CN102399807A - Swine transmissible gastroenteritis S/N protein fusion gene, recombinant lactococcus lactis and application - Google Patents
Swine transmissible gastroenteritis S/N protein fusion gene, recombinant lactococcus lactis and application Download PDFInfo
- Publication number
- CN102399807A CN102399807A CN2011104247137A CN201110424713A CN102399807A CN 102399807 A CN102399807 A CN 102399807A CN 2011104247137 A CN2011104247137 A CN 2011104247137A CN 201110424713 A CN201110424713 A CN 201110424713A CN 102399807 A CN102399807 A CN 102399807A
- Authority
- CN
- China
- Prior art keywords
- fusion gene
- gly
- ala
- protein
- lys
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a swine transmissible gastroenteritis S/N protein fusion gene, recombinant lactococcus lactis and application. The invention provides an antigen fusion gene obtained by connecting A and D antigen loci in swine transmissible gastroenteritis virus (TGEV) S protein and an N321 antigen locus in N protein and a streptococcus pyogenes cell wall anchoring sequence, and a nucleotide sequence of the antigen fusion gene is shown as SEQ ID No. 1. The invention further provides an expression vector containing the antigen fusion gene and the recombinant lactococcus lactis strain containing the recombinant expression vector. The recombinant lactococcus lactis strain is induced by using nisin, the fusion gene can be expressed on the surface of the bacterial cell wall. Immunoblotting experiments indicate that the expressed recombinant protein can react with TGEV immune serum and has the same antigenicity with TGEV natural antigens, and the recombinant protein can be prepared into safe and effective mucous immune live vaccines for preventing and treating swine transmissible gastroenteritis.
Description
Technical field
The recombinant bacterial strain that the present invention relates to antigen fusion gene and contain this antigen fusion gene; The expression vector that relates in particular to pig infectious gastroenteritis virus S/N protein fusion gene and contain this fusion gene; The invention further relates to recombination lactic acid lactococcus spp (Lactococcus lactis) bacterial strain and their purposes in preparation control transmissible gastroenteritis of swine vaccine that contain this expression vector, belong to the prevention and control field of transmissible gastroenteritis of swine.
Background technology
Transmissible gastroenteritis of swine is that (Transmissible gastroenteritis virus of swine, TGEV) caused is the height contagious disease of principal character with serious diarrhoea, vomiting, dehydration and high mortality by TGE.TGEV mainly is present in jejunum and duodenum, the equal susceptible of the pig of various ages in days.Because piglet self resistibility is poor, is subject to the influence of extraneous various stimuluss and the invasion and attack of pathogenic micro-organism, death takes place because of serious dehydration in regular meeting, and the highest with interior piglet mortality ratio with 2 ages in week, can reach 100%.With the increase of age in days, though mortality ratio descends gradually, infect this sick pig production performance and descend, price of deed rate is low, all brings serious economy loss for worldwide pig industry.Transmissible gastro-enteritis virus has the characteristics of tangible intestinal tissue preferendum mainly through the intestinal tract infections pig, and except that humoral immunization and cellular immunization, local intestines mucosa immunity system is being brought into play irreplaceable effect in anti-TGEV infection immunity process.
Conventional inactivated vaccine and less toxic vaccine have played active effect in these two kinds of diseases of control, obtain good effect, but still have some problems, and be poor like the inactivated vaccine immunogenicity, can not effectively induce slgA, and opposing is infected; The postvaccinal animal body of less toxic vaccine row loose virus, virus virulence possibly return strong etc., in addition must be through the injecting pathway immunity.To these sick characteristics, adopting oral immunity is ideal prevention approach comparatively, but how to avoid gi tract to antigenic destruction and effectively induce immune response become the key of technology.TGEV has three kinds of primary structure albumen; Be respectively nucleocapsid protein N, membranin M and the glycosylated spike protein S of phosphorylation; Wherein S gp carries main bone-marrow-derived lymphocyte antigen determining family; And absorption that can mediated cell, the processes such as generation of neutralizing antibody can provide effective immanoprotection action.
TGEV infects to have and significantly has a liking for intestines property; Combining of the spike protein (S albumen) on virus particle surface and the aminopeptidase that is present in the intestinal epithelial cells teleblem (APN) is the most important condition that infects generation; Mucosal immunity is the principal character of this disease-specific immunne response, and the height of intestinal mucosa surface SIgA content directly determines the generation and the disease severity of clinical disease.
To the several characteristics of transmissible gastroenteritis of swine morbidity, adopting oral immunity is ideal prevention approach comparatively.The outstanding advantage of oral immunity is to stimulate enteron aisle local immunity cell to produce secretory IgA effectively, and this especially is adapted to the intestinal mucosa transmissible disease, and immunogen was degraded before arriving mucous membrane of small intestine or the possibility of deactivation but oral immunity need overcome.Live vectors such as use bacteriophage transmit undamaged antigenic component and have solved this problem; Have at present and use the report of attenuated bacteria as the carrier of vaccine antigen; Like Salmonellas, weak malicious listeria bacteria etc.; But Salmonellas possibly exist virulence to return strong danger as the carrier transfer dna vaccination; DNA also may be incorporated into the host cell gene group, causes a series of problems such as the expression of genetic disorder, proto-oncogene and cancer suppressor gene that regulating cell is grown is out of control, somatocyte canceration, cell transition.
Summary of the invention
One of the object of the invention provides a kind of pig infectious gastroenteritis virus S/N proteantigen fusion gene and encoded protein thereof;
Two of the object of the invention provides the expression vector of the fusion gene that contains above-mentioned pig infectious gastroenteritis virus S/N proteantigen site;
Three of the object of the invention provides the recombinant host that contains above-mentioned expression vector bacterial strain.
