RU2745626C1 - Method of creating a live vaccine against covid-19 based on the probiotic strain enterococcus faecium l3 and a live vaccine enterococcus faecium l3-pentf-covid-19 - Google Patents

Abstract

FIELD: medicine; virology; microbiology; molecular genetics; biotechnology.

SUBSTANCE: invention relates to medicine, virology, microbiology, molecular genetics and biotechnology. Presented is a live vaccine Enterococcus faecium L3-pentF-covid-19, containing a clone of enterococci COVID 19+ with a DNA region SEQ ID No: 1 introduced into its genome, providing expression of a protein having the amino acid sequence SEQID No: 2, stimulating humoral and cellular immunity in against the SARS-CoV-2 virus. Also presented is a method of obtaining the specified vaccine based on the probiotic strain Enterococcus faecium L3, modified as a result of electroporation of the culture of enterococci Enterococcus faecium L3 of the recombinant plasmid DNA pentF-covid-19, SEQ ID No: 1, characterized by the fact that the the pspf region of the plasmid pentF-pspf is replaced by a fragment of the gene of the SARS-CoV-2 spike protein, while the pentF-covid-19 DNA encodes the amino acid sequence SEQ ID No: 2, which functions as the spike protein of the SARS-CoV-2 virus, capable of stimulating humoral and cellular immunity against SARS-CoV-2 virus.

EFFECT: oral administration of the Enterococcus faecium pentF-covid-19 vaccine stimulates the development of a specific systemic and local immune response, which is manifested by the production of specific immunoglobulins of classes G and A, as well as increased production of interferon gamma in vaccinated animals.

2 cl, 7 dwg, 1 tbl, 5 ex

Description

The invention relates to the field of medicine, virology, microbiology, molecular genetics and biotechnology and can be used in the medical industry in the production of live vaccines for the prevention and treatment of infections caused by coronavirus. Coronaviruses ( Coronaviridae ) are a family of viruses that as of January 2020 includes 40 types of RNA viruses, combined into four subfamilies that infect humans and animals. The name is associated with the structure of the virus, which has spiny processes. They resemble the sun's corona and contain receptor-binding proteins on the surface that bind to transmembrane receptors in cells.

It is known that scientists from China have decoded and published on January 12, 2020 in the international database the genome of the new coronavirus [ 1- Guo YR, Cao QD, Hong ZS, Tan YY, Chen SD, Jin HJ, Tan KS, Wang DY, Yan Y . The origin, transmission and clinical therapies on coronavirus disease 2019 (COVID-19) outbreak - an update on the status. Mil Med Res. 2020 Mar 13; 7 (1): 11. doi: 10.1186 / s40779-020-00240-0. PMID: 32169119; PMCID: PMC7068984.] And that scientists around the world are currently conducting intensive research on the development of a vaccine against the SARS-CoV-2 coronavirus and their laboratory and test tests (brief information on human coronavirus is presented in the Appendix to the description of the invention).

Known probiotic strain Enterococcus faecium L3 ND-79 VNIISHM, intended for the manufacture of therapeutic and prophylactic agents and food for therapeutic purposes, is resistant to a wide range of antibiotics, more pronounced antagonism to pathogenic bacteria, high viability and a high level of production of vitamins of group "B "and folic acid; the known strain is the basis of the claimed invention [2 - RF patent No. 2220199 for a strain of enterococci Enterococcus faecium l-3 for the manufacture of therapeutic and prophylactic agents (patent holders and authors Alekhina GG and Suvorov AN)].

Known created on the basis of this strain [2] live vaccine for the prevention of vaginal infection caused by Streptococcus agalactiae (GBS). On the basis of the probiotic strain Enterococcus faecium L3, the first genetically engineered live vaccine with the pathogenic GBS protein gene inserted into the chromosome was designed. [3-T.V. Gupalova, G.F. Leontieva, E.I. Ermolenko, K.B. Grabovskaya, T.A. Kramskaya, A.N. Tsapieva, I.V. Koroleva, A.N.Suvorov. Creation and experience of using a live vaccine based on the probiotic strain Enterococcus Faecium L3 for the prevention of vaginal infection caused by Streptococcus agalactiae , Medical Academic Journal, 2013, 13 (2), pp. 64-70].

The known method is based on the introduction of the bac gene of pathogenic GBS into chromosomal DNA in the coding region of pili proteins of the probiotic strain Enterococcus faecium L3, followed by expression of the Bac protein encoded by this gene in pili. Pili enterococci protrude beyond the bacterial cells and are able to penetrate the capsule, which screens most bacterial antigen proteins. Pili are composed of protein monomers capable of aggregation. Due to this process, the dose of a foreign antigen embedded in the pili protein can be increased. The latter should contribute to an increase in the titers of antibodies specific to the polypeptide fragment of the pathogenic GBS strain inserted into the structure of the surface protein of enterococcus.

The known method of introducing the gene of pathogenic streptococci into pili of the probiotic strain Enterococcus faecium L3 is interesting in that the recombinant protein is expressed not in the cytoplasm, but on the surface of the bacterium [4-RF patent No. 2640250 "Method of introducing genes of pathogenic streptococci into the chromosomal DNA of the probiotic strain Enterciumoco3 expression in pilas ", IPC: A61K39 / 092; authors - Suvorov A.N. and etc.].

