CN106754607B - A kind of recombinant bacterial strain and its construction method producing tyrosol - Google Patents

A kind of recombinant bacterial strain and its construction method producing tyrosol Download PDF

Info

Publication number
CN106754607B
CN106754607B CN201710091999.9A CN201710091999A CN106754607B CN 106754607 B CN106754607 B CN 106754607B CN 201710091999 A CN201710091999 A CN 201710091999A CN 106754607 B CN106754607 B CN 106754607B
Authority
CN
China
Prior art keywords
tyrosol
gene
tyrosine
aro10
recombinant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201710091999.9A
Other languages
Chinese (zh)
Other versions
CN106754607A (en
Inventor
陈献忠
薛宇翔
杨翠
樊游
沈微
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Priority to CN201710091999.9A priority Critical patent/CN106754607B/en
Publication of CN106754607A publication Critical patent/CN106754607A/en
Application granted granted Critical
Publication of CN106754607B publication Critical patent/CN106754607B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1096—Transferases (2.) transferring nitrogenous groups (2.6)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/22—Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01001—Pyruvate decarboxylase (4.1.1.1)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kind of recombinant bacterial strains and its construction method for producing tyrosol, belong to microorganism field.The present invention constructs recombinant vector pRSFDuet-ARO10-ARO8 using technique for gene engineering, converted the e. coli bl21 (DE3) of the knockout gene pheA and gene feaB by genetic engineering transformation, obtain bacterial strain BE0, it is reacted by whole-cell catalytic, using 10mM tyrosine as substrate, fermentation 20h can produce tyrosol up to 6.73mM, tyrosine conversion ratio is up to 67.3%, on the basis of this recombinant bacterium, by chemical mutagenesis, to obtain the recombinant bacterial strain BE2 of one plant of performance optimization high yield tyrosol, it is reacted by whole-cell catalytic, using 10mM tyrosine as substrate, fermentation 20h can produce tyrosol up to 8.71mM, tyrosine conversion ratio is up to 87.1%.