To achieve these goals, one aspect of the present invention provides a kind of by the N in A, D antigen site and the N albumen in the pig infectious gastroenteritis virus S protein
321Antigen site and streptococcus pyogenes cell walls anchor series (CWA
M6) connecting the antigen fusion gene that obtains, its polynucleotide sequence is shown in the SEQ ID No.1.
The present invention is with the N in A, D antigen site (Sad) and the N albumen in the TGEV S albumen
321Antigen site and streptococcus pyogenes cell walls anchor series (CWA
M6) (is the cell walls anchor series with proteic last 140 amino acid of streptococcus pyogenes M6) couple together; That considers that lactococcus lactis ssp accesses to your password son has a liking for situation partially; In order to improve the expression of heterologous gene in the host bacterium; And guarantee rare codon Serine (TCG), Threonine (ACG), proline(Pro) (CCC), l-arginine (CGG), phenylalanine(Phe) (TTC) etc. to be changed, but do not change its coded amino acid under the constant situation of amino acid after the translation.(AAC-AAT, ATC-ATT ACA-ACT) carry out point mutation, but do not change its coded amino acid to 3 sites that methylate on the A antigen site.Linker ((GGGGS) through two flexibilities
3) with A, D antigen site gene and the N of TGEV
321The antigen site gene couples together and (is D-Linker-N in proper order
321-Linker-A), and this sequence called after MLSN (SEQ ID No.1); In addition, introduce NcoI restriction enzyme site and SacI restriction enzyme site respectively at the upstream and downstream of MLSN.
Another aspect of the present invention provides by antigen fusion gene encoded protein shown in the SEQ ID No.1, and its aminoacid sequence is shown in the SEQ ID No.2.。
Another aspect of the present invention provides the expression vector that contains said antigen fusion gene; For example; Antigen fusion gene shown in the SEQ ID No.1 of the present invention is connected with expression vector pNZ8149, and obtaining can be at the outside surface of lactococcus lactis ssp or the secretion expression carrier of cell walls antigen expressed fusion gene.
Thus, the proteic recombination lactic acid lactococcus strain of strain expression pig infectious gastroenteritis virus S/N that provides on the one hand more of the present invention can be prepared into the safe and effective mucosal immunity live bacterial vaccines of control transmissible gastroenteritis of swine by enough its.
The present invention carries out fusion gene shown in the SEQ ID No.1 double digestion with secretion expression carrier pNZ 8149, is connected and changes lactococcus lactis ssp (Lactococcus lactis) NZ3900 cell over to through electric shock, obtains to contain the lactococcus lactis ssp called after NZ3900-pNZ8149-MLSN of recombinant plasmid; Its microbial preservation number is: CCTCC No:M2011444; The classification name is: Lactococcus lactis NZ3900-pNZ8149-MLSN; The preservation time is on December 5th, 2011; Depositary institution is: Chinese typical culture collection center; The preservation address is: Chinese Wuhan Wuhan University.
Further, the present invention induces recombination lactic acid lactococcus spp bacterium WH320-pHIS1525-MLS with newborn streptobacillus peptide Nisin, goal gene is expressed on the thalline surface; Immunoblot experiment shows; Expressed recombinant protein can react with the TGEV immune serum; Showing that recombinant protein is the same with the TGEV natural antigen has an identical antigenicity, can be used in the safe and effective mucosal immunity live bacterial vaccines that is prepared into the control transmissible gastroenteritis of swine.
The present invention has made up the NZ3900-pNZ8149-MLSN expression vector system, has expressed to contain TGEV albumin A/D site and N albumen N
321Site and streptococcus pyogenes cell walls anchor series CWAM6 catenation sequence MLSN (the about 28kDa of target protein); Western blot test shows that expressed recombinant protein can react with the TGEV immune serum, shows that recombinant protein is the same with the TGEV natural antigen to have an identical antigenicity.Indirect immunofluorescence confirms that also expressing protein is present on the thalline; Viable bacteria body immunofluorescent test behind the abduction delivering shows; Expressed recombinant protein Primary Location is in the surface of thalline; Having the target protein on thalline surface is antigenic substance effective stimulus immunity system, improves antibody horizontal and has established important basic substance.
The present invention is directed to TGEV takes place and immune several characteristics; The first line of defence that in experimental design, infects with blocking-up infectious intestinal disease disease pathogen is a purpose; Utilize the adhesion on intestinal mucosa of milk-acid bacteria expression system, field planting and the expression of safety non-toxic and transmit antigenic substance; Thereby antigenic substance more approaches the natural infection approach of virus to the immunostimulation of mucous membrane, and the mucosa-immune that is therefore produced protection effect is with even more ideal.Simultaneously; Itself has adjuvant effect milk-acid bacteria; Can obviously strengthen immunogenicity of antigens, body does not produce strong antibody response reaction to lactic acid bacteria vector system itself, and milk-acid bacteria also can be synthesized some biologically active substances; Like lactobacillin, bacteriocin, multiple organic acid etc., these materials itself just have bacteriostasis antibiosis, diarrhea effect.
The term definition that arrives involved in the present invention
Only if in addition definition, otherwise all technology used herein and scientific terminology all have with those skilled in the art and understand identical implication usually.Though in practice of the present invention or test, can use any method, device and the material similar or equivalent, describe preferred method, device and material now with person described herein.
Term " recombinant host bacterial strain " or " host cell " mean the cell that comprises polynucleotide of the present invention; And no matter use which kind of method to insert, for example directly absorb to produce recombinant host cell, known other method in transduction, f pairing or the affiliated field.Exogenous polynucleotide for example can remain, and the nonconformity carrier of plasmid perhaps can be integrated in the host genome.