It is known that the strain Enterococcus faecium L3 has a pronounced antagonistic activity against gram-positive and gram-negative bacteria, the ability to restore intestinal microbiocenosis against the background of dysbiotic conditions [5 - Yermolenko E., Suvorov A., Chernush A., et al. International Congress Series, 1289: 363-366 (2006)], and also have an immunomodulatory effect on the host organism [6 - Tarasova E., Yermolenko E. , Donets V., SundukovaZ. , Bochkareva A. , BorshevI. , Suvorova M. , Ilyasov. I., Simanenkov V., Suvorov A. The influence of probiotic enetrococci on the microbiota and cytokines expression in rats with dysbiosis induced by antibiotics // Beneficial Microbes. -2010- T. 1. -No. 3.- S. 265-270].

Physical mapping of the Enterococcus faecium L3 strain [7 - Suvorov A., Simanenkov V., Gromova L. et al. Prebiotics and probiotics potencial for human health, 104-112, (2011)]. In experiments on healthy female mice, it was shown that intravaginal administration of high doses of the Enterococcus faecium L3 strain not only does not have a toxic effect on the body, but does not affect the state of the vaginal mucosa [8 - A. Suvorov, G. Alekhina, P. Pigarevsky. IN. et al. Gastro-Bulletin, 4: 29-31, (2001)] and promotes the expression of IL-10 by cells of the vaginal mucosa of rats with experimental vaginitis caused by S.agalactiae and Staphylococcus aureus [6 - TarasovaE., YermolenkoE. , Donets V., SundukovaZ. , Bochkareva A. , BorshevI. , Suvorova M. , Ilyasov I., Simanenkov V., Suvorov A. The influence of probiotic enetrococci on the microbiota and cytokines expression in rats with dysbiosis induced by antibiotics // Beneficial Microbes. -2010.- T. 1. -No. 3.- S. 265-270].

In the Enterococcus faecium L3 strain, like other gram-positive bacteria, there are pili, which are fimbriae 0.3-3 μm in length and 2-10 nm in diameter [9 - Telford JL, Barocchi MA, Margarit I, Rappuoli R, Grandi G. Pili in gram-positive pathogens. Nat Rev Microbiol. -2006- T.4, No. 7-C. 509-519. doi: 10.1038 / nrmicro1443. PMID: 16778837]. These long protein-like polymers stretching on the surface of bacteria are subunits of the pilin protein linked by a covalent bond. They play a large role in host colonization adhesion. Pili are highly immunogenic structures that are under the selective pressure of host immune responses [10 - Danne C, Dramsi S. Pili of gram-positive bacteria: roles in host colonization. Res Microbiol. 2012 Nov-Dec; 163 (9-10): 645-58. doi: 10.1016 / j.resmic.2012.10.012. Epub 2012 Oct 29. PMID: 23116627]. The principle of modification of pili enterococci with vaccine antigens is a priority approach when creating effective live vaccines due to exposure of the target antigen on the surface of enterococcus.

A known method of creating a live vaccine by introducing genes of pathogenic streptococci into the chromosomal DNA of a probiotic strain Enterococcus faecium L3 for expression in pili, and a live vaccine based on a modified strain of probiotics Enterococcus faecium L3 for the prevention of infection caused by Streptococcus pneumonie H. [11 - Suvorov A. , Gupalova TV, Kuleshevich EV, Leontyeva GF, Kramskaya TA, RF Patent No. 2701733], which was adopted as a prototype.

The disadvantage of the known method [11] is the complexity of the design of such a vaccine due to the large number of steps required to create a total DNA fragment consisting of two separate fragments of the probiotic Enterococcus faecium L3 gene and the chimeric Streptococcus pneumonie gene - pspf.

This drawback is eliminated in the claimed method for creating a live vaccine by replacing the chimeric Streptococcus pneumoniae - pspf gene with a covid-19 gene fragment by cloning, which reduces the production of a vaccine, in contrast to the prototype, and also allows you to create any other vaccine candidates on this platform. It is essential that the created vaccine candidate, in contrast to the prototype vaccine, is intended to provide specific prevention of diseases caused by the SARS-Cov-2 virus, and not by Streptococcus pneumoniae .

The technical result of the invention is a significant simplification of the method for producing a live vaccine against coronavirus infection.

The specified technical result is achieved by the fact that in the method of creating a live vaccine against coronavirus infection COVID-19 based on the probiotic strain Enterococcus faecium L3 (according to RF patent No. 2220199), modified as a result of electroporation of the culture of enterococci strain Enterococcus faecium L3 recombinant plasmid DNA pentF-co 19, containing the sequence SEQ ID No: 1 in accordance with the claimed invention, to create SEQ ID No: 1 in the plasmid pentF-pspf (according to the patent of the Russian Federation No. 2701733) , the pspf region was replaced with a fragment of the SARS-CoV-2 spike protein gene, the DNA pentF-covid-19 encodes the amino acid sequence SEQ ID No: 2, which performs the function of the spike protein of the SARS-CoV-2 virus, capable of stimulating humoral and cellular immunity against the SARS-CoV-2 virus. In this case, the task of the genetic part is the work consisted in the implementation of the integration of the DNA region of the virus into the structure of the gene of the surface protein of the probiotic without disturbing this reading frame and damage to the coding regions of the components involved in the processing of the PilF surface protein.