Description

A kind of recombinant bacterial strain and its construction method producing tyrosol
Technical field
The present invention relates to a kind of recombinant bacterial strains and its construction method for producing tyrosol, belong to microorganism field.
Background technique
Tyrosol (4- (2-Hydroxyethyl) phenol) is a kind of natural antioxidant, derives from olive oil, is benzene A kind of derivative of ethyl alcohol.As a kind of antioxidant, it can protect cell from oxidative damage.For phenolic compound, It has very big industrial value.Tyrosol and its derivative are the synthons for synthesizing various organic compounds.For example, junket Alcohol can be used for preparing commercially getable medical agent, and e.g., betaxolol and metoprolol, these medicaments are selective β 1 Receptor blocker, while can be used for treating hypertension, angina pectoris, heart failure and glaucoma.In addition, tyrosol may be hydroxyl The precursor substance of tyrosol, hydroxytyrosol (2- (3,4-dihydroxyphenyl) ethanol) are one kind for human health Antioxidant, for tyrosol, its inoxidizability is better than tyrosol, meanwhile, it can also synthesize many polymer.According to related Studies have shown that it has many biological properties, it prevents the generation of the diseases such as angiocarpy, osteohalsiteresis.In addition, tyrosol can be with The flavor of improvement food, such as sake are removed as food additives.
Due to the huge industrial value of tyrosol, it has obtained the attention of industry personage gradually.Currently, industrially prepared junket Alcohol mainly passes through chemical technology method.Existing chemical synthesis process has very much, for example, phenol and its phenol derivatives synthesis The techniques such as method, carboxylic acid synthetic method, benzyl carbinol alcohol synthetic method, para-nitrotoluene synthetic method.The synthetic method of p-hydroxyphenylethanol is very It is more, but only having for really realization industrialized production domestic at present is synthesized using phenol and its derivatives and benzyl carbinol as raw material, Two kinds of synthetic method comparative maturities in technical study.It is to use first to protect hydroxyl mostly, so by taking benzyl carbinol alcohol synthetic method as an example Nitrification, reduction, diazotising, hydrolysis obtain p-hydroxyphenylethanol, yield 70% afterwards.In this approach, amino is reduced into nitro During, the amine of researcher's available different yields of different catalysts, main catalyst has platinum black and stannous chloride, Obtained yield is respectively 90% and 88%.This process yield is high, but it the drawbacks of be raw material benzyl carbinol price, It is in short supply.Other chemical synthesis process, such as para-nitrotoluene synthetic method cost of material relative moderate, the source of goods is more, cost compared with It is low, but step is longer, low yield, is unfavorable for the protection of environment；4-Vinyl phenol synthetic method yield 96%, purity 99% produce Rate and purity are all very high, have certain value, but a large amount of investments of cost of material equally constrain large-scale industrialization life It produces.
In order to solve these problems mentioned above, biological synthesis process synthesis tyrosol has become research hotspot, day in 2014 Saliva industry institute Yanfen Bai etc. is heterologous in E.coli MG1655 by the Pyruvate Decarboxylase Gene ARO10 in saccharomyces cerevisiae Expression successfully constructs the recombinant microorganism for producing tyrosol.Then, it to the transformation of chromosome, successfully constructs and efficiently synthesizes tyrosol Engineering bacteria, yield is up to 6.8mM.
Summary of the invention
The present invention provides Escherichia coli (Escherichia coli) BE2 that one plant produces tyrosol, on September 6th, 2016 It is preserved in China typical culture collection center, deposit number is CCTCC NO:M2016462, and preservation address is Wuhan, China, Wuhan University.
Escherichia coli BE2 provided by the invention will be derived from Pyruvate Decarboxylase Gene ARO10, the aromatic series of saccharomyces cerevisiae Amino acid aminotransferase gene ARO8, using technique for gene engineering import by genetic engineering transformation knockout gene feaB with PheA e. coli bl21 (DE3) expresses under strong promoter T7 control, colibacillus engineering BE0 is successfully constructed, in this strain On the basis of bacterium, chemical mutagenesis is carried out, filters out the recombination for excessively synthesizing tyrosol using tyrosine as substrate of performance performance optimization E. coli mutant strain BE2.
The aromatic amino acid transamination enzyme coding gene nucleotide sequence is as shown in GenBank 852672；It is described Shown in pyruvate decarboxylation enzyme coding gene nucleotide sequence GenBank 851987.
The construction step of the Escherichia coli BE2 includes:
A) it expands to obtain the ARO10 genetic fragment containing I restriction enzyme site sequence of BamH I and Nco from saccharomyces cerevisiae genome；
B) it constructs pRSFDuet-ARO10 recombinant vector: distinguishing digestion with restriction enzyme BamH I, Nco I The ARO10 genetic fragment that pRSFDuet-1 plasmid and step a) are obtained, and using the connection reaction of T4DNA ligase, it obtains PRSFDuet-ARO10 recombinant vector；
C) it expands to obtain 8 genetic fragment of ARO containing I restriction enzyme site sequence of Nde I and Xho from saccharomyces cerevisiae genome；
D) it constructs recombinant vector pRSFDuet-ARO10-ARO8: distinguishing digestion step with restriction enzyme Nde I, Xho I B) the genetic fragment ARO8 that the recombinant vector pRSFDuet-ARO10 and step c) obtained is obtained, and use T4DNA ligase Connection reaction, obtains recombinant vector pRSFDuet-ARO10-ARO8；
E) CaCl is used2Recombinant vector pRSFDuet-ARO10-ARO8 is imported the large intestine for knocking out pheA and feaB by conversion method Bacillus obtains colibacillus engineering BE0；
F) mutagenesis obtains recombination bacillus coli mutant strain BE2.
The present invention also provides the methods of application Escherichia coli BE2 production tyrosol, are using tyrosine as substrate, with large intestine The full cell of bacillus BE2 synthesizes tyrosol as catalyst.
Specifically, it cultivates, collect Escherichia coli BE2 thallus, place it in full cell effect liquid, make its OD600About 18, reaction 20h or so.
The present invention provides biological synthesis process synthesize tyrosol, by derived from saccharomyces cerevisiae Pyruvate Decarboxylase Gene ARO10, Aromatic amino acid aminotransferase gene ARO8 makes its overexpression, utilizes technique for gene engineering under strong promoter T7 control The e. coli bl21 (DE3) for knocking out gene feaB and pheA is imported, colibacillus engineering BE0 is successfully constructed, in this plant of bacterium On the basis of, chemical mutagenesis is carried out, the recombination large intestine bar for excessively synthesizing tyrosol using tyrosine as substrate of performance optimization is filtered out Bacterium mutant strain BE2 synthesizes tyrosol with the method for Whole Cell Bioconversion, this method has operation letter using tyrosine as substrate It is single, pollute small, the higher feature of yield；Using 10mM tyrosine as substrate, fermentation 20h can produce tyrosol up to 8.71mM, and tyrosine turns Rate is up to 87.1%.
Biomaterial preservation
Escherichia coli (Escherichia coli) BE2 was preserved in China typical culture collection on September 6th, 2016 Center, deposit number are CCTCC NO:M2016462, and preservation address is Wuhan, China, Wuhan University.
Detailed description of the invention
Fig. 1 is the approach that colibacillus engineering synthesizes tyrosol；
Fig. 2 is the electrophoretogram of the resulting ARO10 genetic fragment containing specific cleavage site sequence of embodiment 1, wherein 1 is ARO10 gene, and M is label；
Electrophoretogram is identified in the digestion that Fig. 3 is recombinant plasmid pRSFDuet-ARO10, wherein 1,2 be pRSFDuet-ARO10 enzyme Product is cut, M is label；
Fig. 4 is the resulting ARO8 genetic fragment electrophoretogram containing specific cleavage site sequence of embodiment 1, wherein 1 is ARO8 gene, M are label；
Fig. 5 is that electrophoretogram is identified in the digestion of gained pRSFDuet-ARO10-ARO8 recombinant plasmid, wherein 1-2: for PRSFDuet-ARO10-ARO8, M are label；
Fig. 6 is that high performance liquid chromatography surveys the obtained chromatogram of tyrosol standard sample, and the appearance time of tyrosol is at 6.02 points Clock or so；
Fig. 7 is the obtained chromatogram of fermentation liquid that high performance liquid chromatography surveys recombinant bacterium.
Specific embodiment
Embodiment 1
One, the building of the recombinant plasmid pRSFDuet-ARO10 of the encoding gene containing pyruvate decarboxylase
According to encoding gene ARO10 nucleotide sequence (the ARO10 gene sequence of reported saccharomyces cerevisiae pyruvate decarboxylase No. GenBank of column is 851987), to design following primer, and I restriction enzyme site of Nco is introduced in upstream primer (with underscore mark Out), I restriction enzyme site of BamH (being marked with underscore) is introduced in downstream primer.
Aro101:CATGCCATGGGCATGTCTGAAATTACTTTGGGT
Aro102:GGCGCCGCGGATCCTATTTTTTATTTCTTTTA
Using saccharomyces cerevisiae Eby100 genomic DNA as template, using aro101, aro102 as primer, PCR amplification is carried out.It will Obtained PCR product carries out 1% agarose gel electrophoresis, and electrophoresis result is as shown in Fig. 2, obtain the special of a treaty 1908bp Property band, size is consistent with the mrna length that GenBank has been announced, through further DNA sequencing show amplification obtain pyruvic acid Decarboxylase gene.The ARO10 gene and expression vector pRSFDUet-1 recombinant vector that amplification is obtained are through restriction enzyme Nco I with I double digestion of BamH, and using T4DNA ligase connection reaction, construct pRSFDUet-ARO10 recombinant plasmid.Utilize limit Property restriction endonuclease processed carries out digestion verification, as a result sees Fig. 4, and digestion obtains the band of size about 3829bp and 1908bp, suitable with expection, The pRSFDUet-ARO10 structure that digestion verification result proves is correct.In Fig. 2, swimming lane M is DL 5000DNA Marker, swimming lane 1 For the PCR product of ARO10；In Fig. 3, swimming lane M be DL 5000DNA Marker, swimming lane 1,2 be restriction enzyme Nco I with Recombinant plasmid pRSFDUet-ARO10 after I double digestion of BamH.
Two, pRSFDUet-ARO10-ARO8 recombinant vector containing aromatic amino acid transamination enzyme coding gene Building
