CN102367468A - Method for quickly and efficiently screening L-arginine-producing strain - Google Patents
Method for quickly and efficiently screening L-arginine-producing strain Download PDFInfo
- Publication number
- CN102367468A CN102367468A CN2011102898114A CN201110289811A CN102367468A CN 102367468 A CN102367468 A CN 102367468A CN 2011102898114 A CN2011102898114 A CN 2011102898114A CN 201110289811 A CN201110289811 A CN 201110289811A CN 102367468 A CN102367468 A CN 102367468A
- Authority
- CN
- China
- Prior art keywords
- arginine
- strain
- screening
- argbh
- coli
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a method for quickly and efficiently screening an L-arginine-producing strain, belonging to the technical field of industrial microbial breeding. The traditional method for screening an L-arginine-producing strain is characterized by screening a strain containing anti-L-arginine structural analogs. In the invention, an Escherichia coli L-arginine defective strain is constructed as an L-arginine secretion indicator bacterium; and TTC (2,3,5-triphenyltetrazolium chloride) is a viable cell indicator and can be reduced into red by reducing hydrogen produced by viable cells. By using the L-arginine defective strain as the L-arginine secretion indicator bacterium and using the TTC as the developer through an interactive co-culture method to realize the qualitative screening of the L-arginine-producing strain based on the concentration of the extracellular L-arginine, a strain having high L-arginine synthesis capability or good secretion performance can be preliminarily screened on a flat plate. The method greatly improves the screening efficiency in strain breeding and saves the cost.
Description
Technical field
The present invention relates to a kind ofly based on L-l-arginine deficient strain, the method for rapidly and efficiently screening L-l-arginine superior strain belongs to the industrial micro breeding technical field.
Background technology
The L-l-arginine is human body and animal intravital half an essential basic aminoacids, is the important source material of synthetic protein creatine, also is a kind of important mesostate of organism ornithine cycle, therefore in medicine and foodstuffs industry, has extensive use.
Fermentative Production L-l-arginine is to commercially produce more effective and economic method at present, and good L-l-arginine superior strain is the arginic key of fermentative prodn L-.The seed selection of L-l-arginine superior strain at present mainly is to obtain through traditional selection by mutation and modern genetic engineering breeding method; Wherein genetic engineering breeding is strong because of its purpose; Workload little and extremely investigators favor; And the bacterial classification production performance that selection by mutation obtains is often more stable, therefore still extensively utilization in production practice.Find also in the production practice that produce L-l-arginine bacterial classification in process is gone down to posterity in preservation, production performance can fail gradually; Producing acid and transformation efficiency can constantly descend; Therefore must regularly carry out rejuvenation, promptly from the bacterial strain of decline, filter out the not bacterial strain of decline through separation, purifying; The highly yielding ability that could keep bacterial strain so constantly satisfies the production needs.No matter be with traditional mutagenesis, with of the transformation of modern genetic engineering means to existing L-l-arginine superior strain, or the rejuvenation of superior strain, all need from numerous single strains, pick out superior strain.So it is essential that the seed selection of high yield L-l-arginine bacterial strain is operated in the arginic fermentative prodn of L-.The screening of traditional L-l-arginine superior strain mainly is through screening anti-L-l-arginine analog bacterial strain, and its output of bacterial strain of resistive connection structure analogue strong resistance is corresponding will be higher.But,, therefore make that screening operation intensity is big, efficient is low and cost is higher because the arginic similar species of L-is more and cost an arm and a leg.
The present invention has set up a kind of dull and stereotyped development process that rapidly and efficiently screens L-l-arginine superior strain from another angle.From the synthetic L-l-arginine of L-L-glutamic acid 3 approach are arranged in the mikrobe: linear path, circulation approach and the newfound transcarbamylase that utilizes carry out the biosynthetic new way of L-l-arginine; Intestinal bacteria and archeobacteria are mainly with the synthetic L-l-arginine of linear path; Mikrobes such as yeast saccharomyces cerevisiae, Corynebacterium glutamicum, pseudomonas are then with the synthetic L-l-arginine of circulation approach, Fig. 1.In the intestinal bacteria; N-acetylglutamat kinases argB in the L-l-arginine route of synthesis is positioned at the upper reaches of argininosuccinase argH just; The present invention obtains L-l-arginine defective escherichia coli through knocking out the argH gene; With E.coli BL21 genomic dna is that template PCR obtains the argBH gene fragment, at the inner kalamycin resistance gene (Kan) that inserts of argH, thereby realizes knocking out of argH obtained the L-l-arginine defective escherichia coli that this enzyme lacks.With TTC is qualitative screening that developer realize Corynebacterium crenatum born of the same parents outer l-arginine concentration height as L-l-arginine excretory indicator through the mutual method of supporting altogether with L-l-arginine deficient strain; On flat board, just sift out the high or secretion performance more excellent type bacterial strain of synthetic L-l-arginine ability; And then sieve again through shake flask fermentation again, this method has improved the screening efficiency in the strain improvement greatly and has practiced thrift cost.Therefore, the present invention has positive effect to screening high yield L-l-arginine bacterial strain.