In addition, this technical result is achieved by the fact that the live vaccine Enterococcus faecium L3-pentF-covid-19, in which the Enterococcus faecium strain expresses a gene of a fusion protein capable of inducing the formation of antibodies, and the resulting specific antibodies of classes A and G against infection, in In accordance with the claimed invention, a fragment of the gene encoding the spike protein of the SARS-CoV-2 virus is introduced into the plasmid DNA, capable of stimulating humoral and cellular immunity against the SARS-CoV-2 virus, i.e. creating a live vaccine against the SARS-CoV-coronavirus 2, which has a pronounced immunogenic effect.

In the known method, used as a prototype [11], on the basis of the probiotic strain Enterococcus faecium L3, a genetically engineered live vaccine was constructed with an inserted chromosome, in the region encoding the pili gene, a portion of the chimeric pspf gene, constructed on the basis of the pathogenicity genes of Streptococcus pneumonia ... The Enterococcus faecium L3-PSPF + strain was obtained by transformation with the pentF-pspf plasmid of the Enterococcus faecium L3 strain.

Intranasal administration of the Enterococcus faecium L3-PSPF + vaccine stimulated the development of a specific systemic and local immune response. In a model of intranasal lethal pneumococcal infection in CBA mice, it was shown that three-fold intranasal vaccination with the created live probiotic vaccine increased protection against lethal pneumococcal infection.

When implementing the claimed method for creating a live vaccine based on the probiotic strain Enterococcus faecium L3, a synthesized DNA fragment of the coronavirus spike protein was used, which was modeled by the authors of the patent, and then synthesized by the Evrogen company. In this case, in the pentF-pspf plasmid, the pspf gene fragment was replaced with a spike protein gene fragment.

As a result of the implementation of this method, a solution to the final technical problem of the claimed invention is achieved, which consists in creating a live vaccine against the SARS-CoV-2 coronavirus, which has pronounced immunogenic properties, based on a biologically active strain of Enterococcus faecium L3 due to the replacement of the pili gene in the structure of a section of its gene by a site gene of coranovirus SARS-CoV-2. The creation of such a vaccine against an infection caused by a coranovirus is based on the introduction of a DNA fragment encoding an antigenic fragment of the immunogenic epitopes of the SARS-CoV-2 virus into the structure of the probiotic pili gene.

The implementation of this technical problem is illustrated by specific examples of the introduction of the covid - 19 gene of the coronavirus into the chromosomal DNA in the region encoding the pili gene of the probiotic strain Enterococcus faecium L3 for expression in the pili of the immunogenic region of the SARS-CoV-2 spike protein:

a) obtaining the fusion gene entF-covid - 19 and cloning it

b) identification of bacterial clones containing the gene for the fusion protein COVID-19 + in the chromosome

c) oral vaccination of mice with live probiotic vaccine

d) determination of COVID19 + -specific antibodies in blood and vaginal swabs.

e) identification of the cellular link of a specific immune response to oral vaccination with a live antiviral vaccine.

The technical essence of the proposed invention is the creation of a live vaccine against the coronavirus SARS-CoV-2, which has pronounced immunogenic properties.

Oral administration of the Enterococcus faecium L3 vaccine with the SARS-CoV-2 virus gene stimulated the development of a specific systemic and local immune response. In a model of intranasal lethal coronavirus infection in mice, it was shown that three-fold oral vaccination with the created live probiotic vaccine increased protection against lethal coronavirus infection.

The design of a live vaccine based on the biologically active probiotic strain Enterococcus faecium L3 due to the inclusion of the SARS-CoV-2 antigen in its pili made it possible to combine the effectiveness of the beneficial properties of the probiotic and a specific antigenic stimulus in one preparation.

To obtain the fusion gene entF-covid - 19 and its cloning, DNA primers were designed, presented in the table "Oligonucleotide primers", in which 8 names are given in column 1. primers; column 2 shows their orientation in relation to the positive DNA strand .; and column 3 shows the nucleotide sequences that were designed in accordance with the direction of the DNA strand sequence from 5 'to 3'.

Oligonucleotide primers

Table

Name Orientation Nucleotide Sequence 5 'to 3' one 2 3 E1 straight TGATATGGTATCGGATGGGAAА E2 back TCAGTTGAATTTCTCGTCCATC A1 straight GCTCTAGAGCCGATGAGAGCAGCTGGTATTG D1 back CAACAGGATCCAAAGCATCGTTGG K1 straight TTG CATATG GGTTTCCAACCCACT back GTA GAATTC GTTGTTACATGTTCA B1 straight TGAGTGAACCACAGCCAGAA Seq F straight GGACACCACAACCATCGAAG

Nucleotide sequences in column 3 with the names K1 and K2 (in column 1), with areas highlighted by underlining, indicate the corresponding sites for hydrolysis by restriction endonucleases.

A fragment of the covid - 19 gene was synthesized with subsequent cloning into vector plasmid DNA pAL2-T by Evrogen. For the convenience of subsequent cloning, restriction sites for NdEI and EcoRI were inserted into the covid - 19 gene fragment during its synthesis.

Recombinant plasmid DNA pentF-pspf , which is a plasmid DNA obtained by inserting a total DNA fragment consisting of two separate fragments of the probiotic Enterococcus faecium L3 gene and a pspf gene fragment described in the prototype [11-RF patent 2701733], was used for the claimed constructions. From plasmid DNA pentF-pspf pneumococcal insert has been removed and replaced by a gene pspf covid to insert genes - 19. For this, plasmid DNA pentF-psp was digested with NdEI and EcoRI enzymes, the sites for which limit the pspf gene sequence (Fig. 1). The same restriction sites were incorporated into the synthesized fragment of the covid - 19 gene. The resulting upper fragment after hydrolysis was used for further cloning.

Plasmid DNA pAL2-T containing a fragment of the covid - 19 gene was digested with NdEI and EcoRI. Cloning of the restricted fragment encoding COVID-19 was carried out using the upper fragment after hydrolysis of the pentF-pspf plasmid. Restriction products were separated by electrophoresis in 1% agarose gel. Restricted DNA was isolated from agarose using a QIAquick Gel Extraction Kit (Qiagen, USA), which were then ligated and transformed into a heterologous E. coli DH5α system. The selection medium contained 500 μg / ml erythromycin. As a result of the transformation, one clone was obtained. Plasmid DNA was isolated from this clone. The presence of the insert was confirmed by hydrolysis of the plasmid with the enzymes NdEI and EcoRI (Fig. 2).

PCR products of plasmid DNA obtained with primers K1 and K2, and SeqF and K2 were sequenced. The sequencing results showed the correctness of the plasmid DNA sequence, which contained the desired Enterococcus DNA and coronavirus DNA fragments (SEQ ID NO: 1).

As a result of cloning, the p ent F- covid - 19 plasmid was obtained with the predicted insert and the erythromycin resistance gene.

As a result of electroporation of enterococci with the created integrative plasmid, 14 transformants were obtained. They were tested in a PCR reaction with primers K1 and K2. For this, DNA was isolated from transformants using a DNA express kit (Litekh, Russia). 13 transformers gave a positive answer, all but 12. (Fig. 3, top row)

To determine the integration of plasmid DNA pentF-covid - 19 into the chromosomal DNA of enterococcus, DNA amplification was carried out, isolated from 13 clones with primers B1 and K2. Integration of plasmid DNA pentF-covid - 19 into chromosomal DNA of enterococcus was found in only two transformants (Fig. 3, lanes 22 and 23, lower row). Sequencing of DNA isolated from one of the positive clones, designated as COVID 19 +, was carried out with primers corresponding to the sequence of the covid - 19 gene ( primer K2) and the chromosomal DNA sequence of enterococci (primer B1) to confirm the integration of plasmid DNA pentF-covid - 19 into the chromosomal DNA of Enterococcus (SEQ ID NO: 1).

Figure 4 shows the result after PCR with DNA from the COVID 19+ clone with different primer pairs. FIG. 4 shows the results of PCR with chromosomal DNA of enterococcus and plasmid DNA pentF-covid - 19.

A COVID 19+ clone expressing the COVID-19 protein gene was selected as a vaccine for further research.

Below are specific examples confirming the experimental implementation of the stages of obtaining a live vaccine against coronavirus infection.

Example 1.

Synthesis of a DNA fragment of a coronavirus and its cloning into the pAL2-T plasmid vector

The synthesis of the DNA fragment of the coronavirus and its cloning into the plasmid vector pAL2-T was carried out by Evrogen. For the convenience of subsequent cloning, restriction sites for NdEI and EcoRI were inserted into the covid - 19 gene fragment during its synthesis.

Example 2.

Obtaining a fusion gene entF-covid - nineteen and cloning it.

Recombinant plasmid DNA pentF-pspf , which is a plasmid DNA obtained by inserting a total DNA fragment consisting of two separate fragments of the probiotic Enterococcus faecium L3 gene and a pspf gene fragment described in the prototype [11-RF patent 2701733], was used to create fusion gene entF-covid - 19 . For this, an insert of the pspf gene of pneumococcus was cut from the plasmid DNA pentF-psp f , and the plasmid DNA pentF-pspf was hydrolyzed with the enzymes NdEI and EcoRI (Fig. 1). The resulting upper fragment after hydrolysis was used for further cloning.

FIG. 1 shows an electrophoretogram of the pentF-pspf plasmid DNA restricted by the enzymes NdEI and EcoRI., Where:

1 - plasmid pentF-pspf - initial

2 - plasmid pentF -pspf restricted

3 - 100 bp DNA - marker (from top to bottom: 3000, 2000, 1000, 900, 800, 700, 600, 500, 400, 300, 200 and 100 nucleotide pairs).

Plasmid DNA pAL2-T containing the covid - 19 gene fragment was digested with NdEI and EcoRI (Figure 2). Cloning of the restricted fragment of the gene encoding COVID-19 was carried out using the upper fragment after hydrolysis of the pentF-pspf plasmid. The products of restriction endonuclease hydrolysis were separated by electrophoresis in 1% agarose gel. DNA hydrolysates were isolated from agarose using the QIAquick Gel Extraction Kit (Qiagen, USA), ligated and transformed into the heterologous E. coli DH5α system. The medium for the selection of clones of E. coli with the plasmid contained 500 μg / ml of erythromycin. As a result of the transformation, one clone was obtained. Plasmid DNA was isolated from this clone. The presence of the insert was confirmed by hydrolysis of the plasmid with the enzymes NdEI and EcoRI (Fig. 2).