According to the encoding gene ARO8 nucleotide sequence of reported saccharomyces cerevisiae aromatic amino acid aminopherase (No. GenBank of ARO8 gene order is 852672), designs following primer, I restriction enzyme site of Nde is introduced in upstream primer (being marked with underscore) introduces I restriction enzyme site of Xho (being marked with underscore) in downstream primer.
Aro81:GGAATTCCATATGACTTTACCTGAATCAAAAGAC
Aro82:CCGCTCGAGCTATTTGGAAATACCAAATTCTTCGT
Using saccharomyces cerevisiae Eby100 genomic DNA as template, using aro81, aro82 as primer, PCR amplification is carried out.Will The PCR product arrived carries out 1% agarose gel electrophoresis, and electrophoresis result obtains a treaty 1503bp's as shown in Fig. 1 swimming lane 2 Specific band, size is consistent with the mrna length that GenBank has been announced, and shows that amplification obtains third through further DNA sequencing Keto-acid decarboxylase enzyme gene.The ARO8 gene and b step one that amplification is obtained obtain recombinant vector pRSFDUet-ARO10 through limiting Property restriction endonuclease Nde I and I double digestion of Xho construct recombinant plasmid pRSFDUet- and using the connection reaction of T4DNA ligase ARO10-ARO8.Carry out digestion verification using restriction enzyme, as a result see Fig. 4, digestion obtain size about 5737bp and The band of 1503bp, suitable with expection, digestion verification result proves that the structure of pRSFDUet-ARO10-ARO8 is correct.In Fig. 4, swimming Road M is DL 5000DNA Marker, and swimming lane 1 is the PCR product of ARO8；In Fig. 5, swimming lane M is DL 5000DNA Marker, swimming Road 1,2 is the recombinant plasmid pRSFDUet-ARO10-ARO8 after restriction enzyme Nde I and I double digestion of Xho.
Three, Red homologous recombination technique knocks out the gene feaB of e. coli bl21 (DE3)
The gene feaB nucleotide sequence (No. GenBank of feaB gene order is 945933) announced according to NCBI, and Plasmid pKD13 sequence, designs following primer, and introducing and the homologous 50bp sequence of gene order, draw in downstream in upstream primer It is introduced and the homologous 50bp sequence of gene order in object.
YFeaB1:ATGACAGAGCCGCATGTAGCAGTATTAAGCCAGGTCCAACAGTTTCTCGAGTGTGGCTGGA GCTGCTTC
YFeaB2:TTAATACCGTACACACACCGCTTAGTTTCACACCAACCGTCCAGCCAGTATTCCGGGGATC CGTCGACC
Using plasmid pKD13 as template, to carry out PCR amplification for YFeaB1, YFeaB2 primer.By obtained PCR product into The agarose gel electrophoresis of row 1%, electrophoresis result obtain the specific band of a treaty 1503bp as shown in Fig. 1 swimming lane 2, Size is consistent with the mrna length that GenBank has been announced, and shows that amplification obtains the gene containing homology arm through further DNA sequencing Segment.The genetic fragment that amplification is obtained imports in the e. coli bl21 (DE3) containing plasmid pKD46, sieves through resistant panel Choosing, obtained transformant are verified through bacterium colony PCR, and amplification has obtained the segment of 1780bp, obtain integrating resistant maker gene Positive transformant.In 42 DEG C of elimination temperature sensitive type plasmid pKD46, screens, obtain long in kalamycin resistance plate through resistant panel And the transformant that cannot be grown on amicillin resistance plate, plasmid pCP20 is being converted into positive transformants obtained above Son is screened through resistant panel, is verified through bacterium colony PCR, and amplification obtains the segment of 274bp, is accredited as positive transformant.By what is obtained Positive transformant is incubated overnight through 42 DEG C, eliminates plasmid pCP20, the single colonie grown is screened through resistant panel, is obtained in card Long transformant, this transformant are not to delete gene feaB for that chloramphenicol resistance plate and amicillin resistance plate Mutant strain.
Four, Red homologous recombination technique knocks out the gene pheA for having deleted the e. coli bl21 (DE3) of gene feaB
The gene pheA nucleotide sequence (No. GenBank of pheA gene order is 947081) announced according to NCBI, and Plasmid pKD13 sequence, designs following primer, and introducing and the homologous 50bp sequence of gene order, draw in downstream in upstream primer It is introduced and the homologous 50bp sequence of gene order in object.
YPheA1:AGGCAACACTATGACATCGGAAAACCCGTTACTGGCGCTGCGAGAGAAAAGTGTGGCTGGA GCTGCTTC
YPheA2:TCAGGTTGGATCAACAGGCACTACGTTCTCACTTGGGTAACAGCCCAATAATTCCGGGGAT CCGTCGACC
Using plasmid pKD13 as template, using YPheA1, YPheA2 as primer, PCR amplification is carried out.By obtained PCR product into The agarose gel electrophoresis of row 1%, electrophoresis result obtain the specific band of a treaty 1503bp as shown in Fig. 1 swimming lane 2, Size is consistent with the mrna length that GenBank has been announced, and shows that amplification obtains the gene containing homology arm through further DNA sequencing Segment.The genetic fragment that amplification is obtained imports the e. coli bl21 (DE3) for having deleted gene feaB containing plasmid pKD46 In, it is screened through resistant panel, obtained transformant is verified through bacterium colony PCR, and amplification has obtained the segment of 1658bp, is obtained in integration The positive transformant of resistant maker gene.In 42 DEG C of elimination temperature sensitive type plasmid pKD46, screened through resistant panel, obtain card that The transformant that chloramphenicol resistance plate is long and cannot grow on amicillin resistance plate, it is above-mentioned converting plasmid pCP20 Obtained positive transformant, is screened through resistant panel, is verified through bacterium colony PCR, and amplification obtains the segment of 499bp, is accredited as the positive Transformant.Obtained positive transformant is incubated overnight through 42 DEG C, plasmid pCP20 is eliminated, the single colonie grown is put down through resistance Screen choosing, obtains the transformant that do not grow in kalamycin resistance plate and amicillin resistance plate, this transformant is not Delete the mutant strain of gene feaB and gene pheA.It is named as BE0.