Term " polynucleotide " or " Nucleotide " mean deoxyribonucleotide, dezyribonucleoside, ribonucleoside or ribonucleotide and the polymkeric substance thereof of sub-thread or bifilar form.Only if specific limited, otherwise the nucleic acid of the known analogue that contains natural nucleotide contained in said term, said analogue have the binding characteristic that is similar to reference nucleic acid and carry out metabolism with the mode of the Nucleotide that is similar to natural generation.Only if other specific limited, otherwise said term also means oligonucleotide analogs, it comprises PNA (PNAG3), used DNA analogue (thiophosphatephosphorothioate, phosphoramide acid esters or the like) in antisense technology.Unless otherwise, otherwise specific nucleic acid sequence is also impliedly contained its conservative varient of modifying (including, but is not limited to degenerate codon replaces) and complementary sequence and clear and definite specified sequence.Specific; Can realize that through mixing base and/or the substituted sequence of Hypoxanthine deoxyriboside residue degenerate codon replaces (people such as Batzer, Nucleic AcidRes.19:5081 (1991) through producing one of them or selected more than one (or all) codon the 3rd; People such as Ohtsuka, J.Biol.Chem.260:2605-2608 (1985); With people such as Cassol, (1992); People such as Rossolini, Mol Cell.Probes 8:91-98 (1994)).
Term " polypeptide ", " peptide " and " albumen " exchange in this article and use to mean the polymkeric substance of amino-acid residue.That is, be equally applicable to describe peptide and describe albumen and vice versa to the description of polypeptide.Said term is applicable to natural generation aminoacid polymers and one of them or the aminoacid polymers that above amino-acid residue is a non-naturally encoded amino acids.As used herein, the amino acid chain of any length contained in said term, and it comprises full-length proteins (being antigen), and wherein amino-acid residue connects via the covalency peptide bond.
Description of drawings
Fig. 1 PCR product electrophoresis result.
Fig. 2 PCR product electrophoresis result; M: protein molecular weight standard; 1, the NcoI of pNZ8149-MLSN, SacI enzyme are cut the result; 4, the PCR of MLSN identifies.
The SDS-PAGE of Fig. 3 expression product and Western-blot analyze; M: protein molecular weight standard; 1: the protein after recombination lactic acid lactococcus spp NZ3900-pNZ8149 induces; Protein after 2-3, reorganization NZ3900-pNZ8149-MLSN induce; 4: the proteinic immunoblotting after recombination lactic acid lactococcus spp NZ3900-pNZ8149-MLSN induces.
The indirect immunofluorescence of Fig. 4 expression product detects (* 40); The IFA test-results of A:NZ3900-pNZ8149-MLSN reorganization bacterium, somatic cells has distributed the intensive yellow-green fluorescence; The IFA test-results of B:NZ3900-pNZ8149 reorganization bacterium does not have fluorescence, and thalline takes on a red color.
Embodiment
Further describe the present invention below in conjunction with specific embodiment, advantage of the present invention and characteristics will be more clear along with description.But these embodiment only are exemplary, scope of the present invention are not constituted any restriction.It will be understood by those skilled in the art that and down can make amendment with form or replace without departing from the spirit and scope of the present invention, but these modifications and replacing all fall in protection scope of the present invention the details of technical scheme of the present invention.
The structure and the evaluation of embodiment 1MLSN gene lactococcus lactis ssp secretion expression carrier
The design of the sequence of epitope more than 1 MLSN is with synthetic
Pig infectious gastroenteritis virus S protein contains A, B, C, D totally 4 antigen sites; Wherein A (536-593 residue district) and D (376-392 residue district) antigen site play an important role in inducing the generation neutralizing antibody, and the A antigen site is a main B cell antigen epi-position.Transmissible gastro-enteritis virus contains 4 main t cell epitopes, wherein the N on the N albumen
321(321-335 residue district) antigen site can be induced intensive t cell responses, and can assist the synthetic proteic specific antibody of the promptly anti-S of neutralizing antibody in vivo by inducing T cell.
Linker ((GGGGS) through two flexibilities
3) with A, D antigen site gene and the N of TGEV
321The antigen site gene couples together and (is D-Linker-N in proper order
321-Linker-A), and this sequence called after ADN.Rare codon Serine (TCG), Threonine (ACG), proline(Pro) (CCC), l-arginine (CGG), phenylalanine(Phe) (TTC) etc. are changed, but do not change its coded amino acid.(AAC-AAT, ATC-ATT ACA-ACT) carry out point mutation, but do not change its coded amino acid to 3 sites that methylate on the A antigen site.Upstream and downstream shown in the MLSN (SEQ ID No.1) is introduced NcoI restriction enzyme site and SacI restriction enzyme site respectively.The MLSN sequence that designs is carried out synthetic, made up recombinant plasmid pMD18-MLSN.
PMD18-T Simple Vector purchases white TaKaRa (Dalian) company, and the concrete building process of pMD18-MLSN is following:
The pcr amplification goal gene
In the PCR reaction tubes, add following reagent and solution:
The PCR reaction system of table 1MLSN
P1：5’-GA?
AGA?TCT?ATGTCTGTAAGTGATTCAAGCT?3’
P2：5’-ACAT?
GCA?TGC?GTTTTCTTCTTTGCGTTTTAC?3’
Be positioned in the PCR appearance after mixing is also centrifugal, behind 94 ℃ of preparatory sex change 5min, circulate as follows: 94 ℃, 30s; 54 ℃, 30s; 72 ℃, 30s.30 circulations are extended 10min for back 72 ℃.Pcr amplification is got 5 μ L products and is observed with 1% agarose gel electrophoresis after accomplishing.And reclaim test kit specification sheets recovery enzyme with reference to dna gel and cut product, reclaiming the test kit specification sheets with reference to dna gel and reclaim the PCR reaction product, operation steps is following:
With 100 μ L PCR products electrophoresis in 1% sepharose; Under UV-lamp, downcut the sepharose that contains target DNA; Add the DE-A solution (for dna gel reclaims the reagent in the test kit) of 3 gel volumes, mix the back in 75 ℃ of heating and melting.Add the DE-B solution (for dna gel reclaims the reagent in the test kit) of 0.5 DE-A volume, mix.Get above mixed solution, be transferred to and centrifugally in the DNA preparation pipe abandon filtrating.To prepare pipe and put back centrifuge tube, and add 0.5ml W1 solution (for dna gel reclaims the reagent in the test kit), the centrifugal 30s of 12000rpm abandons filtrating.To prepare pipe and put back centrifuge tube, and add 0.7ml W2 solution (for dna gel reclaims the reagent in the test kit), the centrifugal 30s of 12000rpm abandons filtrating, repeats this step once.To prepare pipe and put back in the centrifuge tube the centrifugal 1min of 12000rpm.Preparation pipe is placed clean 1.5ml centrifuge tube, add in right amount (20 μ L) water or the elutriant room temperature leaves standstill 1min, the centrifugal 1min eluted dna of 12000rpm in preparation film centre.Fetch to receive in product 1 μ L 1% sepharose and carry out electrophoresis, detect and reclaim the result.And it is subsequent use in-20 ℃ of preservations.
The PCR product is connected and conversion with cloning vector
Pressing pMD18-T Simple Vector specification sheets is connected the PCR product that reclaims with pMD18-T Vector.Linked system is seen table 2:
Table 2 ligation system
Centrifugal behind the mixing, place 16 ℃ of water-baths to connect 4h, 4 ℃ are spent the night.After the connection, contain the plasmid called after pMD18-MLSN of MLSN sequence.
The structure of 2 recombinant expression vectors
The vector plasmid pNZ 8149 (plasmid pNZ8149 purchases the company in MoBiTec) of pMD 18-2DNA plasmid and secreting, expressing respectively with reclaiming behind the NcoI+Sac I double digestion, is used T
4DNA ligase couples together and is built into recombinant plasmid pNZ8149-MLSN.
2.1MLSN the enzyme of sequence is cut and is reclaimed
The endonuclease reaction system is seen table 3.
Table 3NcoI, SacI double digestion reaction system
100 μ L enzymes are cut product electrophoresis in 1% sepharose, and reclaim test kit specification sheets recovery enzyme with reference to dna gel and cut product, reclaim the test kit specification sheets with reference to dna gel and reclaim the PCR reaction product, operation steps is following:
With 100 μ L PCR products electrophoresis in 1% sepharose; Under UV-lamp, downcut the sepharose that contains target DNA; Add the DE-A solution (for dna gel reclaims the reagent in the test kit) of 3 gel volumes, mix the back in 75 ℃ of heating and melting.Add the DE-B solution (for dna gel reclaims the reagent in the test kit) of 0.5 DE-A volume, mix.Get above mixed solution, be transferred to and centrifugally in the DNA preparation pipe abandon filtrating.To prepare pipe and put back centrifuge tube, and add 0.5ml W1 solution (for dna gel reclaims the reagent in the test kit), the centrifugal 30s of 12000rpm abandons filtrating.To prepare pipe and put back centrifuge tube, and add 0.7ml W2 solution (for dna gel reclaims the reagent in the test kit), the centrifugal 30s of 12000rpm abandons filtrating, repeats this step once.To prepare pipe and put back in the centrifuge tube the centrifugal 1min of 12000rpm.Preparation pipe is placed clean 1.5ml centrifuge tube, add in right amount (20 μ L) water or the elutriant room temperature leaves standstill 1min, the centrifugal 1min eluted dna of 12000rpm in preparation film centre.Fetch to receive in product 1 μ L 1% sepharose and carry out electrophoresis, detect and reclaim the result, the big or small about 850bp (Fig. 1) that conforms to expected results of nucleotide fragments.
2.2 the enzyme of the carrier pNZ8149 of lactococcus lactis ssp secreting, expressing is cut and is reclaimed
A large amount of enzymes of the carrier pNZ8149 of lactococcus lactis ssp secreting, expressing are cut, and the endonuclease reaction system is seen table 4.
Table 4NcoI, SacI double digestion reaction system
100 μ L enzymes are cut product electrophoresis in 1% sepharose, and reclaim test kit specification sheets recovery enzyme with reference to dna gel and cut product, more than the concrete steps reference, fetch to receive in product 1 μ L 1% sepharose and carry out electrophoresis, detect and reclaim the result.And it is subsequent use in-20 ℃ of preservations.
2.3MLSN the structure of gene lactococcus lactis ssp secretion expression carrier
The enzyme of above step preparation is cut purified product connect, linked system is seen table 5.
The carrier pNZ8149 ligation system of table 5MLSN gene secreting, expressing
After 16 ℃ of water-baths connected 4h, 4 ℃ were spent the night.
The purifying that connects product: will connect product and be transferred in the 1.5ml centrifuge tube, add the absolute ethyl alcohol mixing gently of 3mol/L sodium-acetate (pH5.2) and the 50 μ L of 2.0 μ L, place-20 ℃, 1h after; 4 ℃, the centrifugal 30min of 12000rpm carefully remove supernatant, add 70% ethanol of 500 μ L; 4 ℃, the centrifugal 5min of 12000rpm carefully remove supernatant, and be air-dry to there not being the ethanol smell; Add 4 μ L sterilization deionized water dissolving deposition ,-20 ℃ of preservations are subsequent use.
2.4pNZ8149-MLSN the double digestion of plasmid, PCR identify
(1) with the above-mentioned plasmid that reclaims, with NcoI, Sac I double digestion, the endonuclease reaction system is following:
The double digestion reaction system of table 6pNZ8149-MLSN plasmid
The above component of mixing gently, 37 ℃ of water-bath 4h get 5 μ L enzymes and cut product and observe with 1% agarose gel electrophoresis.Can cut out the purpose fragment and pNZ8149 carrier plasmid of the same size is accredited as the positive.
(2) the above-mentioned plasmid that extracts is diluted 100 times with sterile purified water; Get 2 μ L as template, carry out PCR and identify, get in PCR product 1 μ L 1% sepharose and carry out electrophoresis; Detect and reclaim the result; Obtain the nucleotide fragments size and be about 2600bp and 850bp (Fig. 2), show that the MLSN gene has been inserted between the restriction enzyme site NcoI of expression vector pNZ8149, the SacI, with the positive recombinant plasmid called after pNZ8149-MLSN that obtains; With the positive recombinant bacterial strain called after NZ3900-pNZ8149-MLSN bacterial strain that obtains.
The expression and the qualification result of embodiment 2MLSN gene lactococcus lactis ssp
The structure of 1MLSN gene lactococcus lactis ssp and electricity transform
After will connecting product and electric transformed competence colibacillus cell NZ9000 (lactococcus lactis ssp NZ9000 purchases the company in MoBiTec) mixing, place 5min on ice; Its precooling electricity that changes 2mm over to is transformed in the cup; With Transformation Apparatus 165-2101 electric shock, shock parameters is voltage 2kV, and the time is 4.5ms; The SGM17MC of electric shock back adding 900 μ L ice precooling (the GM17 liquid nutrient medium adds 0.5mol/L sucrose,, 0.02mol/L magnesium chloride, 0.002mol/L calcium chloride) recovery media, mixing; Bacterium liquid is transferred in the 1.5mL centrifuge tube, places 10min on ice; 30 ℃ of anaerobism are cultivated 2h; Get an amount of bacterium liquid and coat on the GM17 nutrient agar that contains 5 μ g/mL paraxin, 30 ℃ of anaerobism are cultivated 2-3d.The single bacterium colony of picking on flat board is inoculated in respectively in the GM17 liquid nutrient medium that contains 5 μ g/mL Cm, after 30 ℃ of anaerobism overnight cultures, from lactococcus lactis ssp, extracts plasmid.Recombinant plasmid is carried out enzyme cut evaluation, PCR evaluation and sequencing analysis, will transform and obtain recombinant plasmid lactococcus lactis ssp called after NZ3900-pNZ8149-MLSN.
Abduction delivering of 2 recombination lactic acid lactococcus sppes and evaluation
PNZ8112-Sa/NZ9000 and pNZ8112/NZ9000 contrast bacterium are inoculated in the GM17 liquid nutrient medium, after 30 ℃ of anaerobism overnight cultures, get overnight culture and are inoculated in the 20mL substratum with 1: 25 ratio, and 30 ℃ are cultured to OD
600Be about 0.4, get the 10mL inoculum and induce 2-3h with the newborn streptobacillus peptide Nisin of 1ng/mL.Take out the 1mL sample respectively with the centrifugal 3min of 12000r/min after stopping cultivating, abandon supernatant; Suspend with 200 μ L PBS solution, the centrifugal 3min of 12000r/min abandons supernatant; The N,O-Diacetylmuramidase that adds 100 μ L 10mg/mL, 30min is placed in 37 ℃ of water-baths, boiling water bath 5min, the deactivation N,O-Diacetylmuramidase, the centrifugal 3min of 12000r/min abandons supernatant; Add 1 * PBS (OD
600* 50 μ L) and equivalent 2 * sds gel sample loading buffer (containing DTT), fully mixing boils 10min, and the centrifugal 3min of 12000r/min gets supernatant 10 μ L on kind, is reference with the protein standard molecular weight, and 10%SDS-PAGE carries out electrophoretic analysis.
The immune marking (western-blot) of 3 expression products is analyzed
Gel after the above-mentioned electrophoresis end is transferred to albumen on transfer printing damping fluid equilibrated nitrocellulose filter energized, 0.5-1mA/cm through transfer device
2Transfer printing 1h.After transfer printing finished, the anti-TGEV serum of rabbit was as first antibody, and as SA, the 20min that develops the color in the 4-chloro-1-naphthols substrate chromophoric solution detects the antigenic activity of expression product with the horseradish peroxidase-labeled goat anti-rabbit igg.
Detected result shows; Recombination lactic acid lactococcus spp NZ3900-pNZ8149-MLSN has the band of expression at about 28kDa place; Goal gene is obtaining effectively expressing (shown in arrow) in the engineering bacteria; Along with the increase of induction time, the content of target protein also progressively increases in the supernatant, and does not contain target protein (Fig. 3) in the positive control bacterium supernatant.Detect through Western-blot and to show that recombinant protein has the ability that the antiserum(antisera) with the preparation of TGEV totivirus reacts, and have good specificity, i.e. reactionogenicity.
4 indirect immunofluorescences
Get positive reorganization bacterium that 12h cultivates with empty carrier contrast bacteria liquid culture 0.5mL is centrifugal remove supernatant after, wash 3 times the anti-TGEV antiserum(antisera) in adding rabbit source respectively with the PBS low-speed centrifugal; Suspend and mix back 37 ℃ of effect 30min, the centrifugal supernatant that goes, PBS is centrifugal to wash thalline 3 times; The anti-rabbit fluorescent mark that contains Evans Blue two that adds dilution is anti-, suspends to mix back 37 ℃ of effect 30min, the centrifugal supernatant that goes; PBS is centrifugal to wash thalline 3 times, and the bacterial sediment thing is suspended in 200 μ L PBS, gets an amount of smear; Seasoning, cold acetone is 30min fixedly, dry back fluorescence microscope.
Show with NZ3900-pNZ8149-MLSN reorganization bacterium and the NZ3900-pNZ8149 contrast indirect immunofluorescence experiment result that bacterium was carried out; The visible significantly yellow-green fluorescence of reorganization bacterium NZ3900-pNZ8149-MLSN fluorescence microscopy; Show also that thus the expressed foreign protein of reorganization bacterium is the surface location that is present in thalline; NZ3900-pNZ8149 does not find green fluorescence, and thalline is dyed redness (Fig. 4).
< 110>Wuhan Huayang Animal Pharmaceutical Co., Ltd.
< 120>transmissible gastroenteritis of swine S/N protein fusion gene and recombination lactic acid lactococcus spp and application
<130> DQXL-0016
<160> 2
<170> PatentIn?version?3.5
<210> 1
<211> 843
<212> DNA
<213> Artifical?sequence
<220>
<221> CDS
<222> (1)..(843)
<400> 1
aug?tct?gta?agt?gat?tca?agc?ttt?ttt?agt?tac?ggt?gaa?att?ccg?ttc 48
Met?Ser?Val?Ser?Asp?Ser?Ser?Phe?Phe?Ser?Tyr?Gly?Glu?Ile?Pro?Phe
1 5 10 15
ggc?gta?act?gat?gga?cca?cgt?tac?tgt?tac?ggt?ggc?ggt?ggc?tct?ggc 96
Gly?Val?Thr?Asp?Gly?Pro?Arg?Tyr?Cys?Tyr?Gly?Gly?Gly?Gly?Ser?Gly
20 25 30
gga?ggt?ggg?agc?ggc?ggt?ggt?ggc?agc?caa?ttt?ctt?cag?cag?att?aat 144
Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gln?Phe?Leu?Gln?Gln?Ile?Asn
35 40 45
gcc?tat?gct?cgt?cca?tca?gaa?gta?gca?aaa?gaa?cag?aga?aaa?aga?aaa 192
Ala?Tyr?Ala?Arg?Pro?Ser?Glu?Val?Ala?Lys?Glu?Gln?Arg?Lys?Arg?Lys
50 55 60
tct?cgt?ggt?ggt?ggc?ggt?tct?ggc?gga?ggt?ggc?agc?ggc?ggt?ggc?ggt 240
Ser?Arg?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly
65 70 75 80
tct?ggt?atg?aag?cgt?agt?ggt?tat?ggt?caa?cct?ata?gcc?tca?aca?tta 288
Ser?Gly?Met?Lys?Arg?Ser?Gly?Tyr?Gly?Gln?Pro?Ile?Ala?Ser?Thr?Leu
85 90 95
agt?aat?att?act?cta?cca?atg?cag?gat?cac?aac?acc?aca?gat?gta?tac 336
Ser?Asn?Ile?Thr?Leu?Pro?Met?Gln?Asp?His?Asn?Thr?Thr?Asp?Val?Tyr
100 105 110
tgt?att?cgt?tct?gac?caa?ttt?tca?gtt?tat?gtt?cat?tct?act?tgc?aaa 384
Cys?Ile?Arg?Ser?Asp?Gln?Phe?Ser?Val?Tyr?Val?His?Ser?Thr?Cys?Lys
115 120 125
agt?gct?tta?tgg?gac?aat?att?ttt?aag?cga?aac?tgc?acg?aaa?gct?tta 432
Ser?Ala?Leu?Trp?Asp?Asn?Ile?Phe?Lys?Arg?Asn?Cys?Thr?Lys?Ala?Leu
130 135 140
gaa?gaa?gca?aac?agc?aaa?tta?gct?gct?ctt?gaa?aaa?ctt?aac?aaa?gag 480
Glu?Glu?Ala?Asn?Ser?Lys?Leu?Ala?Ala?Leu?Glu?Lys?Leu?Asn?Lys?Glu
145 150 155 160
ctt?gaa?gaa?agc?aag?aaa?tta?aca?gaa?aaa?gaa?aaa?gct?gag?cta?caa 528
Leu?Glu?Glu?Ser?Lys?Lys?Leu?Thr?Glu?Lys?Glu?Lys?Ala?Glu?Leu?Gln
165 170 175
gca?aaa?ctt?gaa?gca?gaa?gca?aaa?gca?ctc?aaa?gaa?caa?tta?gcg?aaa 576
Ala?Lys?Leu?Glu?Ala?Glu?Ala?Lys?Ala?Leu?Lys?Glu?Gln?Leu?Ala?Lys
180 185 190
caa?gct?gaa?gaa?ctt?gca?aaa?cta?aga?gct?gga?aaa?gca?tca?gac?tca 624
Gln?Ala?Glu?Glu?Leu?Ala?Lys?Leu?Arg?Ala?Gly?Lys?Ala?Ser?Asp?Ser
195 200 205
caa?acc?cct?gat?gca?aaa?cca?gga?aac?aaa?gtt?gtt?cca?ggt?aaa?ggt 672
Gln?Thr?Pro?Asp?Ala?Lys?Pro?Gly?Asn?Lys?Val?Val?Pro?Gly?Lys?Gly
210 215 220
caa?gca?cca?caa?gca?ggt?aca?aaa?cct?aac?caa?aac?aaa?gca?cca?atg 720
Gln?Ala?Pro?Gln?Ala?Gly?Thr?Lys?Pro?Asn?Gln?Asn?Lys?Ala?Pro?Met
225 230 235 240
aag?gaa?act?aag?aga?cag?tta?cca?tca?aca?ggt?gaa?aca?gct?aac?cca 768
Lys?Glu?Thr?Lys?Arg?Gln?Leu?Pro?Ser?Thr?Gly?Glu?Thr?Ala?Asn?Pro
245 250 255
ttc?ttc?aca?gcg?gca?gcc?ctt?act?gtt?atg?gca?aca?gct?gga?gta?gca 816
Phe?Phe?Thr?Ala?Ala?Ala?Leu?Thr?Val?Met?Ala?Thr?Ala?Gly?Val?Ala
260 265 270
gca?gtt?gta?aaa?cgc?aaa?gaa?gaa?aac 843
Ala?Val?Val?Lys?Arg?Lys?Glu?Glu?Asn
275 280
<210> 2
<211> 281
<212> PRT
<213> Artifical?sequence
<400> 2
Met?Ser?Val?Ser?Asp?Ser?Ser?Phe?Phe?Ser?Tyr?Gly?Glu?Ile?Pro?Phe
1 5 10 15
Gly?Val?Thr?Asp?Gly?Pro?Arg?Tyr?Cys?Tyr?Gly?Gly?Gly?Gly?Ser?Gly
20 25 30
Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gln?Phe?Leu?Gln?Gln?Ile?Asn
35 40 45
Ala?Tyr?Ala?Arg?Pro?Ser?Glu?Val?Ala?Lys?Glu?Gln?Arg?Lys?Arg?Lys
50 55 60
Ser?Arg?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly?Ser?Gly?Gly?Gly?Gly
65 70 75 80
Ser?Gly?Met?Lys?Arg?Ser?Gly?Tyr?Gly?Gln?Pro?Ile?Ala?Ser?Thr?Leu
85 90 95
Ser?Asn?Ile?Thr?Leu?Pro?Met?Gln?Asp?His?Asn?Thr?Thr?Asp?Val?Tyr
100 105 110
Cys?Ile?Arg?Ser?Asp?Gln?Phe?Ser?Val?Tyr?Val?His?Ser?Thr?Cys?Lys
115 120 125
Ser?Ala?Leu?Trp?Asp?Asn?Ile?Phe?Lys?Arg?Asn?Cys?Thr?Lys?Ala?Leu
130 135 140
Glu?Glu?Ala?Asn?Ser?Lys?Leu?Ala?Ala?Leu?Glu?Lys?Leu?Asn?Lys?Glu
145 150 155 160
Leu?Glu?Glu?Ser?Lys?Lys?Leu?Thr?Glu?Lys?Glu?Lys?Ala?Glu?Leu?Gln
165 170 175
Ala?Lys?Leu?Glu?Ala?Glu?Ala?Lys?Ala?Leu?Lys?Glu?Gln?Leu?Ala?Lys
180 185 190
Gln?Ala?Glu?Glu?Leu?Ala?Lys?Leu?Arg?Ala?Gly?Lys?Ala?Ser?Asp?Ser
195 200 205
Gln?Thr?Pro?Asp?Ala?Lys?Pro?Gly?Asn?Lys?Val?Val?Pro?Gly?Lys?Gly
210 215 220
Gln?Ala?Pro?Gln?Ala?Gly?Thr?Lys?Pro?Asn?Gln?Asn?Lys?Ala?Pro?Met
225 230 235 240
Lys?Glu?Thr?Lys?Arg?Gln?Leu?Pro?Ser?Thr?Gly?Glu?Thr?Ala?Asn?Pro
245 250 255
Phe?Phe?Thr?Ala?Ala?Ala?Leu?Thr?Val?Met?Ala?Thr?Ala?Gly?Val?Ala
260 265 270
Ala?Val?Val?Lys?Arg?Lys?Glu?Glu?Asn
275 280
Claims (10)
1. transmissible gastro-enteritis virus (Transmissible gastroenteritis virus of swine) S/N proteantigen fusion gene, it is characterized in that: its polynucleotide sequence is shown in the SEQ ID No.1.
2. by the said fusion gene encoded protein of claim 1 sequence, it is characterized in that: its aminoacid sequence is shown in the SEQ ID No.2.
3. the recombinant expression vector that contains the said pig infectious gastroenteritis virus S of claim 1/N proteantigen fusion gene.
4. contain the recombinant host cell strain of the said recombinant expression vector of claim 3.
5. according to the described recombinant host strain of claim 4, it is characterized in that: described recombinant host cell strain be the recombination lactic acid lactococcus spp (
Lactococcus lactis) bacterial strain, its microbial preservation number is: CCTCC No:M2011444.
6. the described pig infectious gastroenteritis virus S of claim 1/N proteantigen fusion gene is prevented and treated the purposes in the transmissible gastroenteritis of swine vaccine in preparation.
7. the described albumen of claim 2 is prevented and treated the purposes in the transmissible gastroenteritis of swine vaccine in preparation.
8. the described recombinant expression vector of claim 3 is prevented and treated the purposes in the transmissible gastroenteritis of swine vaccine in preparation.
9. claim 4 or 5 described recombinant host cell strains prevent and treat the purposes in the transmissible gastroenteritis of swine vaccine in preparation.
10. according to any one described purposes of claim 6-9, it is characterized in that: described vaccine is the mucosal immunity live bacterial vaccines.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011104247137A CN102399807A (en) | 2011-12-16 | 2011-12-16 | Swine transmissible gastroenteritis S/N protein fusion gene, recombinant lactococcus lactis and application |
| CN201210523651.XA CN103194471B (en) | 2011-12-16 | 2012-12-06 | Transmissible gastroenteritis of swine S/N protein fusion gene and Recombinant Lactococcus lactis and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011104247137A CN102399807A (en) | 2011-12-16 | 2011-12-16 | Swine transmissible gastroenteritis S/N protein fusion gene, recombinant lactococcus lactis and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102399807A true CN102399807A (en) | 2012-04-04 |
Family
ID=45882454
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011104247137A Pending CN102399807A (en) | 2011-12-16 | 2011-12-16 | Swine transmissible gastroenteritis S/N protein fusion gene, recombinant lactococcus lactis and application |
| CN201210523651.XA Active CN103194471B (en) | 2011-12-16 | 2012-12-06 | Transmissible gastroenteritis of swine S/N protein fusion gene and Recombinant Lactococcus lactis and application |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210523651.XA Active CN103194471B (en) | 2011-12-16 | 2012-12-06 | Transmissible gastroenteritis of swine S/N protein fusion gene and Recombinant Lactococcus lactis and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN102399807A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103060250A (en) * | 2012-12-07 | 2013-04-24 | 山东信得科技股份有限公司 | Genetically engineered bacteria strain expressing porcine transmissible gastroenteritis virus |
| CN103194471A (en) * | 2011-12-16 | 2013-07-10 | 武汉华扬动物药业有限责任公司 | Swine transmissible gastroenteritis virus S/N protein fusion gene and recombinant lactococcus lactis, and their use |
| CN112011497A (en) * | 2020-08-28 | 2020-12-01 | 上海交通大学 | Recombinant lactococcus lactis secreting and expressing swine-derived enterotoxigenic escherichia coli K88-resistant pilus single-chain antibody and preparation method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102399807A (en) * | 2011-12-16 | 2012-04-04 | 武汉华扬动物药业有限责任公司 | Swine transmissible gastroenteritis S/N protein fusion gene, recombinant lactococcus lactis and application |
-
2011
- 2011-12-16 CN CN2011104247137A patent/CN102399807A/en active Pending
-
2012
- 2012-12-06 CN CN201210523651.XA patent/CN103194471B/en active Active
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103194471A (en) * | 2011-12-16 | 2013-07-10 | 武汉华扬动物药业有限责任公司 | Swine transmissible gastroenteritis virus S/N protein fusion gene and recombinant lactococcus lactis, and their use |
| CN103194471B (en) * | 2011-12-16 | 2015-08-19 | 武汉华扬动物药业有限责任公司 | Transmissible gastroenteritis of swine S/N protein fusion gene and Recombinant Lactococcus lactis and application |
| CN103060250A (en) * | 2012-12-07 | 2013-04-24 | 山东信得科技股份有限公司 | Genetically engineered bacteria strain expressing porcine transmissible gastroenteritis virus |
| CN112011497A (en) * | 2020-08-28 | 2020-12-01 | 上海交通大学 | Recombinant lactococcus lactis secreting and expressing swine-derived enterotoxigenic escherichia coli K88-resistant pilus single-chain antibody and preparation method thereof |
| CN112011497B (en) * | 2020-08-28 | 2022-06-07 | 上海交通大学 | Recombinant lactococcus lactis for secretory expression of swine-derived enterotoxigenic escherichia coli K88 pilus single-chain antibody and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103194471B (en) | 2015-08-19 |
| CN103194471A (en) | 2013-07-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103194472B (en) | Porcine epizootic diarrhea virus S1 protein fusion gene and recombinant bacillus megaterium, and their use | |
| Huang et al. | Construction and immunogenicity analysis of Lactobacillus plantarum expressing a porcine epidemic diarrhea virus S gene fused to a DC-targeting peptide | |
| CN107099496B (en) | Recombinant lactic acid bacteria strain for fusion expression of chicken infectious bursal disease virus VP2 protein and salmonella outer membrane protein and application thereof | |
| CN106754594A (en) | A kind of Salmonella choleraesuls attenuated carrier bacterium and its construction method | |
| CN109303916A (en) | Coke dies GAP-associated protein GAP GSDMD and is preparing the application in ghost vaccine | |
| CN114908029B (en) | Construction and application of II-type grass carp reovirus VP6 recombinant lactobacillus | |
| CN101979501B (en) | Recombinant Salmonella choleraesuis for expressing surface antigen gene sao of streptococcus suis type 2, vaccine and application | |
| CN103194471B (en) | Transmissible gastroenteritis of swine S/N protein fusion gene and Recombinant Lactococcus lactis and application | |
| CN105907766B (en) | The recombinant yeast pichia pastoris and its construction method of expression goat alpha interferon and application | |
| Zhao et al. | Recombinant Lactobacillus casei expressing Clostridium perfringens toxoids α, β2, ε and β1 gives protection against Clostridium perfringens in rabbits | |
| CN103275228A (en) | K99-987P-F41 recombinant protein and application thereof | |
| CN100567477C (en) | Express the recombination lactic acid galactococcus and the method for making of pig infectious gastroenteritis virus S protein | |
| CN107446872A (en) | A kind of recombinant lactic acid bacteria vaccine strain of constitutive expression rabbit hemorrhagic disease virus VP60 albumen and its production and use | |
| WO2007083893A1 (en) | Cell surface expression vector of white spot syndrome virus antigen and microorganism transformed with the same | |
| CN103194470B (en) | Swine transmissible gastroenteritis virus antigen fusion gene and recombinant bacillus megaterium, and their use | |
| Shonyela et al. | Recombinant Lactobacillus plantarum NC8 strain expressing porcine rotavirus VP7 induces specific antibodies in BALB/c mice | |
| CN101368167A (en) | Recombinant lactobacillus casei for co-expression of swine fever virus T cell epitope and pig parvoviral VP2 protein, and method of producing the same | |
| CN108273052B (en) | Oral targeting epitope gene vaccine of vibrio mimicus and preparation method and application thereof | |
| CN107312736B (en) | Recombinant lactobacillus strain for fusion expression of IBDV VP2 protein and salmonella outer membrane protein RCK and application thereof | |
| CN101611143A (en) | Delivery of peptides is gone into the method and apparatus of stomach mucous membrane | |
| CN107164252A (en) | A kind of RHDV subunit vaccine | |
| CN110028559A (en) | A kind of application of pseudomonas aeruginosa vaccine recombinant protein and its encoding gene and they | |
| Wan et al. | Immunogenic analysis of two DNA vaccines of avian reovirus mediated by attenuated Salmonella typhimurium in chickens | |
| KR100933090B1 (en) | Adhesive fusion protein and immunoadjuvant for preventing or treating diarrhea in livestock | |
| RU2745626C1 (en) | Method of creating a live vaccine against covid-19 based on the probiotic strain enterococcus faecium l3 and a live vaccine enterococcus faecium l3-pentf-covid-19 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120404 |