CN102382843A

CN102382843A - Sword-leaved cymbidium flowering integrator gene (CeFT gene) and application thereof

Info

Publication number: CN102382843A
Application number: CN2011103620074A
Authority: CN
Inventors: 张建霞; 曾宋君; 黄玮婷; 段俊; 吴坤林
Original assignee: South China Botanical Garden of CAS
Current assignee: South China Botanical Garden of CAS
Priority date: 2011-11-15
Filing date: 2011-11-15
Publication date: 2012-03-21
Anticipated expiration: 2031-11-15
Also published as: CN102382843B

Abstract

The invention discloses a sword-leaved cymbidium flowering integrator gene CeFT and application thereof. The sequence of the CeFT gene is shown in SEQ ID NO.1 from the 87th basic group to the 617th basic group, and the amino acid sequence of a protein coded by the gene is shown in SEQ ID NO.2. The invention clones the FT homologous gene (CeFT gene) from a sword-leaved cymbidium for the first time; and experiment proves that the gene can influence the growth and development process of plants, shorten the juvenile phase and urge the plants to flower ahead of time. Thus, the sword-leaved cymbidium CeFT gene disclosed by the invention provides an effective technical means for the improvement on the growth process of the plants and the control on the flowering season of the plants in gene engineering, thereby having broad application prospects and great economic values.

Description

Sword-leaved cymbidium integrator gene-CeFT gene and the application thereof of blooming

Technical field:

The invention belongs to molecular biology, gene engineering technology field; The recombinant plant expression vector that be specifically related to a kind of integrator gene of blooming-CeFT gene of in sword-leaved cymbidium, expressing, contains this gene; And the CeFT gene is shortening the virgin phase of plant, the application during the promotion plant blooms in advance

Background technology:

FT (FLOWERING LOCUS T) gene is the key gene in the florescence control approach.It is arranged in the Rendezvous Point of flower development approach, integrates the signal from different flower development approach such as photoperiod approach, vernalization approach and autonomous approach, in plant flowers is grown, is bringing into play important effect.

The FT gene of Arabidopis thaliana belongs to the FT/TFL1 gene family, and (phosphatidyletha nolamine-binding protein, PEBP) gene family is because of its albumen is prone to combine to gain the name with phosphatidylethanolamine to be called phosphotidylethanolabinding binding protein again.According to PEBP gene family member in Arabidopis thaliana and paddy rice phylogenetic relationship and to the regulating and controlling effect of flowering time; It is divided into 3 subfamilies: (1) FT subfamily (FT-like); Comprise FT gene, TSF gene, play and promote the effect of blooming that TSF and FT funtion part are redundant; (2) MFT subfamily (MFT-like) comprises the MFT gene, in flowering time regulation and control with the FT functional redundancy; (3) TFL1 subfamily (TFL1-like) has comprised TFL1, BFT and ATC gene, works the restraining effect (Chardon and Damerv al, 2005) of blooming.In plant PEBP gene family, FT and TFL1 gene are to study the most clearly two members.FT is the supressor of blooming for the promotion factor of blooming, TFL1, and they play a crucial role in the process of decision flowering time.There is some difference for the crystalline structure of FT albumen and TFL1, and this species diversity causes playing reverse functions in their one-tenth flower processes.Hanzawa etc. (2005) research shows amino acid of replacement, and promptly Tyr85 among the FT and the His88 among the TFL1 just can make FT and TFL1 exchange function.These two genes form flower primordium through suppressing stem end meristematic tissue, prolong the process of nourishing and growing of plant, thereby postpone the reproductive growth process of plant.

FT albumen is the chief component of flowering hormone; In the different genetic approach of blooming; Upper reaches key gene regulation and control FT gene; Make FT albumen move to stem apical meristem (SAM) from phloem; (basic region-leucine zipper, b-ZIP) transcription factor FD (FLOWERING LOCUS D) promotes to become flower to change at stem apex through protein interactions, and starts the flower development process through transcriptional activation floral meristem characteristic gene AP1 (APETALA1) with being with alkaline leucine zipper protein.

The FT homologous gene of the following plant of overexpression in Arabidopis thaliana all can significantly promote to bloom: Arabidopis thaliana (Abe et al., 2005), willow (Hsu et al.; 2006), tomato (Lifschitz et al., 2006), petunia (Hayama et al.; 2007), grape (Carmona et al., 2007); Pumpkin (Lin et al., 2007) and paddy rice (Kojima et al., 2002) etc.And in tomato (Lifschitz et al., 2006), willow (Bohlenius et al., 2006; Hsu et al., 2006), wheat (Yan et al., 2006), heterogenous expression FT or FT homologous gene equally also can cause the early blossoming phenomenon in the petunia plants such as (Hayama et al., 2007).Especially in the xylophyta willow, wild-type need be passed through 8-20 and just can be bloomed, and the comospore poplar of overexpression PtFT1 just can be observed catkin (Bohlenius et al., 2006) after in petridish, cultivating all around.Otherwise in Arabidopis thaliana and paddy rice, after employing RNAi or miRNA means made the downward modulation of FT expression of gene, the flowering time of plant postponed (Kojima et al., 2002; Komiya et al., 2008).These results show that FT and homologous gene thereof are that flowering of plant is necessary.

FT not only plays an important role in becoming the flower transition process, but also participates in regulating some processes of growing.As regulate and control the growth course of Arabidopis thaliana fruit pod and seed, FT mRNA in cotyledon expression amount than higher, and very low at the apical meristem expression amount.In addition; In willow; FT homologous gene PtFT1 expression level still is a key determinative of cessation of growth cessation in autumn and bud dormancy, thereby autumn, short day was induced the forest tree population cessation of growth cessation of different latitude and the startup of bud dormancy through the activity of regulation and control PtFT1.

Sword-leaved cymbidium (Cymbidium ensifolium) is the Xiao Hua type ground non-hibernating eggs in the orchid family (Orchidaceae) Cymbidium (Cymbidium), and its fragrance of a flower is strong fragrant, and color and luster is simple and elegant; The flower appearance is beautiful, and the leaf attitude is elegant, enjoys great popularity; For one of China's tradition inscription flower, has good marketable value.The young stage of sword-leaved cymbidium is longer, and about about 3 years, production cost was high, and therefore how florescence control shortens virgin phase of sword-leaved cymbidium, makes its early flowering that very important significance for theories and economic implications arranged.China mainly concentrates on the Spring Festival and other important Holiday to the traditional consumption phase of flowers in addition, realize that the industrialization of sword-leaved cymbidium is also wanted to save listing, and its commodity value just can be higher.The florescence of sword-leaved cymbidium can repeatedly be bloomed, but in important festivals such as the Spring Festival, New Year's Day, can not bloom usually in the 6-10 month in 1 year, and in addition, the florescence of sword-leaved cymbidium generally has only 1 month, also needed on florescence and prolongation flowering time, to regulate and control as annual flower grass.

At present, the research aspect the blue florescence control of sword-leaved cymbidium and relevant state is fewer, and Pan Ruichi and the Ye discovery low temperature of celebrating one's birthday can promote bud differentiation and the growth of Chinese cymbidium and Chunlan, and high temperature (30/25 ℃ and 25/20 ℃) helps sword-leaved cymbidium bud differentiation and growth.But spending mechanism and genes involved clone and functional study about the one-tenth of sword-leaved cymbidium does not also appear in the newspapers.

Summary of the invention:

First purpose of the present invention provides a kind of integrator gene of blooming-CeFT gene of in sword-leaved cymbidium, expressing and proteins encoded and the recombinant plant expression vector that contains this gene.

Second purpose of the present invention provides the CeFT gene and shortening the virgin phase of plant, and the application during the promotion plant blooms in advance as shortening the virgin phase of Arabidopis thaliana, promotes it to bloom in advance.

The present invention is a material with the bud of sword-leaved cymbidium " spun gold horse hair " (C.ensifolium ' Jin Si Ma Wei '), extracts its total RNA, again the mRNA rt is become cDNA first chain; With this cDNA first chain template,, utilize the method amplification splicing of RT-PCR and RACE to obtain full length cDNA sequence according to the homologous gene design primer of FT; This cDNA sequence length is 773bp; Its sequence is shown in SEQ ID NO.1, and its ORFs is to hold the 87th to the 617th bit base, common 531bp from 5 '; With this ORFs called after CeFT gene; The aminoacid sequence of its encoded protein has 176 amino-acid residues, and its sequence is shown in SEQ ID NO.2, with this albumen called after CeFT albumen.

The protein sequence of the CeFT genes encoding of sword-leaved cymbidium is analyzed its homology with ClustalW2; The result shows two conservative motifs that CeFT albumen has a FT proteinoid i.e. 14 conserved amino acid sequences (LGRQTVYAPGWRQN) and LYN/IYN triplet; Also contain a conservative PEBP structural domain the from the 25th to 163 amino acid, the homology of it and oncidiumLuridum OnFT is 94%; Be respectively 79%, 74% with the amino acid sequence homology of paddy rice Hd3a, Arabidopis thaliana FT, this shows, the CeFT gene is a new integrator gene FT gene of blooming.

The inventor is connected above-mentioned CeFT gene with plant expression vector, through agriculture bacillus mediated, the recombinant plant expression vector that will contain the CeFT gene is transformed in the Arabidopis thaliana, obtains to contain the transgenic arabidopsis of CeFT gene through screening and culturing.Find that through experiment this transgenic arabidopsis is compared with the wild-type Arabidopis thaliana, the transgenic arabidopsis advance flowering period, the average flowering time of 10 transformants is 22 days, and the average flowering time of wild-type is 31 days.Show that thus external source CeFT gene is the structure gene with function, it has realized overexpression in host's Arabidopis thaliana, and it has shortened the flowering time of transgenic arabidopsis.

Can show that from the The above results analysis CeFT gene of the present invention is a new integrator gene of blooming, this gene can shorten flowering time, thereby influences the growth of plant.

Therefore can CeFT gene of the present invention be applied to and shorten the virgin phase of plant, promote in the flowering of plant.CeFT gene of the present invention is connected with plant expression vector, through agriculture bacillus mediated entering vegetable cell, tissue or organ, becomes genetically modified vegetable transformant through tissue culture, thereby realizes shortening plant child vegetative period phase, promotes flowering of plant.Described plant expression vector can be any one and can be used for the carrier etc. that agrobacterium tumefaciens or Agrobacterium rhizogenes transform the binary vector of plant or can be used for the plant micropellet bombardment, like pBI serial carrier, pBin serial carrier, Gateway ^TWSerial carrier, pCAMBIA serial carrier or other plant expression vector etc. of deriving, above-mentioned carrier is the commodity of public offering.

FT homologous gene-CeFT gene is cloned in the present invention first from sword-leaved cymbidium, and can influence the growth and development of plants process through this gene of experiment proof, has shortened the virgin phase, and has impelled plant to bloom in advance.Therefore, sword-leaved cymbidium CeFT gene provided by the invention is the growth course of genetically engineered improvement plant, regulates and control to provide a kind of effective technical means to the florescence of plant, is with a wide range of applications and economic worth greatly.

Description of drawings:

Fig. 1 is sword-leaved cymbidium CeFT gene deduced amino acid and oncidiumLuridum OnFT (EU583502), paddy rice Hd3a (BAB61028.1), Arabidopis thaliana AtFT homogenic aminoacid sequence comparison diagrams (amino acid with consistence and similarity is represented with black and gray shade respectively) such as (BAA77838.1);

Fig. 2 is the electrophoresis showed figure that detects the CeFT gene expression amount in root, stem, leaf and the axillalry bud of the adult sword-leaved cymbidium plant that does not grow bennet through RT-PCR, and wherein 1 is root; 2 is pseudobulb; 3 is leaf; 4 is axillalry bud;

Fig. 3 is the electrophoresis showed figure that detects the CeFT gene expression amount in root, stem, leaf, axillalry bud, bennet and the bud that bennet length reaches the adult plant of 10cm through RT-PCR, and wherein 1 is root; 2 is pseudobulb; 3 is leaf; 4 is axillalry bud; 5 is bennet; 6 is bud;

Fig. 4 is the PCR evaluation figure that expression vector pBI121-35s-CeFT transforms Agrobacterium, and wherein M is Marker 2000,1-3 be the positive colony numbering that screens ,+be connection carrier pBI121-35s-CeFT plasmid positive control;-be empty carrier plasmid pBI121 negative control.

Fig. 5 is that the PCR of transgenic (CeFT) Arabidopis thaliana identifies figure, wherein M be Marker 2000,1-14 be CeFT transgenic arabidopsis strain system numbering ,+be connection carrier pBI121-35s-CeFT plasmid positive control;-be wild-type Arabidopis thaliana negative control.

Embodiment:

Further explain the present invention below in conjunction with specific embodiment.Should be understood that these embodiment only are not used in restriction scope of the present invention to be used to the present invention is described.Unreceipted concrete experimental technique in the following example all can carry out according to ordinary method.Condition described in " fine works molecular biology experiment guides " such as " molecular cloning experiment guide ", F. Ao Sibai such as J. Sa nurse Brookers, or according to the operation instruction of used products production manufacturer.

Embodiment 1:

One, the clone of sword-leaved cymbidium CeFT gene and homology analysis thereof.

(1) bud with sword-leaved cymbidium kind " spun gold horse hair " (C.ensifolium ' Jin Si Ma Wei ') is a test materials, vegetable material under the greenhouse normal condition, grow (L/D, 16h/8h; 25-28 ℃).

(2) RNA extracts: the total RNA with Trizol reagent (available from the Invitrogen company) material that makes an experiment extracts, and the entire operation process is extracted process description in strict accordance with the RNA of Trizol reagent.

(3) adopt M-MLV ThermoScript II (available from Promgra company) rt mRNA to become cDNA first chain, method is carried out according to the reagent specification sheets.

(4) clone of gene: sword-leaved cymbidium bud cDNA first chain with rt is a template, utilizes primers F T-1F and FT-1R to carry out pcr amplification, reclaims the PCR product, order-checking, the core fragment of acquisition 205bp.

Primer: FT-1F:5 '-TAGGACGAGTGATTGGTGA-3 '

FT-1R：5′-TCACTTGGACTTGGAGCAT-3′

Adopt Golden DNA polymerase (TIANGEN) to carry out pcr amplification, the specification sheets of application of sample system reference enzyme, its PCR response procedures is: 94 ℃ of sex change 4min; Carry out 35 circulating reactions (94 ℃ of 30s subsequently; 51 ℃ of 45s, 72 ℃ of 1min), 72 ℃ are extended 5min.

Utilize the core fragment of this 205bp, according to the RACE method, the primers F T3A and the FT3B of design amplification 3 ' terminal sequence, and the primers F T5A and the FT5B of the 5 ' terminal sequence that increases, primer is:

FT3A：5′-TAGGACGAGTGATTGGTGA-3′

FT3B：5′-TTCAGCAGTAGTGGAGCAG-3′

FT5A：5′GGCTGCTCCACTACTGCTGAAGGCT?3′

FT5B：5′CAAGTACATCACCAATCACTCGTCC?3′

3 ' terminal sequence pcr amplification reaction program is: adopt Golden DNA polymerase (TIANGEN) to carry out pcr amplification; The specification sheets of application of sample system reference enzyme; Its PCR response procedures is 94 ℃ of sex change 3min, subsequently 30 circulating reactions (94 ℃ of 30s, 53 ℃ of 45s; 72 ℃ of 1min), 72 ℃ are extended 5min.

5 ' terminal sequence pcr amplification reaction program is: adopt Golden DNA polymerase (TIANGEN) to carry out pcr amplification, the specification sheets of application of sample system reference enzyme, its PCR response procedures are 95 ℃ of sex change 1min, then 5 circulating reaction (94 ℃ of 30s; 72 ℃ of 2min), follow 5 circulating reactions (94 ℃ of 30s, 70 ℃ of 30s again; 72 ℃ of 1.5min), last 30 circulating reactions (94 ℃ of 30s, 62 ℃ of 30s; 72 ℃ of 1.5min), 72 ℃ are extended 10min, 4 ℃ of termination reactions.

Reclaim amplified production, the extension increasing sequence of 5 ' end and 3 ' terminal sequence is checked order, splice the acquisition full length cDNA sequence at last with core fragment; Its sequence is shown in SEQ ID NO.1; This sequence length is 773bp, the ORFs of this sequence be SEQ ID NO.1 from the 87th at 5 ' end to the 617th bit base, 531bp altogether; With this ORFs called after CeFT gene; The polypeptide that this genes encoding is made up of 176 amino-acid residues, called after CeFT albumen, proteinic pI/Mw is respectively 6.42/19848.3.Amino acid (CeFT albumen) sequence of sword-leaved cymbidium CeFT genes encoding is analyzed its homology with ClustalW2; The result shows that CeFT albumen comprises differentiation FT and the proteic key amino acid residue of TFL1 Tyr (Y); And another decisive amino-acid residue Gln (Q) of 140; Two conservative motifs that also have the FT proteinoid in addition are 14 conserved amino acid sequences (LGRQTVYAPGWRQN) and LYN/IYN triplet; Also have a conservative PEBP structural domain, the homology of it and oncidiumLuridum OnFT is the highest, is 94%; Be respectively 79%, 74% with the amino acid sequence homology of paddy rice Hd3a, Arabidopis thaliana FT, Fig. 1 is seen in concrete comparison.

Two, sword-leaved cymbidium CeFT gene expression pattern is analyzed

Sword-leaved cymbidium not flowering period with bloom period; Extract root, pseudobulb, leaf and axillalry bud and total RNA of the root in flowering period, pseudobulb, leaf, axillalry bud, bennet and bud in the not flowering period of sword-leaved cymbidium plant respectively with Trizol reagent (Invitrogen); Quantitatively take out 2 μ gRNA after measuring OD260, and then use oligo-dT primer and PrimeScript ^TMReverse Transcriptase (available from Takara company) carries out reverse transcription reaction (method is with reference to specification sheets); Special primer FT-1F:5 '-TAGGACGAGTGATTGGTGA-3 ' with amplification FT core fragment; FT-1R:5 '-TCACTTGGACTTGGAGCAT-3 ' carries out pcr amplification, and this primer is crossed over intron.Adopt Golden DNA polymerase (TIANGEN) to carry out pcr amplification, the specification sheets of application of sample system reference enzyme, its response procedures are 94 ℃ of sex change 4min, carry out 32 circulating reactions (94 ℃ of 30s, 54 ℃ of 45s, 72 ℃ of 1min) subsequently, and 72 ℃ are extended 5min.Reaction product is separated with 1.0% agarose gel electrophoresis, and electrophoresis result is shown in Fig. 2 and 3, and wherein contrast is the ACTIN gene from sword-leaved cymbidium; The primer of ACTIN gene of this contrast of increasing is: ACTPF:5 '-CCTCTCAATCCCAAGGCAAACA-3 ', and ACTPR:5 '-GACCTCGGGGCACCTAAATCTC-3 ' adopts Golden DNA polymerase (TIANGEN) to carry out pcr amplification; The specification sheets of application of sample system reference enzyme; Its response procedures is 94 ℃ of sex change 4min, carries out 32 circulating reactions (94 ℃ of 30s, 54 ℃ of 45s subsequently; 72 ℃ of 1min), 72 ℃ are extended 5min.Can find out that from Fig. 2 and Fig. 3 the CeFT gene all has expression in each organ of sword-leaved cymbidium, vegetative growth phase, the CeFT expression level is lower, generative growth phase, expression level is higher.Vegetative growth phase, the CeFT gene was at the expression amount the highest (Fig. 2) of axillalry bud; Reproductive stage CeFT gene is the highest at the expression amount of bud, and the expression amount in bennet, axillalry bud takes second place, the expression amount in root and leaf minimum (Fig. 3).

Three, the expression of sword-leaved cymbidium CeFT gene in Arabidopis thaliana and the phenotypic evaluation of transfer-gen plant.

(1) contains the structure of goal gene CeFT expression vector

The cDNA that obtains with the front rt is a template, uses the LA Taq enzyme of Takara company to increase, the reaction system by specification, and amplimer is:

CeFT-F 5’CCGTCTAGAATGAATAGAGAGAGAGACTCTTTG?3’

CeFT-R 5’CTTGAATTCTCAATCCTGCATCCTTCTTCCGCC?3’

Response procedures is 94 ℃ of 4min; 94 ℃ of 30sec, 60 ℃ of 45sec, 72 ℃ of 2min, 35cycles; 72 ℃ of 5min.

The CeFT gene that amplification is obtained is connected with the pMD18-T carrier of Takara company after reclaiming, and transforms in the entering intestinal bacteria.

Extraction contains the T vector plasmid of CeFT gene; Utilize restriction enzyme site Xba I and EcoR I that the CeFT gene is downcut from the T carrier; With the plant expression vector pBI121 that has 35s promotor and no terminator equally with Xba I be connected after EcoR I enzyme is cut; Ligase enzyme is with T4 DNALigase (available from Takara company), and concrete operations by specification method is carried out, construction of expression vector pBI121-35s-CeFT.

(2) adopt freeze-thaw method to be transformed among the agrobacterium tumefaciens GV3101 recombinant expression vector pBI121-35s-CeFT.

takes out the Agrobacterium competent cell from-70 ℃; Thaw on ice; Add 5 μ l recombinant expression vector pBI121-35s-CeFT; Mixing gently, ice bath 30min.

shifts this mixture and puts in the mortar; Liquid nitrogen flash freezer 1min; Change over to rapidly in 37 ℃ of metal baths; With its thawing, about 2-3min.

adds 1ml LB in mixture, cultivate 2-4h in 28 ℃ of shaking table 200rpm.Described LB liquid nutrient medium is this area substratum commonly used, and it is filled a prescription with reference to " molecular cloning experiment guides " such as J. Sa nurse Brookers.

coats converted product on the flat board of LB+Kan (kantlex) 50mg/L+Genta 25mg/L; Dry up; Seal, be put in 28 ℃ of incubators and cultivated 48 hours.

picking mono-clonal carries out bacterium colony PCR to be identified; As shown in Figure 4; Contrast with plasmid pBI121-35s-CeFT positive (+); With empty carrier plasmid pBI121 negative (-) contrast, 1,2,3 all is the agrobacterium tumefaciens GV3101 clone positive colony that contains goal gene (CeFT gene) that screens.

(3) utilize inflorescence dip method arabidopsis thaliana transformation

Positive colony of picking is inoculated in the liquid nutrient medium of LB+Kan (kantlex) 50mg/L+Genta 25mg/L, and 28 ℃ of 200rpm shaking culture 24-36h make OD ₆₀₀About=0.8.

changes bacterium liquid in the aseptic 50ml centrifuge tube over to; 5000rpm; The centrifugal collection bacterial classification of 15min; Use infiltration substratum (the 1/2MS+0.5g/L MES+5% Sucrose of equal volume again; PH5.7) resuspended Agrobacterium, and add tensio-active agent Silwet, make its final concentration reach 0.02% (200 μ l/L).Described MS substratum is this area substratum commonly used, and its prescription is with reference to (Murashige T and Skoog F, 1962).

gets the Arabidopis thaliana plant (petal) that has just bloomed and in this solution, soaks 1min.Tiltingly dry unnecessary bacterium liquid.

will contaminate the Arabidopis thaliana inflorescence epiphragma of bacterium liquid and preserve moisture; About dark culturing 8 hours, take off film again and place the ripe results of normal management seed under the illumination.

(4) Molecular Identification of transfer-gen plant.

Collect contemporary transfer-gen plant seed (T ₀For), be seeded on the 1/2MS solid medium that contains Kan microbiotic (50mg/L) after the sterilization (10%NaClO 10min, aqua sterilisa rinsing 6 times) and screen.The green resistant plant commentaries on classics of growth about 10 days is planted in the basin alms bowl, and matrix is that peat soil is 3: 1 (volume ratio) with the vermiculite ratio.Collect T ₁For seed.This seed is planted on the 1/2MS substratum that contains Kan microbiotic (50mg/L); Statistical from than; Choose and meet 3 survivals: cultivate in transgenic line plantlet of transplant to the alms bowl of 1 dead separation ratio, collect T2, this seed is planted on the 1/2MS substratum that contains Kan microbiotic (50mg/L) for seed; Seed all is green seedling on substratum, and T2 for seed for isozygotying is.With plasmid pBI121-35s-CeFT positive (+) contrast, with Arabidopis thaliana wild-type leaf DNA negative (-) contrast, with the 35S promoter sequence and insert target gene sequences design primer, carry out PCR detect single insert strain be in the expression of goal gene.Primer sequence is following: 35SFT-F:5 '-TTGCGATAAAGGAAAGGC-3 '; 35SFT-R:5 '-ACGAAGACGAAGCGGTGT-3 '; Qualification result is as shown in Figure 5, chooses positive plant, obtains to change over to the transgenic arabidopsis of pBI121-35s-CeFT expression vector therefrom.

(5) transfer-gen plant carries out phenotypic evaluation.

With transgenic arabidopsis T2 for cultivating under plant and the wild-type Arabidopis thaliana equal conditions; Compare with the wild-type Arabidopis thaliana; The transgenic arabidopsis bolting and when blooming the lotus throne leaf 4 leaves are only arranged, transfer-gen plant is all bloomed than wild-type tobacco in advance, under the equal culture condition; The wild-type Arabidopis thaliana needed bloom in 31 days, and the transgenic arabidopsis that changes the CeFT gene over to only needed bloom in 22 days.Show that according to the result external source CeFT gene has been realized overexpression in host's Arabidopis thaliana, promoted transgenic to bloom in advance.Test-results shows that sword-leaved cymbidium CeFT gene is the gene that function is arranged, and can influence the growth of plant, has the promotion reproductive growth, thereby shortens the effect of flowering time.

By the The above results analysis revealed, CeFT gene of the present invention is a new integrator gene FT gene of blooming, and this gene can promote the reproductive growth of plant, shortens flowering time, thereby influences the growth of plant.

Claims

1. sword-leaved cymbidium integrator gene-CeFT gene of blooming is characterized in that, the nucleotide sequence of described CeFT gene as the 87th among the SEQ ID NO.1 to shown in 617 bit bases.

2. one kind by the bloom protein of integrator gene-CeFT genes encoding of the described sword-leaved cymbidium of claim 1, it is characterized in that described proteinic aminoacid sequence is shown in SEQ ID NO.2.

3. recombinant plant expression vector that contains the described CeFT gene of claim 1.

4. recombinant plant expression vector according to claim 3 is characterized in that, the carrier in the described recombinant plant expression vector is pBI carrier, pBin carrier, Gateway ^TWCarrier or pCAMBIA carrier.

5. the described CeFT gene of claim 1 is shortening the virgin phase of plant, the application during the promotion plant blooms in advance.

6. application according to claim 5 is characterized in that, described plant is an Arabidopis thaliana.