Summary of the invention
The purpose of this invention is to provide a kind of based on intestinal bacteria L-l-arginine deficient strain, the method for rapidly and efficiently screening L-l-arginine superior strain.
Technical scheme of the present invention: at first make up e. coli bl21 L-l-arginine deficient strain, use the dull and stereotyped development process screening of this bacterial strain L-l-arginine superior strain.
E. coli bl21 L-l-arginine deficient strain construction process is following:
(1) amplification of argBH: with E.coli BL21 genomic dna is template, uses primer P15 '-CGC
GAATTCATGAATCCATTAATTATCAAACTGG-3 ' (EcoR I), P25 ' CGC
GTCGACTTACCCTAACCGAGC CTGC-3 ' (Sal I) amplification argBH gene, the amplification cycles condition: 94 ℃ of preparatory sex change 5min, 94 ℃ of sex change 40s, 56 ℃ of annealing 90s, 72 ℃ are extended 90s, 35 circulations.
(2) spend the night for 16 ℃ with the pMD-18T carrier and be connected in the argBH gene fragment running gel recovery back of the structure of plasmid pMD-18T-argBH::Kan: PCR acquisition; Transformed E .coli JM109, picking positive transformant and checking obtain E.coli JM109 (pMD-18T-argBH).T-Kan is cut back glue with the EcoRV enzyme reclaim the wherein big or small fragment that comprises the Kan resistant gene that is about 1.4kb; And it is connected (the EcoRV site is positioned at argH inside) with same T-argBH after cutting with the EcoRV enzyme; Transformed E .coli JM109, picking positive transformant and checking obtain E.coli JM109 (T-argBH::Kan).
(3) acquisition of E.coliBL21 l-arginine deficient strain: plasmid T-argBH::Kan is cut with EcoRI, XhoI enzyme, and glue reclaims and obtains the argBH::Kan fragment.Thermal shock Transformed E .coli BL21 screens positive transformant on the kalamycin resistance flat board.With the positive that obtains transform give dibbling respectively in minimum medium (MM) dull and stereotyped with the dull and stereotyped contrast cultivation of supplemental medium (SM), on the MM flat board, can't grow, tentatively think L-l-arginine defective bacterial strain what added normal growth on the arginic SM flat board of L-.Extract the chromosomal DNA of transformant, with the primer amplification argBH::Kan of argBH gene, the checking positive transformant.Obtain E.coli BL21L-l-arginine deficient strain thus.
The foundation of the dull and stereotyped development process of rapid screening high yield L-l-arginine bacterial strain:
The minimum medium (g/L) that the dull and stereotyped development process of described rapid screening is used: glucose 10, (NH
4)
2 SO
43, KH
2PO
41, MgSO
47H
2O 0.5, FeSO
47H
2O 0.02, MnSO
4H
2O 0.02, agar 20, vitamin H 8 * 10
-5, VitB1 2 * 10
-4, L-Histidine 5 * 10
-4PH 7.0～7.2, and 1 * 10
5The Pa 20min that sterilizes.
The supplemental medium (g/L) that the dull and stereotyped development process of described rapid screening is used: add the L-l-arginine with 20mg/L in the minimum medium, pH 7.0～7.2, and 1 * 10
5The Pa 20min that sterilizes.
The screening culture medium that the dull and stereotyped development process of described rapid screening is used: in the minimum medium with 10
5Individual/mL cell concn is sneaked into E.coli BL21L-l-arginine deficient strain.
The dull and stereotyped development process of described rapid screening is with 10 in minimum medium
5Individual/mL cell concn is sneaked into E.coli BL21L-l-arginine deficient strain and is processed the screening flat board; The 4 strain Corynebacterium crenatums that this laboratory preservation L-arginine yield does not wait are dull and stereotyped with same amount dibbling to screening; Cultivate 5-7d for 30 ℃; Evenly spray aseptic 1 μ g/mL TTC solution (membrane filtration degerming) in Bechtop, place 1-2h for 37 ℃, observe the dull and stereotyped colour developing situation that goes up.
The application of the dull and stereotyped development process of rapid screening high yield L-l-arginine bacterial strain:
In the minimum medium with 10
5Individual/mL cell concn is sneaked into E.coli BL21L-l-arginine deficient strain and is processed the screening flat board; Bacterial strain to be screened is processed certain density bacteria suspension; 10 times of serial dilutions are coated on this flat board, cultivate 5-7d for 30 ℃, evenly spray aseptic 1 μ g/mL TTC solution (membrane filtration degerming) in Bechtop; Place 1-2h for 37 ℃, observe the dull and stereotyped colour developing situation that goes up.
Beneficial effect of the present invention: the screening method of traditional L-l-arginine superior strain is the anti-L-l-arginine analog bacterial strain of screening; The present invention is according to high yield L-l-arginine bacterial strain characteristics; Utilize L-l-arginine deficient strain and L-l-arginine to produce the mutual keeping between the bacterial strain; With TTC is developer, and indirect visual, rapid screening go out L-l-arginine superior strain, has improved screening operation efficient greatly and has practiced thrift cost.
Description of drawings
The structure of Fig. 1 plasmid pMD-18T-argBH::Kan
The arginic route of synthesis of Fig. 2 mikrobe L-
The amplification 1 of Fig. 3 a argBH gene: λ DNA/HindIII; 2:argBH gene.3b T-EcargBH::Kan enzyme is cut checking 1.DL2000; 2.T-EcargBH::Kan/EcoRI+SalI; 3.T-EcargBH/EcoRV; 4.T-EcargBH::Kan/EcoRV; 5.T-EcargBH::Kan/EcoRI; 6. λ DNA/HindIII
The PCR of Fig. 4 argBH gene knockout transformant identifies 1～5:argBH PCR of, 1～5transformants6～7:kan PCRof 1～2transformants; 8: λ HindIII Marker
Dull and stereotyped development process result such as the 4 strain Corynebacterium crenatum deficient strain that Fig. 5 L-arginine yield does not wait
Embodiment
Embodiment 1: the inner realization of argininosuccinase gene knocks out purpose and obtains deficient strain in kalamycin resistance gene (Kan) the insertion e. coli bl21 L-l-arginine route of synthesis:
The structure of the amplification of argBH and plasmid pMD-18T-argBH::Kan: primer the P15 '-CGC that obtains argBH according to the argBH sequences Design PCR that announces among the GeneBank
GAATTCATGAATCCATTAATTATCAAACTGG-3 ' (EcoR I) P25 ' CGC
GTCGACTTACCCTAACCGAGCCTGC-3 ' (Sal I).With E.coli BL21 genomic dna is template, with primer P1, P2 amplification argBH gene, amplification cycles condition: 94 ℃ of preparatory sex change 5min; 94 ℃ of sex change 40s, 56 ℃ of annealing 90s, 72 ℃ are extended 90s; 35 circulations, amplified production detects through 0.8% agarose gel electrophoresis, shown in Fig. 3 a; Can find out has a bright band at the 2.2kb place, this is big or small consistent with the expection of argBH gene.Spend the night for 16 ℃ with the pMD-18T carrier and be connected in the argBH gene fragment running gel recovery back that PCR obtains, Transformed E .coli JM109 obtains E.coli JM109 (pMD-18T-argBH).Recombinant plasmid pMD-18T-argBH cuts with the EcoRV enzyme; Glue reclaims the T-argBH fragment of 4.7kb after the linearizing, T-Kan is cut back glue with the EcoRV enzyme reclaims the fragment that comprises the Kan resistant gene that size wherein is about 1.4kb, and with its with cut with the EcoRV enzyme equally after T-argBH be connected; Obtain T-argBH::Kan; Enzyme is cut the checking result and is seen Fig. 3 b, can see, the 3rd swimming lane plasmid T-EcargBH cuts the fragment that discharges the 4.7kb size with the EcoRV enzyme; Show that T-EcargBH makes up successfully; The second swimming lane plasmid T-EcargBH::Kan is with EcoRI, the two fragments that discharge 3.4kb and 2.7kb size of cutting of SalI, and the 4th swimming lane T-EcargBH::Kan cuts the fragment that discharges 4.7kb and 1.4kb size with the EcoRV enzyme, shows that T-EcargBH::Kan makes up successfully.
The acquisition of E.coli BL21 l-arginine deficient strain: plasmid T-argBH::Kan is cut with EcoRI, XhoI enzyme, and glue reclaims and obtains the argBH::Kan fragment.Thermal shock Transformed E .coli BL21 screens positive transformant on the kalamycin resistance flat board.With the positive that obtains transform give dibbling respectively in minimum medium (MM) dull and stereotyped with the dull and stereotyped contrast cultivation of supplemental medium (SM), on the MM flat board, can't grow, tentatively think L-l-arginine defective bacterial strain what added normal growth on the arginic SM flat board of L-.Extract the chromosomal DNA of transformant; Primer amplification argBH::Kan with the argBH gene; The checking positive transformant; The result is as shown in Figure 4 in checking: the former argBH gene of positive transformant is contained the argBH::Kan replacement that the Kan fragment length is approximately 3.4kb, and the about 2.2kb of original control strain argBH mrna length, both differ about 1.2kb.Explain that the successful usefulness argBH::Kan fragment of positive transformant replaced former argBH gene, reached purpose the argH gene knockout.Embodiment 2: utilizing L-l-arginine defective escherichia coli, is developer with TTC, the foundation of the dull and stereotyped development process of rapid screening high yield L-l-arginine bacterial strain:
In the minimum medium with 10
5Individual/mL cell concn is sneaked into E.coli BL21L-l-arginine deficient strain and is processed the screening flat board; The 4 strain Corynebacterium crenatums that this laboratory preservation L-arginine yield does not wait are dull and stereotyped with same amount dibbling to screening; Cultivate 5-7d for 30 ℃; Evenly spray aseptic 1 μ g/mL TTC solution (membrane filtration degerming) in Bechtop, place 1-2h for 37 ℃, observe the dull and stereotyped colour developing situation that goes up.As shown in Figure 5, experimental result shows that red circle size is proportional with bacterial strain L-arginine yield, and it is effective and feasible to show that this method is used to screen high yield L-l-arginine mutant strain.
Embodiment 3: the application of the dull and stereotyped development process of rapid screening high yield L-l-arginine bacterial strain
In the minimum medium with 10
5Individual/mL cell concn is sneaked into E.coli BL21L-l-arginine deficient strain and is processed the screening flat board; Bacterial strain to be screened is processed certain density bacteria suspension; 10 times of serial dilutions are coated on this flat board, cultivate 5-7d for 30 ℃, evenly spray aseptic 1 μ g/mL TTC solution (membrane filtration degerming) in Bechtop; Place 1-2h for 37 ℃, observe the strain growth situation.
Claims (3)
1. a method of rapidly and efficiently screening L-l-arginine superior strain is characterized in that making up a strain e. coli bl21 L-l-arginine deficient strain
As L-l-arginine excretory indicator, how many indication L-l-arginine produces the outer L-l-arginine of bacterial strain born of the same parents, just sifts out L-l-arginine superior strain with it.
2. the described e. coli bl21 L-of claim 1 l-arginine deficient strain construction process is following:
In intestinal bacteria, the N-acetylglutamat kinases argB in the L-l-arginine route of synthesis is positioned at the upper reaches of argininosuccinase argH just, hereinafter to be referred as argBH.With E.coli BL21 genomic dna is template amplification argBH gene, at the inner kalamycin resistance gene (Kan) that inserts of argH, thereby realizes knocking out of argH obtained the L-l-arginine defective escherichia coli that this enzyme lacks.
3. the establishment method of the dull and stereotyped development process of the described rapid screening high yield of claim 1 L-l-arginine bacterial strain is following:
The described L-l-arginine of claim 1 deficient strain is passed through the method for supporting altogether alternately with viable cell indicator TTC (2 as L-l-arginine excretory indicator; 3; The 5-triphenyltetrazolium chloride) realizes the qualitative screening just of the outer l-arginine concentration of Corynebacterium crenatum born of the same parents for developer, on flat board, filter out the high or secretion performance more excellent type bacterial strain of synthetic L-l-arginine ability.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110289811 CN102367468B (en) | 2011-09-28 | 2011-09-28 | Method for quickly and efficiently screening L-arginine-producing strain |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110289811 CN102367468B (en) | 2011-09-28 | 2011-09-28 | Method for quickly and efficiently screening L-arginine-producing strain |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102367468A true CN102367468A (en) | 2012-03-07 |
| CN102367468B CN102367468B (en) | 2013-07-24 |
Family
ID=45760059
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110289811 Active CN102367468B (en) | 2011-09-28 | 2011-09-28 | Method for quickly and efficiently screening L-arginine-producing strain |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102367468B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103320438A (en) * | 2013-05-24 | 2013-09-25 | 江南大学 | Screening method for corynebacterium crenatum dissolved oxygen inducible promoter |
| CN108795965A (en) * | 2018-03-05 | 2018-11-13 | 北京理工大学 | A kind of screening technique of polar amino acid superior strain |
-
2011
- 2011-09-28 CN CN 201110289811 patent/CN102367468B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| M.LEONOR FERNA´NDEZ-MURGA等: "《Arginine Biosynthesis in Thermotoga maritima: Characterization of the Arginine-Sensitive N-Acetyl-L-Glutamate Kinase》", 《JOURNAL OF BACTERIOLOGY》 * |
| WENFANG DOU等: "《Improvement of L-Arginine Production by Overexpression of a Bifunctional Ornithine Acetyltransferase in Corynebacterium crenatum》", 《APPL BIOCHEM BIOTECHNOL》 * |
| 饶志明等: "《钝齿棒杆菌精氨酸琥珀酸酶编码基因argH的克隆表达及其重组菌发酵产精氨酸研究》", 《中国生物工程杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103320438A (en) * | 2013-05-24 | 2013-09-25 | 江南大学 | Screening method for corynebacterium crenatum dissolved oxygen inducible promoter |
| CN103320438B (en) * | 2013-05-24 | 2015-06-24 | 江南大学 | Screening method for corynebacterium crenatum dissolved oxygen inducible promoter |
| CN108795965A (en) * | 2018-03-05 | 2018-11-13 | 北京理工大学 | A kind of screening technique of polar amino acid superior strain |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102367468B (en) | 2013-07-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102132132B1 (en) | Fermentation method to improve recombinant human collagen production level | |
| CN102453691A (en) | Escherichia coli engineering bacteria capable of realizing high yield of L-tryptophan | |
| CN106754607B (en) | A kind of recombinant bacterial strain and its construction method producing tyrosol | |
| CN110055204B (en) | Method for improving fermentation enzyme production of bacillus licheniformis by knocking out spo II Q and pcf genes and application | |
| CN105087529A (en) | Genetically engineered protease K and production method of protease K | |
| CN106148209A (en) | New binary organic acid produces bacterial strain and preparation thereof and application | |
| CN102994439A (en) | Escherichia coli recombinant strain producing shikimic acid, and construction method and application thereof | |
| CN100357441C (en) | Yeast expressing system of recombined human nerve growth factor and process for preparing recombined human nerve grouth factor | |
| CN109486876A (en) | A method of threonine is extracted and is purified in fermentation | |
| Zhao et al. | Enhancement of nuclease P1 production by Penicillium citrinum YL104 immobilized on activated carbon filter sponge | |
| CN102367468B (en) | Method for quickly and efficiently screening L-arginine-producing strain | |
| CN103429738A (en) | Transformant of yeast of genus schizosaccharomyces, method for producing same, method for producing [beta]-glucosidase, and method for decomposing cellulose | |
| CN105907692A (en) | High-yield recombinant corynebacterium glutamicum for L-lysine and method for constructing high-yield recombinant corynebacterium glutamicum | |
| CN116478838B (en) | Pichia pastoris with multi-carbon source utilization and high protein synthesis and application thereof | |
| CN105349516A (en) | Threonine deaminase, coding gene, carrier, engineering bacterium and applications | |
| CN102242092A (en) | Isolation and identification for bombyx mori intestinal tract probiotics, and cloning and expression of enzyme gene produced by bombyx mori probiotics | |
| CN109134662A (en) | A kind of visualization antibacterial peptide fusion protein and preparation method thereof and its application | |
| CN103667274B (en) | A kind of multiple-shaped nuohan inferior yeast genetic manipulation strategy and application thereof | |
| CN104774863B (en) | A kind of method for improving Lactococcus lactis Microcystin stress resistance | |
| CN107778365A (en) | The recombinant-protein expression that a kind of multiple spot is integrated | |
| CN106086055B (en) | The strain of DNC wireless algae and its construction method that a kind of pair of alcohol resistance significantly improves | |
| CN115960803A (en) | Autonomous evolution system and application thereof | |
| CN104099267A (en) | Construction and application of C.glutamicum subspecies lactofermentum with high L-methionine yield | |
| CN104357425A (en) | Novel alpha-galactosidase NGAL, and gene and application thereof | |
| CN102533841B (en) | Method for increasing expression of bacillus thuringiensis(Bt) insecticidalcrystalprotein in hansenula polymorpha |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |