes because of excessive bone.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Claims

1. construction of be used for expressing the RANKL-HBsAg recombinant protein, described construction contains the expression cassette of 1 expression cassette or 2-15 arranged in series, and each described expression cassette comprises following element:

(a) start signal element AOX;

(b) RANKL-HBsAg recombinant protein encoding sequence, described RANKL-HBsAg recombinant protein encoding sequence is by forming with the lower section:

(i) the RANKL encoding sequence of aminoacid sequence shown in the coding SEQ ID NO:3,

(ii) encode aminoacid sequence shown in the SEQ ID NO:1 the HBsAg encoding sequence and

(iiii) encoding sequence of the connection peptides GGGGSGGGGGS between RANKL and HBsAg encoding sequence;

(c) termination signal element AOXTT.

2. construction as claimed in claim 1 is characterized in that, the aminoacid sequence of described RANKL-HBsAg recombinant protein is shown in SEQ ID NO:8.

3. yeast cell of expressing the RANKL-HBsAg recombinant protein, it is characterized in that, be integrated with the construction of expressing the RANKL-HBsAg recombinant protein in the karyomit(e) of described yeast cell, described construction contains the expression cassette of 1 expression cassette or 2-15 arranged in series, and each described expression cassette comprises following element:

(a) start signal element AOX;

(c) termination signal element AOXTT;

Wherein, described yeast cell is being induced expression RANKL-HBsAg recombinant protein down, and the being made by manufacturers or users in described yeast of described recombinant protein becomes virus-like particle.

4. yeast cell as claimed in claim 3 is characterized in that, described yeast cell is selected from: pichia spp, yeast saccharomyces cerevisiae or debaryomyces hansenii.

5. yeast cell as claimed in claim 3 is characterized in that, described virus-like particle is showed in the surface with RANKL, and can stimulate immune system to produce anti-RANKL antibody.

6. one kind comprises RANKL-HBsAg recombinant protein virus-like particle, it is characterized in that, described virus-like particle is produced by the described yeast cell of claim 3.

7. a method for preparing the RANKL-HBsAg recombinant protein is characterized in that, described method comprises step:

(i) under conditions suitable for the expression, cultivate the described yeast cell of claim 3, thereby make it express the RANKL-HBsAg recombinant protein; With

(ii) separation and purification RANKL-HBsAg recombinant protein from described yeast cell.

8. a RANKL-HBsAg recombinant protein is characterized in that, described recombinant protein be express to be produced by the construction described in the claim 1, produced by the yeast cell described in the claim 3, or by the described method preparation of claim 7.

9. the purposes of the described yeast cell of claim 3, the described virus-like particle of claim 6 or the described RANKL-HBsAg recombinant protein of claim 8; it is characterized in that it is for the preparation of the vaccine of the relevant bone-loss of prevention or treatment RANK/RANKL/OPG system.

10. purposes as claimed in claim 9 is characterized in that, the relevant bone-loss of described RANK/RANKL/OPG system is osteoporosis.

11. a vaccine composition, it comprises:

(a) the described RANKL-HBsAg recombinant protein of claim 8; And

(b) acceptable carrier and/or adjuvant on the immunology.