FIG. 2 shows an electropherogram of the restricted pasmids NdEI and EcoRI, where:

1 - pAL2-T plasmid DNA containing a fragment of the covid gene - 19

2 - plasmid DNA p ent F -covid - 19

3 - 100 bp DNA - marker (from top to bottom: 3000, 2000, 1000, 900, 800, 700, 600, 500, 400, 300, 200 and 100 nucleotide pairs).

Example 3.

Transformation of enterococci by electroporation.

For electroporation of enterococci, the culture of Enterococcus faecium L3 was seeded in 3 ml of Tood-Hewitt broth (THB) (HiMedia, India) and grown overnight at 37 ° C, then subcultured in 50 ml of THB broth with 1 ml of overnight culture and grown to optical density at a wavelength of 650 nm 0.3. After that, the culture was placed on ice and then washed three times in 20 ml of 10% glycerol at a temperature of 4 ° C, the resulting precipitate was suspended in 0.5 ml of sterile glycerol solution, reprecipitated and the final precipitate was resuspended in 0.3 ml of the same solution, poured 50 μL into test tubes and electroporation was performed in a cuvette with a distance between the electrodes of 1 mm at a voltage of 2100 V. DNA was added to the cells on ice (the resulting integrative plasmid p entF-covid - 19 plasmid, 300 ng). The optimal pulse duration was 4-5 milliseconds. After conducting a current discharge, 1 ml of THB was added to the cuvette, incubated for 1 hour and plated on plates with a selective medium containing 10 μg / ml of erythromycin. The transformants were then expected to appear after 24 hours.

As a result of electroporation of enterococci created by an integrative plasmid, 14 transformant clones were obtained. They were tested in a PCR reaction with primers K1 and K2. For this, DNA was isolated from transformants using a DNA express kit (Litekh, Russia). A positive response was given by 13 transformants (Fig. 3, top row).

FIG. 3, the top row shows an electrophoretogram of amplified DNA fragments with primers K1 and K2.

1 - 14 - PCR products of DNA from the obtained 14 clones.

15 - 100 bp DNA - marker (from top to bottom: 3000, 2000, 1000, 900, 800, 700, 600, 500, 400, 300, 200 and 100 nucleotide pairs).

16 - PCR product of plasmid DNA p ent F -covid - 19

17 - PCR product without added DNA.

Amplification of DNA isolated from 13 clones was carried out to determine the integration of plasmid DNA pentF-covid - 19 into chromosomal DNA of enterococcus with primers B1 and K2. Integration of plasmid DNA pentF-covid - 19 into chromosomal DNA of enterococcus was found in only two transformants (Fig. 3, lower row).

On the. FIG. 3, the bottom row shows an electrophoretogram of amplified DNA fragments with primers B1 and K2.

18 - 31 - PCR products of DNA from the obtained 14 clones.

32 - 100 bp DNA - marker (from top to bottom: 3000, 2000, 1000, 900, 800, 700, 600, 500, 400, 300, 200 and 100 nucleotide pairs).

33 - PCR product without added DNA.

Sequencing of DNA isolated from one of the positiveoops cloneov, designated as COVID 19 +, was carried out with DNA primers corresponding to the gene sequencecovid-nineteen (primer K2) and chromosomal DNA sequences of enterococci (primer B1) to confirm the integration of plasmid DNApentF- covid-nineteen into the chromosomal DNA of enterococcus (SEQ ID No: 1).

FIG. 4 shows the result obtained after PCR using DNA from the COVID 19+ clone with different primer pairs. FIG. 4 shows the results of PCR with chromosomal DNA of enterococcus and plasmid DNA pentF-covid - 19.

FIG. 4 shows an electrophoretogram of amplified DNA fragments with different pairs of primers, where:

1 - DNA clone COVID 19+ with primers K1 and K2

2 - DNA clone COVID 19+ with primers A1 and D2

3 - DNA clone COVID 19+ with primers B1 and K2

4 - DNA clone COVID 19+ with primers K1 and E2

5 - DNA clone COVID 19+ with primers E1 and K2

6 - DNA clone COVID 19+ with primers E1 and E2

7 - DNA clone COVID 19+ with seq F and K2 primers

8 - DNA clone COVID 19+ with primers B1 and E2

9 - DNA L3 with primers B1 and E2

10 - DNA L3 with primers E1 and E2

11 - DNA pentF-covid - 19 with primers K1 and K2

12 - DNA pentF-covid - 19 with primers seqF and K2

13 - DNA pentF-covid - 19 with primers E1 and E2

14 - 100 bp DNA - marker (from top to bottom: 3000, 2000, 1000, 900, 800, 700, 600, 500, 400, 300, 200 and 100 nucleotide pairs).

A COVID 19+ clone expressing the COVID-19 protein gene has been selected as a vaccine for further research.

Example 4.

Oral vaccination of mice with a live probiotic vaccine.

Balb / c mice (n = 10), females aged 9-10 weeks using an adapter were orally administered E. faecium L3 (n = 10) and COVID 19+ (n = 10). The vaccination course consisted of three immunization cycles with an interval of two weeks. Each cycle included three daily administration of 0.5 ml of bacteria suspension at a dose of 109 CFU / mouse. For vaccination, the original and modified variants of E. faecium were cultured in BL medium for 18 hours at 37 ° C under aerobic conditions. E.faecium modified with a portion of the coronavirus gene was cultured in the presence of erythromycin at a concentration of 5 μg / ml. The cell suspension was washed twice in PBS and injected into mice.

Example 5.

Determination of COVID-19 + - specific antibodies in the blood of mice and analysis of specific cytotoxic lymphocytes (CTL).

Two weeks after the end of the second stage of immunization, that is, six weeks after the start of immunization, blood was taken from mice to assess the level of a specific humoral immune response and spleens were obtained for analysis of specific CTLs.

The level of specific IgG and IgA was determined by the conventional ELISA method. Recombinant protein S (analog of the viral insert in Enterococcus) was sorbed to the bottom of a 96-well plate at a concentration of 0.5 μg / ml overnight at 4 ° C. Serial 4-fold dilutions of serum were added to the wells in a volume of 100 μl and incubated for 1 hour at 37 ° C. Excess antibodies were washed with PBS with 0.5% Tween 20. Specific antibodies were detected using secondary antibodies conjugated with horseradish peroxidase. To identify class A antibodies, goat anti mouse – IgA – HRP conjugate (Sigma) was used, and class G antibodies – goat anti mouse – IgG – HRP conjugate (Sigma). The conjugate solution was added in a volume of 100 μl and incubated for 1 hour at 37 ° C. The plates were washed four times in PBS with 0.5% Tween 20, the bound conjugate was detected in a color reaction with TMB, the color intensity was evaluated at a wavelength of 450 nm.

The analysis of sera showed that the blood of the vaccinated animals contained antibodies of class G, specific for the viral protein S, similar to the insert in enterococcus. Antibody titers ranged from 1: 400 to 1: 25600.

FIG. 5 shows the content of class G immunoglobulins in the serum of mice 6 weeks after the start of vaccination.

A - average titration curves

Graph 1 - shows the titration curve of serum obtained from mice treated with COVID 19+

Graph 2 shows the titration curve of serum obtained from mice treated with E. faecium L3 strain.

B - average titers of specific IgG

Column 1 - titer of specific IgG from the serum of mice treated with COVID 19+

Column 2 - titer of specific IgG from the serum of mice treated with E.faecium L3

* - differences between groups are significant p≤0.05

Determination of the level of specific antibodies of class A made it possible to establish that vaccination leads to the appearance of specific IgA in the blood serum of mice in high titers, the values range from 1: 10000-1: 500000, which significantly exceeds the indicators for specific IgG.

FIG. 6 shows the content of class A immunoglobulins in the serum of mice 6 weeks after the start of vaccination, where column 1 shows the average titers of specific IgA from the serum of mice treated with COVID 19+;in column 2 is the average titer of specific IgA from the serum of mice treated withE.faecium L3

* - the differences between the groups are significant p≤0.05.

The analysis of the cellular component of the specific immune response to oral vaccination with a live antiviral vaccine was carried out by assessing the intensity of the induction of interferon gamma after the contact of a suspension of spleen cells with the S protein SARS-Cov-2.

Single cell suspensions of the spleen of immunized mice were prepared by rubbing the spleens through a BD Falcon sieve (BD Biosciences, Bedford, USA). The cells were washed with RPMI-1640 medium (2000 rpm, 5 min) and resuspended in complete RPMI-1640 medium containing 10% fetal calf serum. The counting of the number of cells and their viability was performed using the method with 0.4% trypan blue. A pool of cells from three mice were plated into 24-well plates at a seeding dose of 105 cells / ml in triplicate. Thereafter, the cells were stimulated with the recombinant peptide COVID 19+ at a dose of 1-0.5-0.1 μg / ml. After 6 days of cultivation at 37 ° C in an atmosphere of CO _2, supernatants were collected and the content of interferon (IFN) -gamma was determined using an ELISA kit (Invitrogen, Waltham, Massachusetts, USA) according to the manufacturer's instructions.

FIG. 7 shows the concentration of extracellular IFN-γ in the cell culture supernatant.

A - stimulation with the recombinant peptide COVID 19+ at a dose of 1 μg / ml.

Column 1 - concentration of extracellular IFN-γ in the cell culture supernatant of mice treated with COVID 19+

Column 2 - concentration of extracellular IFN-γ in the cell culture supernatant of mice treated with L3

Column 3 - concentration of extracellular IFN-γ in the cell culture supernatant of intact mice

B - stimulation with the recombinant peptide COVID 19+ at a dose of 0.1 μg / ml

Column 1 - concentration of extracellular IFN-γ in the cell culture supernatant of mice treated with COVID 19+

Column 2 - concentration of extracellular IFN-γ in the cell culture supernatant of mice treated with L3

Column 3 - concentration of extracellular IFN-γ in the cell culture supernatant of intact mice

B - the concentration of extracellular IFN-γ in the cell culture supernatant in the absence of stimulation with the recombinant peptide COVID 19+

Column 1 - concentration of extracellular IFN-γ in the cell culture supernatant of mice treated with COVID 19+

Column 2 - concentration of extracellular IFN-γ in the cell culture supernatant of mice treated with L3

Column 3 - concentration of extracellular IFN-γ in the cell culture supernatant of intact mice.

The data obtained indicate that on the 6th day after the introduction of a specific antigen into the suspension of splenocytes of mice vaccinated with a live probiotic vaccine, interferon gamma accumulates in the medium in an amount that reliably exceeds that for the control samples. The latter indicates that the course of oral vaccination with a live probiotic vaccine stimulates cytotoxic Th1 lymphocytes, which coordinate specific cellular responses, in particular, the activity specific to the S protein of the virus.

As shown by the experimental results, the claimed invention makes it possible to create an effective live vaccine with a preventive effect against COVID-19 infection.

List of used sources of information

1. Guo YR, Cao QD, Hong ZS, Tan YY, Chen SD, Jin HJ, Tan KS, Wang DY, Yan Y. The origin, transmission and clinical therapies on coronavirus disease 2019 (COVID-19) outbreak - an update on the status. Mil Med Res. 2020 Mar 13; 7 (1): 11. doi: 10.1186 / s40779-020-00240-0. PMID: 32169119; PMCID: PMC7068984.

2. RF patent No. 2220199 "Strain of enterococci enterococcus faeciuml-3 for the manufacture of therapeutic and prophylactic agents and food products for therapeutic and prophylactic purposes"; IPC: A23C 9/12, A61K 35/74 (patent holders and authors: Alekhina G.G. and Suvorov A.N.).

3. Gupalova T.V. and others. "Development and experience of using a live vaccine based on the probiotic strain Enterococcus faecium L3 for the prevention of vaginal infection caused by Streptococcus agalactiae." Medical Academic Journal, 2013.

4. RF patent No. 2640250 "Method of introducing genes of pathogenic streptococci into the chromosomal DNA of the probiotic strain Enterococcus faecium l3 for expression in pili", IPC: A61K39 / 092; (authors Suvorov A.N. and others).

5. Yermolenko E., Suvorov A., Chernush A., et al. International Congress Series, 1289: 363-366; 2006.

6. Tarasova E., Yermolenko E., Donets V. et al. Beneficial Microbs 1: 265-270, (2010).

7. Suvorov A., Simanenkov V., Gromova L. et al. Prebiotics and probiotics potencial for human health, 104-112, (2011).

8. Suvorov A., Alekhina G.G., Pigarevsky P.V. et al. Gastro-Bulletin, 4: 29-31, (2001).

9. Telford JL, Barocchi MA, Margarit I et al. Nature Reviews Microbiology 4: 509-519, (2006).

10. Camille Danne, Shaynoor Dramsi. Research in Microbiology 163: 645-658, (2012).

11. RF patent No. 2701733 (Authors - Suvorov A.N., Gupalova T.V., Kuleshevich E.V., Leontyeva G.F., Kramskaya T.A.) - prototype.

--->

LIST OF SEQUENCES

<110>

<120> Method for making live vaccine against COVID-19 coronavirus infection

based on probiotic strain Enterococcus faecium L3 and live vaccine

Enterococcus faecium L3 -pentF-covid-19

<140>

<141>

<150>

<151>

<160> 1

<170>

<210> 1

<211> 1599

<212> Nucleotide sequence

<213> Artificial sequence

<220>

<223> Nucleotide sequence of the covid- 19 gene of the coronavirus COVID-19,

expressed in the Escherichia coli system

<400> 1

Atgagagcagctggtattgagttgaatgatacatttctatctatttacagtttaaatgga 60

cagtatcagcaacgtgtgtcttggtataatgacaataatgaatctgtcggtgaacgtaat 120

attgatatgagagaatttgttgggtatgaaaaaatgggtagcttaccttattttgtcaca 180

acagatacagcatgtgcagaatacaaagctcctgcgttatcaacaaacaatttaacttca 240

aaagtagtgggaggacgtgcagaaaaggcttatagctcgaatgatcatttcaccgatgtt 300

gtaggagctgatacttatcacagaagtggtgtaacgtatacgcttcaaggcgcttcccca 360

acattcatgattggcgcaaatacgaatagtatgatgtttagctttgatactgcattgcta 420

tggacaccacaaccatcgaagcctacaaaagaagtgtttaacaaagctaatactgaagag 480

gcagcacacaatattgacaaaaaagtgattccacaaggatcagatgtttactatcatatt 540

catcaaaagtttgatgcattaacagtcaacacaatgaacaaatacaaatcatttaaaatc 600

actgatacctttgacagcaaaaattttgatatggtatcggatgggaaaaactatgatggc 660

gcattgcatatgggtttccaacccactaatggtgttggttaccaaccatacagagtagta 720

gtactttcttttgaacttctacatgcaccagcaactgtttgtggacctaaaaagtctact 780

aatttggttaaaaacaaatgtgtcaatttcaacttcaatggtttaacaggcacaggtgtt 840

cttactgagtctaacaaaaagtttctgcctttccaacaatttggcagagacattgctgac 900

actactgatgctgtccgtgatccacagacacttgagattcttgacattacaccatgttct 960

tttggtggtgtcagtgttataacaccaggaacaaatacttctaaccaggttgctgttctt 1020

tatcaggatgttaactgcacagaagtccctgttgctattcatgcagatcaacttactcct 1080

acttggcgtgtttattctacaggttctaatgtttttcaaacacgtgcaggctgtttaata 1140

ggggctgaacatgtcaacaacgaattctacgaaaaaaacctgaaagaatacaccgacaag 1200

ctggataaactcgagaaaggttctgcgcgagtgatagatatgagtacaggaaaagatatt 1260

acttcagaaggtacactaacctatgatagcaatttaagaacgctgaaatgggaagcttcc 1320

gctgatttcttaagtaaaaatcttttagatggacgagaaattcaactgatatttacagct 1380

aaaactccactacagtcagaaaaaaatattgataaccaagccgtagcagcagtagagaat 1440

gtttctaataaaacgaatgttgtaacaattggtgttgatcctaacttaccacaagtcatt 1500

gttcctagaacaggttctacacatttagtaacaattttagtggttagcttagtattactt 1560

gtgttagctactcttagttatgtggctctgaagttcaat 1599

<210> 2

<211> 533

<212> Amino acid sequence

<213> Artificial sequence

<220>

<223> Amino Acid Sequence

<400> 2

MetArgAlaAlaGlyIleGluLeuAsnAspThrPheLeuSerIleTyr

5 10 15

SerLeuAsnGlyGlnTyrGlnGlnArgValSerTrpTyrAsnAspAsn

20 25 30

AsnGluSerValGlyGluArgAsnIleAspMetArgGluPheValGly

35 40 45

TyrGluLysMetGlySerLeuProTyrPheValThrThrAspThrAla

50 55 60

CysAlaGluTyrLysAlaProAlaLeuSerThrAsnAsnLeuThrSer

65 70 75 80

LysValValGlyGlyArgAlaGluLysAlaTyrSerSerAsnAspHis

85 90 95

PheThrAspValValGlyAlaAspThrTyrHisArgSerGlyValThr

100 105 110

TyrThrLeuGlnGlyAlaSerProThrPheMetIleGlyAlaAsnThr

115 120 125

AsnSerMetMetPheSerPheAspThrAlaLeuLeuTrpThrProGln

130 135 140

ProSerLysProThrLysGluValPheAsnLysAlaAsnThrGluGlu

145 150 155 160

AlaAlaHisAsnIleAspLysLysValIleProGlnGlySerAspVal

165 170 175

TyrTyrHisIleHisGlnLysPheAspAlaLeuThrValAsnThrMet

180 185 190

AsnLysTyrLysSerPheLysIleThrAspThrPheAspSerLysAsn

195 200 205

PheAspMetValSerAspGlyLysAsnTyrAspGlyAlaLeuHisMet

210 215 220

GlyPheGlnProThrAsnGlyValGlyTyrGlnProTyrArgValVal

225 230 235 240

ValLeuSerPheGluLeuLeuHisAlaProAlaThrValCysGlyPro

245 250 255

LysLysSerThrAsnLeuValLysAsnLysCysValAsnPheAsnPhe

260 265 270

AsnGlyLeuThrGlyThrGlyValLeuThrGluSerAsnLysLysPhe

275 280 285

LeuProPheGlnGlnPheGlyArgAspIleAlaAspThrThrAspAla

290 295 300

ValArgAspProGlnThrLeuGluIleLeuAspIleThrProCysSer

305 310 315 320

PheGlyGlyValSerValIleThrProGlyThrAsnThrSerAsnGln

325 330 335

ValAlaValLeuTyrGlnAspValAsnCysThrGluValProValAla

340 345 350

IleHisAlaAspGlnLeuThrProThrTrpArgValTyrSerThrGly

355 360 365

SerAsnValPheGlnThrArgAlaGlyCysLeuIleGlyAlaGluHis

370 375 380

ValAsnAsnGluPheTyrGluLysAsnLeuLysGluTyrThrAspLys

385 390 395 400

LeuAspLysLeuGluLysGlySerAlaArgValIleAspMetSerThr

405 410 415

GlyLysAspIleThrSerGluGlyThrLeuThrTyrAspSerAsnLeu

420 425 430

ArgThrLeuLysTrpGluAlaSerAlaAspPheLeuSerLysAsnLeu

435 440 445

LeuAspGlyArgGluIleGlnLeuIlePheThrAlaLysThrProLeu

450 455 460

GlnSerGluLysAsnIleAspAsnGlnAlaValAlaAlaValGluAsn

465 470 475 480

ValSerAsnLysThrAsnValValThrIleGlyValAspProAsnLeu

485 490 495

ProGlnValIleValProArgThrGlySerThrHisLeuValThrIle

500 505 510

LeuValValSerLeuValLeuLeuValLeuAlaThrLeuSerTyrVal

515 520 525

AlaLeuLysPheAsn

530533

<---

Claims (2)

1. A method of creating a live vaccine against coronavirus infection COVID-19 based on the probiotic strain Enterococcus faecium L3 modified as a result of electroporation of the culture of enterococci Enterococcus faecium L3 recombinant plasmid DNA pentF-covid-19, SEQ ID No: 1, characterized in that in the plasmid The pentF-pspf region of pspf is replaced with a fragment of the gene for the SARS-CoV-2 spike protein, while the pentF-covid-19 DNA encodes the amino acid sequence SEQ ID No: 2, which acts as a spike protein of the SARS-CoV-2 virus capable of stimulating humoral and cellular immunity against the SARS-CoV-2 virus. 2. Live vaccine Enterococcus faecium L3-pentF-covid-19, obtained by the method according to claim 1 and containing a clone of enterococci COVID 19+ with a DNA region SEQ ID No: 1 introduced into its genome, providing expression of a protein having the amino acid sequence SEQ ID No : 2, is able to stimulate humoral and cellular immunity against the SARS-CoV-2 virus.

Images