Five, the technique that tyrosol is synthesized as substrate resting cell using tyrosine
With obtained host BE0, by whole-cell catalytic, using tyrosine as substrate, tyrosol is synthesized.By recombination mutation bacterium BE2 is inoculated into 20mL LB liquid medium, and 37 DEG C are incubated overnight, 1% inoculum concentration switching 50mL fresh liquid LB culture Base, with the optimal conditions OD by optimization600=0.6,0.2mM IPTG inducer is added, in 25 DEG C of Fiber differentiation 8h, collects bacterium Body places it in full cell effect liquid (100mM Tris-HCl buffer (pH 7.4), 10mM MgCl2,2mM NADH,2mM Thiamine pyrophosphate, 0.2mM pyridoxal phosphate) in, make its OD600About 18, ferment 20h, fits Fermentation liquid is collected when the time, centrifuging and taking supernatant is used as efficient liquid phase chromatographic analysis.
Chromatographic column used in efficient liquid phase be Cosmosil5C18-MS-II column, mobile phase used be pure methanol and The concentration of 0.1% trifluoroacetic acid, methanol increases to 80% from 20% in 0~5min, keeps 80% concentration 10min later.Efficiently Detector used in liquid chromatographic detection tyrosol is UV detector, and condition elution flow rate used is 0.4ml/min, and Detection wavelength is 222nm。
Six, the recombination bacillus coli mutant strain that tyrosol is excessively synthesized using tyrosine as substrate of performance optimization is obtained
It draws starting strain Escherichia coli BE0 single colonie to be inoculated in the triangular flask for filling 5ml cultured solution of broth, 37 DEG C of cultures Overnight.Second day addition 5ml fresh cultured solution of broth, after mixing well, is distributed into 2 triangular flasks, continues to cultivate 5h.By two The bacterium solution of triangular flask is poured into centrifuge tube respectively, and 3500rpm is centrifuged 10min, is discarded supernatant liquid, is beaten precipitating, wherein one manages 5ml physiological saline is sucked, another centrifuge tube, two pipes and Cheng Yiguan are subsequently poured into.Bacterium solution 1ml is drawn in centrifuge tube, freezes 1h, Akinete is made.It is added 5ml acetate buffer solution (pH=4.0), adds 13.8mg sodium nitrite, the mutagenic treatment at 37 DEG C 5~8min.0.1mol/LNaOH is added and is neutralized to pH=7.0, stops nitrous acid effect.Bacterium solution that treated passes through processing, after It after culture, is coated on the plate containing penicillin, cultivates 12h, wild type is eliminated by penicillin method, screening obtains 500 Mutant strain.It will obtain 500 mutant strains to be inoculated into 10mL LB liquid medium, 37 DEG C are incubated overnight, and 1% inoculum concentration turns 10mL fresh liquid LB culture medium is connect, with the optimal conditions OD by optimization600=0.6,0.2mM IPTG inducer, In is added 25 DEG C of Fiber differentiation 8h collect thallus, place it in full cell effect liquid, make its OD600About 18, ferment 20h, collects hair Zymotic fluid, centrifuging and taking supernatant, is used as efficient liquid phase chromatographic analysis.
Fermented experiment filters out the recombination large intestine bar that tyrosol is excessively synthesized using tyrosine as substrate of one plant of performance optimization Bacterium mutant strain.Using 10mM tyrosine as substrate, recombinant bacterial strain BE0 can produce tyrosol up to 6.7mM, on the basis of recombinant bacterial strain BE0, pass through The bacterial strain BE2 that chemical mutagenesis obtains is crossed, tyrosol can be produced up to 8.71mM.
Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention Enclosing subject to the definition of the claims.
SEQUENCE LISTING
<110>Southern Yangtze University
<120>a kind of recombinant bacterial strain and its construction method for producing tyrosol
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 33
<212> DNA
<213>artificial sequence is used for PCR
<400> 1
catgccatgg gcatgtctga aattactttg ggt 33
<210> 2
<211> 32
<212> DNA
<213>artificial sequence is used for PCR
<400> 2
ggcgccgcgg atcctatttt ttatttcttt ta 32
<210> 3
<211> 34
<212> DNA
<213>artificial sequence is used for PCR
<400> 3
ggaattccat atgactttac ctgaatcaaa agac 34
<210> 4
<211> 35
<212> DNA
<213>artificial sequence is used for PCR
<400> 4
ccgctcgagc tatttggaaa taccaaattc ttcgt 35
<210> 5
<211> 69
<212> DNA
<213>artificial sequence is used for PCR
<400> 5
atgacagagc cgcatgtagc agtattaagc caggtccaac agtttctcga gtgtggctgg 60
agctgcttc 69
<210> 6
<211> 69
<212> DNA
<213>artificial sequence is used for PCR
<400> 6
ttaataccgt acacacaccg cttagtttca caccaaccgt ccagccagta ttccggggat 60
ccgtcgacc 69
<210> 7
<211> 69
<212> DNA
<213>artificial sequence is used for PCR
<400> 7
aggcaacact atgacatcgg aaaacccgtt actggcgctg cgagagaaaa gtgtggctgg 60
agctgcttc 69
<210> 8
<211> 70
<212> DNA
<213>artificial sequence is used for PCR
<400> 8
tcaggttgga tcaacaggca ctacgttctc acttgggtaa cagcccaata attccgggga 60
tccgtcgacc 70

Claims (3)

1. Escherichia coli (Escherichia coli) BE2 of one plant of production tyrosol, was preserved in Chinese Typical Representative on September 6th, 2016 Culture collection, deposit number are CCTCC NO:M2016462, and preservation address is Wuhan, China, Wuhan University.
2. application claim 1 described in Escherichia coli BE2 production tyrosol method, which is characterized in that be using tyrosine as substrate, Tyrosol is synthesized using the full cell of Escherichia coli BE2 as catalyst.
3. method according to claim 2, which is characterized in that Escherichia coli BE2 thallus is collected in culture, is placed it in complete thin In born of the same parents' reaction solution, make its OD600About 18, reaction 20h or so.
CN201710091999.9A 2017-02-21 2017-02-21 A kind of recombinant bacterial strain and its construction method producing tyrosol Active CN106754607B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710091999.9A CN106754607B (en) 2017-02-21 2017-02-21 A kind of recombinant bacterial strain and its construction method producing tyrosol

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710091999.9A CN106754607B (en) 2017-02-21 2017-02-21 A kind of recombinant bacterial strain and its construction method producing tyrosol

Publications (2)

Publication Number Publication Date
CN106754607A CN106754607A (en) 2017-05-31
CN106754607B true CN106754607B (en) 2019-11-08

Family

ID=58958341

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710091999.9A Active CN106754607B (en) 2017-02-21 2017-02-21 A kind of recombinant bacterial strain and its construction method producing tyrosol

Country Status (1)

Country Link
CN (1) CN106754607B (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108753636B (en) 2018-06-12 2020-06-09 山东恒鲁生物科技有限公司 Yeast for producing tyrosol and hydroxytyrosol and construction method
US11286475B2 (en) 2019-08-15 2022-03-29 Jiangnan University Tyrosol-producing recombinant Escherichia coli and construction method and application thereof
CN110452865B (en) * 2019-08-15 2021-05-28 江南大学 Recombinant escherichia coli for producing tyrosol as well as construction method and application thereof
CN111748508B (en) * 2020-06-23 2022-11-01 厦门大学 Construction method and application of escherichia coli with high yield of hydroxytyrosol
CN113025546B (en) * 2021-03-18 2023-06-13 江南大学 Method for producing tyrosol by converting L-tyrosine through multienzyme cascade
CN113493758B (en) * 2021-05-31 2022-08-02 江南大学 Tyrosol-producing recombinant escherichia coli capable of shortening fermentation period and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104099379A (en) * 2013-04-08 2014-10-15 中国科学院天津工业生物技术研究所 Method for biosynthesis of tyrosol in Escherichia coli and application of tyrosol

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104099379A (en) * 2013-04-08 2014-10-15 中国科学院天津工业生物技术研究所 Method for biosynthesis of tyrosol in Escherichia coli and application of tyrosol

Also Published As

Publication number Publication date
CN106754607A (en) 2017-05-31

Similar Documents

Publication Publication Date Title
CN106754607B (en) A kind of recombinant bacterial strain and its construction method producing tyrosol
JP2009538118A (en) Enzymatic production of 2-hydroxy-2-methylcarboxylic acid
CN107586795B (en) Method for producing phloretin by fermentation of saccharomyces cerevisiae
CN110157654B (en) Bacillus natto recombinant strain and construction method and application thereof
CN107129959A (en) Construction method and application of genetic engineering strain for producing (R) -acetoin
CN106086102A (en) A kind of engineering bacteria producing trans-4-hydroxy-l-proline and construction method thereof and application
CN106520715B (en) A kind of short-chain dehydrogenase and its gene, recombinant expression carrier, genetic engineering bacterium and its application in the synthesis of astaxanthin chiral intermediate
CN104630100A (en) Reconstructed Klebsiella pneumoniae and application of reconstructed Klebsiella pneumoniae in production of R-acetoin
CN114672525B (en) Biosynthesis method and application of N-acetyl-5-methoxy tryptamine
CN110396507A (en) L- pantoic acid lactone dehydrogenase from Cnuibacter physcomitrellae
CN112080452B (en) High-yield phenyllactic acid bacillus licheniformis genetically engineered bacterium, method for producing phenyllactic acid and application
CN105907692A (en) High-yield recombinant corynebacterium glutamicum for L-lysine and method for constructing high-yield recombinant corynebacterium glutamicum
KR102473375B1 (en) Recombinant microorganisms, their preparation methods and their use in the production of coenzyme Q10
CN109913508A (en) A method of phloretin is synthesized using cyanobacteria
CN110257313B (en) Engineering bacterium of bacillus amyloliquefaciens for producing spermidine
CN106133144A (en) Use the preparation method of 4 amino-cinnamic acids of enzyme
CN104862264B (en) A kind of recombinant bacterium for converting production α-phenylpyruvic acid efficiency and improving
CN113249240B (en) Saccharomyces cerevisiae for high yield of hydroxytyrosol and construction method thereof
CN108588108A (en) A kind of preparation method and application of the bacillus of efficient metabolism glycerine
CN102212499B (en) Application of gene for coding 4-hydroxyphenylphruvic acid dioxygenase
CN116970622A (en) Stable genetic screening element, construction method and application thereof
CN114736918A (en) Recombinant escherichia coli for producing salidroside through integrated expression and application thereof
CN114854717B (en) Lipase and encoding gene and application thereof
KR102602060B1 (en) Recombinant microorganism for producing 2,3-butanediol with reduced by-product production and method for producing 2,3-butanediol using the same
CN101985626B (en) Component flavin dependent monooxygenase gene in prokaryote and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant