CN102344964B - Detection method for genetically modified wheat B72-8-11 b - Google Patents
Detection method for genetically modified wheat B72-8-11 b Download PDFInfo
- Publication number
- CN102344964B CN102344964B CN 201110321461 CN201110321461A CN102344964B CN 102344964 B CN102344964 B CN 102344964B CN 201110321461 CN201110321461 CN 201110321461 CN 201110321461 A CN201110321461 A CN 201110321461A CN 102344964 B CN102344964 B CN 102344964B
- Authority
- CN
- China
- Prior art keywords
- sequence
- seq
- sample
- wheat
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a detection method for genetically modified wheat B72-8-11 b, namely detecting a genetic component of which the sequence is SEQ ID NO: 11 by a PCR (polymerase chain reaction) method. The genetic component comprises an edge sequence of which the sequence is SEQ ID NO: 14. By the method, variety identification of the genetically modified wheat B72-8-11 b can be quickly and sensitively realized. The method has high specificity and high sensitivity and is fast and accurate.
Description
Technical field
The present invention relates to a kind of authentication method of transgenic wheat strain.
Background technology
Transgenic wheat is to utilize genetic engineering technique, in the exogenous genes introduced into wheat gene, through screening the wheat that can express goal gene that obtains.In transgenosis and expression study, need to carry out Molecular Detection to the seedling through conversion processing, to eliminate non-transformed plant.Selectable marker gene (as neomycin phosphotransferase gene, chloramphenicol acetyl transferasegene and Totomycin transferase gene etc.) and reporter gene (as B2 glucosiduronatase gene and luciferase gene etc.) have been widely used in the screening of transformed plant and tissue, but in some cases, this screening effect is unreliable.PCR is one of common technology that detects for this purpose, has sensitivity, advantage fast.Application for this technology is to seek mark gene fragment appropriate, high specificity, and designs primer and the amplification condition that is complementary based on this.
Summary of the invention
The object of the present invention is to provide the method that to identify quickly and accurately transgenic wheat B72-8-11b, the detection method of described transgenic wheat B72-8-11b, be method by PCR to detect sequence be the gene assembly of SEQ ID NO:11, this gene assembly comprises that sequence is the edge sequence of SEQ ID NO:14.
The primer pair of the pcr amplification that the method for the invention described above is addressed is SEQ ID NOS:1/2:
B72-F1(SEQ ID NO：1)：ATGATGGAGGGCATTACTTGGGAGTGAA
B72-R1(SEQ ID NO：2)：ACCCTGATCCCCAAAGTAAACTCGC。
Easily understand, adopt aforesaid method to carry out pcr amplification, if amplification is positive, wheat to be measured is transgenic wheat B72-8-11b; If amplification is negative, wheat to be measured is not transgenic wheat B72-8-11b.
In more preferred technical scheme, the PCR reaction conditions is
94 ℃, 1min, 1 circulation;
98 ℃ of 10s, 55 ℃ of 30s, 72 ℃ of 30s, 35 circulations;
72 ℃, 7min, 1 circulation.
The optimal technical solution of the detection method of transgenic wheat B72-8-11b of the present invention is:
Adopt 50 μ LPCR reaction systems, wherein contain: testing sample DNA, the preferred 5ng/ μ of its concentration L, 10 * LA PCR BufferII (Mg
2+Plus) 5ul, each 0.4mM of dNTP, base sequence are each 0.2 μ M of PCR primer of SEQ ID NOS:1～2, Taq archaeal dna polymerase 0.05U/ul.
Adopt method of the present invention can realize fast, delicately the strain of transgenic wheat B72-8-11b is identified, the method high specificity, highly sensitive, quick and precisely.
Description of drawings
Accompanying drawing 3 width of the present invention,
Fig. 1 is the 1% agarose gel electrophoresis figure of embodiment 1 take sample C genomic dna as template amplification, and wherein: M is DL2,000 DNA Marker; 1～6 is respectively ubiquitin, NOS, bar1, bar2, uidA and GAG56D.
The 1% agarose gel electrophoresis figure that Fig. 2 is embodiment 1 take sample A, B, C genomic dna as template amplification, wherein: M1 is λ-Hind III digest, M2 is DL2,000 DNA Marker, 1～6 is respectively C-ubiquitin F/Nos R, C-ubiquitin F/bar R1, C-ubiquitin F/uidA R, A-ubiquitin F/Nos R, A-ubiquitin F/bar R1 and A-ubiquitin F/uidA R.
Fig. 3 is the 1% agarose gel electrophoresis figure of embodiment 1, M:DL2 wherein, 000 DNA Marker.
Embodiment
The present inventor successfully clones through large quantity research the gene assembly A that comprises specificity exogenous array in transgenic wheat B72-8-11b, and this gene assembly A comprises uidA, ubi, lacZ 1Dx5 and wheat cdna group partial sequence.The complete sequence of this gene assembly A is as shown in SEQ ID NO:11.On the basis of the said gene assembly A complete sequence that obtains, the contriver further obtains the edge sequence of transgene component, i.e. sequence shown in SEQ ID NO:14, and it is positioned at the 8213rd～10384 of SEQ ID NO:11 sequence.Detection for the gene assembly shown in SEQ ID NO:11 can realize by PCR, use specific primer pair SEQ ID NOS:1/2 to increase under certain condition, as amplify target sequence, can judge that institute's test sample is derived from transgenic wheat B72-8-11b.
Following non-limiting example can make the present invention of those of ordinary skill in the art's comprehend, but does not limit the present invention in any way.
Obtaining of embodiment 1. transgenic wheat specific gene assembly A, B, C complete sequence and respective edges sequence
1, transgenosis sample gene group DNA extraction
Choose respectively transgenic wheat B72-8-11b, transgenic wheat B73-6-1 and transgenic wheat B102-1-2, be labeled as respectively sample A, sample B and sample C.Each sample is pulverized pulverization in liquid nitrogen afterwards, then uses DNA Extraction Kit for GMO Detection Ver.2.0 (TaKaRa Code No.D9093) to carry out extracting genome DNA.
Detect the DNA sample quality with 1% agarose gel electrophoresis, and use ultramicrospectrophotometer (Nanodrop) to test sample genomic dna quality and concentration, detected result shows: the genomic dna quality meets the subsequent experimental requirement, the average genomic dna concentration of sample A, B and C is 162.69ng/ μ L, 125.80ng/ μ L, 203.75ng/ μ L, also meets the subsequent experimental requirement.
2, transgenic wheat specific gene assembly A, B, C complete sequence obtain and component analysis
(1) as shown in table 1 according to the wheat inside and outside source gene-correlation information design primer that obtains from GenBank:
Table 1 qualitative PCR detects wheat native gene, the required primer sequence of foreign gene
Use TaKaRa LA
DNA Polymerase (Code No.DRR002A), extract the sample C genomic dna obtain as template take step 1, carry out pcr amplification with above-mentioned primer cross match, each element that may exist increases, respectively get 5 μ l and carry out 3% agarose gel electrophoresis, result as shown in Figure 1.Then use TaKaRa Agarose Gel DNA Purification Kit Ver.2.0 (Code No.DV805A) to reclaim order-checking to electrophoretic band, obtain each element sequences.
On above-mentioned working foundation, further obtain sequence between each element, method is as follows:
Reagent: use many kinds of PCR Kit of TaKaRa, as TaKaRa LA
DNA Polymerase (Code No.DRR002A), TaKaRa LA
With GC Buffer (Code No.DRR02AG) etc.
Template: extract the genomic dna of sample A, the B obtain, C as template take step 1.
Primer: each F primer and each R primer cross match in above-mentioned table 1.
Carry out repeatedly different condition pcr amplification, the sequence between each element of increasing, the sequence results that obtains between ubiquitin F/uidA R is correct.Be summarized as follows:
Use TaKaRa LA
DNA Polymerase (Code No.DRR002A) take A genomic dna and C genomic dna as template, carries out pcr amplification, respectively gets 5 μ l and carries out 3% agarose gel electrophoresis, and result as shown in Figure 2.Use TaKaRa Agarose Gel DNA Purification Kit Ver.2.0 (Code No.DV805A) to reclaim order-checking to electrophoretic band, the sequence results between ubiquitin F/uidA R is correct.
(2) flanking sequence obtains
1) carrying out flanking sequence with genomic dna obtains
Take the sequence between the ubiquitin F/uidA R that obtains as the basis, design flanking sequence primer uses TaKaRa Genome Walking Kit (TaKaRa Code No.D316) in conjunction with TaKaRa LA
(Code No.DRR002A) obtains the flanking sequence at ubiquitin F/uidA R sequence two ends.
2) building the segment storehouse carries out flanking sequence and obtains
So use Clontech Genome Walker
TMUniversal Kit (Clontech Code No.638904) structure segment storehouse, pcr amplification reagent uses
2 PCR Kit (Clontech Code No.639206) carry out obtaining of flanking sequence, and progressively the step moves.Finally obtain transgenic wheat high-molecular-weight glutelin subunit transgenic wheat different lines, i.e. the edge sequence of transgene component in sample A, B, C.
Wherein, Clontech Genome Walker
TMUniversal Kit Clontech Genome Walker
TMThe basic experiment process of Universal Kit is as follows:
A. genomic DNA is used respectively Pvu II, Dra I, Stu I, EcoR V enzyme to cut;
B. be connected to respectively Genome Walker Adaptor after purifying;
Be used for the PCR reaction after the c.TE dilution;
D. design primer and carry out pcr amplification, and analyze experimental result, reclaim the purpose band;
E. the purpose band is checked order, analyze sequencing result; To new " purpose " sequence that obtains, carry out the sequence checking;
F. repeatedly repeat above-mentioned steps d～e, until complete the complete sequence of required part.
(3) sequence total length and edge sequence obtains
Obtain the edge sequence through above-mentioned experimentation, and finally obtain the target gene assembly full length sequence of each sample, described gene assembly should be the gene fragment that has comprised allogenic gene and edge sequence.
1) sample A: transgenic wheat B72-8-11b
The gene assembly A that comprises specificity exogenous array in transgenic wheat B72-8-11b, this gene assembly A comprises uidA, ubi, lacZ 1Dx5 and wheat cdna group partial sequence.The complete sequence of this gene assembly A is as shown in SEQ IDNO:11.In this gene assembly A, each component analysis result shows: gene assembly A sequence total length 10384, wherein: 1～1782nd, uidA, 1766～3794th, ubi, 3797～6475th, lacZ, 6476～8073rd, 1Dx5,8213～10384th, wheat cdna group partial sequence.
In said gene assembly A complete sequence, contriver determined edge sequence, i.e. sequence shown in SEQ ID NO:14, it is positioned at the 8213rd～10384 of SEQ ID NO:11 sequence.
2) sample B: transgenic wheat B73-6-1
The gene assembly B that comprises specificity exogenous array in transgenic wheat B73-6-1, this gene assembly B comprise the wheat cdna group partial sequence of two sections end to end, and the uidA in these two sections sequences, ubi, lacZ, 1Dx5, coliDHl.The complete sequence of this gene assembly B is as shown in SEQ ID NO:12.In this gene assembly B, each component analysis result shows: gene assembly B sequence total length 14690,1～403rd, wheat portion gene group sequence, 404～2468th, uidA, 2477～4500th, ubi, 4503～7178th, lacZ, 7177～8377th, 1Dx5,9179～11784th, coliDHl, 11786～14690th, wheat portion gene group sequence.
In said gene assembly B complete sequence, contriver determined edge sequence, i.e. sequence shown in SEQ ID NO:15 and SEQID NO:16, they lay respectively at the 1st～403 and 11786～14690 of SEQ ID NO:12 sequence.
3) sample C: transgenic wheat B102-1-2
The gene assembly C that comprises specificity exogenous array in transgenic wheat B102-1-2, this gene assembly C comprises the wheat cdna group partial sequence of two sections end to end, and the ubi in these two sections sequences, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vestor pUbiGUSPlus, ubiquitin and coli DH1.The complete sequence of this gene assembly C is as shown in SEQ ID NO:13.In this gene assembly C, each component analysis result shows: gene assembly C sequence total length 14042,1～3993rd, wheat portion gene group sequence, 3994～5164th, ubi, 5220～5750th, vector pBANF-bar, 5766～6044th, vector pUbiGUSPlus, 6044～8682nd, vector HSP, 8695～9671st, reporter vestor pUbiGUSPlus, 9672～10121st, ubiquitin, 10121～10213rd, coli DH1,10214～14042nd, wheat portion gene group sequence.
In said gene assembly C complete sequence, contriver determined edge sequence, i.e. sequence shown in SEQ ID NO:17, they are positioned at the 10214th～14042 of SEQ ID NO:13 sequence.
3, the foundation of PCR detection method
Obtain SEQ ID NOS:11～13 special detection zone separately in order to increase, according to its separately complete sequence design PCR detect primer.Detect primer screening through too much taking turns PCR, finally obtain following Auele Specific Primer such as table 2:
Table 2
| Sequence numbering | The primer title | Length nt | Base sequence (5 '-3 ') |
| SEQ ID NO：1 | B72-F1 | 28 | ATGATGGAGGGCATTACTTGGGAGTGAA |
| SEQ ID NO：2 | B72-R1 | 25 | ACCCTGATCCCCAAAGTAAACTCGC |
| SEQ ID NO：3 | B73-FF1 | 24 | AGTATATCCGGGACGTTACAACAC |
| SEQ ID NO：4 | B73-FR1 | 26 | TATCAGTGTGCATGGCTGGATATGTA |
| SEQ ID NO：5 | B73-RF1 | 26 | CACGGCGCGTTGAATCTCCTCTGTAT |
| SEQ ID NO：6 | B73-RR1 | 25 | ATGCCTTTGTTTTCCCGCCCTCCCA |
| SEQ ID NO：7 | B102-F1 | 20 | GCGAGAGCCGCTGTATGTTC |
| SEQ ID NO：8 | B102-R1 | 22 | CGAGTAAATAATGCCAGCCTGT |
| SEQ ID NO：9 | GAG56D-F | 21 | CCCAACAACAACCACCGTTCA |
| SEQ ID NO：10 | GAG56D-R | 21 | TGGCCCTGGACGAGAGTACCT |
Wherein the amplification object of GAG56D-F/GAG56D-R is Triticum specificity native gene.
Setting up the PCR reaction system is: cumulative volume 50 μ L, dH
2O is the basis, contains: testing sample DNA 5ng/ μ L, 10 * LA PCR BufferII (Mg
2+Plus) (TaKaRa LA
Code No, DRR002A) 5ul, each 0.4mM of dNTP, each 0.2 μ M of primer pair (table 3), Taq archaeal dna polymerase (TaKaRa LA
Code No, DRR002A) 0.05U/ul.
Above-mentioned system is carried out pcr amplification according to following condition:
94 ℃, 1min, 1 circulation;
98 ℃ of 10s, 55 ℃ of 30s, 72 ℃ of 30s, 35 circulations;
72 ℃, 7min, 1 circulation.
Pcr amplification product is got 10ul, carries out 1% agarose gel electrophoresis, and result is as shown in Fig. 3 and table 3:
Table 3
As seen from the results, each designs primer and can amplify very accurately, specifically the target gene fragment.
Through condition optimizing, the pcr amplification condition optimizing of B102-1-2 strain transgenic wheat sample is:
94 ℃, 1min, 1 circulation;
98 ℃ of 10s, 62 ℃ of 30s, 72 ℃ of 30s, 35 circulations;
72 ℃, 7min, 1 circulation.
Based on this, reach a conclusion:
(1) method A: the PCR to transgenic wheat B72-8-11b (sample A) detects, and uses B72-F1/B72-R1 (SEQ ID NO:1/2) to carry out pcr amplification as Auele Specific Primer, and condition is:
Cumulative volume 50 μ L, dH
2O is the basis, contains: testing sample DNA 5ng/ μ L, 10 * LA PCR BufferII (Mg
2+Plus) 5ul, each 0.4mM of dNTP, each 0.2 μ M of primer B72-F1 and B72-R1, Taq archaeal dna polymerase (TaKaRa LA
) 0.05U/ul.
Above-mentioned system is carried out pcr amplification according to following condition:
94 ℃, 1min, 1 circulation;
98 ℃ of 10s, 55 ℃ of 30s, 72 ℃ of 30s, 35 circulations;
72 ℃, 7min, 1 circulation.
Through 1% agarose gel electrophoresis detected result, as positive in amplification, testing sample is transgenic wheat B72-8-11b, and is as negative in amplification, and testing sample is not transgenic wheat B72-8-11b.
(2) method B: the PCR to transgenic wheat B73-6-1 (sample B) detects, use B73-FF1/B73-FR1 (SEQ ID NOS:3/4) or B73-RF1/B73-RR1 (SEQ ID NOS:5/6) to carry out the PCR amplification as Auele Specific Primer, condition is:
Cumulative volume 50 μ L, dH
2O is the basis, contains: testing sample DNA 5ng/ μ L, 10 * LA PCR BufferII (Mg
2+Plus) 5ul, each 0.4mM of dNTP, each 0.2 μ M of primer B73-FF1/B73-FR1 or B73-RF1/B73-RR1, Taq archaeal dna polymerase (TaKaRa LA
) 0.05U/ul.
Above-mentioned system is carried out pcr amplification according to following condition:
94 ℃, 1min, 1 circulation;
98 ℃ of 10s, 55 ℃ of 30s, 72 ℃ of 30s, 35 circulations;
72 ℃, 7min, 1 circulation.
Through 1% agarose gel electrophoresis detected result, as positive in amplification, testing sample is transgenic wheat B73-6-1, and is as negative in amplification, and testing sample is not transgenic wheat B73-6-1.
(3) method C: the PCR to transgenic wheat B102-1-2 (sample C) detects, and uses B102-F1/B102-R1 (SEQ ID NOS:7/8) to carry out pcr amplification as Auele Specific Primer, and condition is:
Cumulative volume 50 μ L, dH
2O is the basis, contains: testing sample DNA 5ng/ μ L, 10 * LA PCR BufferII (Mg
2+Plus) 5ul, each 0.4mM of dNTP, each 0.2 μ M of primer B102-F1 and B102-R1, Taq archaeal dna polymerase (TaKaRa LA
) 0.05U/ul.
Above-mentioned system is carried out pcr amplification according to following condition:
94 ℃, 1min, 1 circulation;
98 ℃ of 10s, 62 ℃ of 30s, 72 ℃ of 30s, 35 circulations;
72 ℃, 7min, 1 circulation.
Through 1% agarose gel electrophoresis detected result, as positive in amplification, testing sample is transgenic wheat B102-1-2, and is as negative in amplification, and testing sample is not transgenic wheat B102-1-2.
1, sample preparation:
Choose 10 of wheat samples to be measured (as shown in table 4), pulverization in liquid nitrogen, use DNA Extraction Kit for GMO Detection Ver.2.0 (TaKaRa Code No.D9093) to carry out extracting genome DNA respectively.Then detect the genomic dna quality, carry out quality and concentration with ultramicrospectrophotometer (Nanodrop) detection genomic dna with agarose gel electrophoresis, determine that the quality of sample gene group DNA and concentration all meet the subsequent experimental requirement.
2, the method A that sets up according to embodiment 1, method B and method C detect these 10 samples, and result is as shown in table 4, and wherein "+" expression amplification is positive, and "-" expression amplification is negative.
Can find out from the detected result of table 4,
Method A can be accurately, sensitive, detect the sample that comes from transgenic wheat B72-8-11b specifically; All the other transgenic wheats and non-transgenic wheat samples are reported as non-transgenic wheat B72-8-11b sample, conform to the sample practical situation;
Method B can be accurately, sensitive, detect the sample that comes from transgenic wheat B73-6-1 specifically; All the other transgenic wheats and non-transgenic wheat samples are reported as non-transgenic wheat B73-6-1 sample, conform to the sample practical situation;
Method C can be accurately, sensitive, detect the sample that comes from transgenic wheat B102-1-2 specifically; All the other transgenic wheats and non-transgenic wheat samples are reported as non-transgenic wheat B102-1-2 sample, conform to the sample practical situation.
Table 4
Claims (2)
1. the detection method of transgenic wheat B72-8-11b, be method by PCR to detect sequence be the gene assembly of SEQ IDNO:11, this gene assembly comprises that sequence is the edge sequence of SEQ ID NO:14;
The primer pair of described pcr amplification is SEQ ID NOS:1/2;
Described PCR reaction conditions is:
94 ℃, 1min, 1 circulation;
98 ℃ of 10s, 55 ℃ of 30s, 72 ℃ of 30s, 35 circulations;
72 ℃, 7min, 1 circulation.
2. method claimed in claim 2, is characterized in that described PCR reaction system is 50 μ L systems, contains: testing sample DNA5ng/ μ L; 10 * LA PCR BufferII, Mg
2+Plus, 5 μ L; Each 0.4mM of dNTP; Each 0.2 μ M of primer pair; Taq archaeal dna polymerase 0.05U/ μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110321461 CN102344964B (en) | 2011-10-20 | 2011-10-20 | Detection method for genetically modified wheat B72-8-11 b |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110321461 CN102344964B (en) | 2011-10-20 | 2011-10-20 | Detection method for genetically modified wheat B72-8-11 b |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102344964A CN102344964A (en) | 2012-02-08 |
| CN102344964B true CN102344964B (en) | 2013-06-26 |
Family
ID=45544035
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110321461 Expired - Fee Related CN102344964B (en) | 2011-10-20 | 2011-10-20 | Detection method for genetically modified wheat B72-8-11 b |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102344964B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114369677A (en) * | 2022-01-04 | 2022-04-19 | 江汉大学 | Primer combination, kit, detection method and application for detecting wheat transgenic components and transgenic strains |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1932037A (en) * | 2006-09-18 | 2007-03-21 | 栾凤侠 | Method of screening transgenic wheat |
| CA2714790A1 (en) * | 2009-09-17 | 2011-03-17 | Commonwealth Scientific And Industrial Research Organisation | Wheat plants with immunity to wsmv |
-
2011
- 2011-10-20 CN CN 201110321461 patent/CN102344964B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1932037A (en) * | 2006-09-18 | 2007-03-21 | 栾凤侠 | Method of screening transgenic wheat |
| CA2714790A1 (en) * | 2009-09-17 | 2011-03-17 | Commonwealth Scientific And Industrial Research Organisation | Wheat plants with immunity to wsmv |
Non-Patent Citations (2)
| Title |
|---|
| 王娜丽等.转基因小麦外源优质亚基基因的杂交转育研究.《武汉植物学研究》.2007,第25卷(第04期), |
| 转基因小麦外源优质亚基基因的杂交转育研究;王娜丽等;《武汉植物学研究》;20071231;第25卷(第04期);331～334 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102344964A (en) | 2012-02-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109628627B (en) | Development and application of SNP (single nucleotide polymorphism) marker of broad-spectrum rice blast resistance gene Pigm of rice | |
| CN107988340B (en) | PCR amplification primer for rapidly detecting mycoplasma ovipneumoniae and application thereof | |
| CN103483438A (en) | Gene for cadmium pollution remediation of plant soil and coded protein and application thereof | |
| CN109628628B (en) | Development and application of SNP (single nucleotide polymorphism) marker of rice blast resistance gene Pi2 | |
| CN102344965B (en) | Detection method for genetically modified wheat B73-6-1 | |
| CN104419708A (en) | Nucleic acid, method for detecting transgenic rice EB7001S and derived line thereof, kit and application thereof | |
| CN108913809B (en) | InDel molecular marker of rice blast resistant gene Pid3-A4, detection method and application | |
| CN102344964B (en) | Detection method for genetically modified wheat B72-8-11 b | |
| CN104988236B (en) | The strain specificity quantitative PCR detection kit of transgenic wheat B73 61 a kind of and application | |
| CN102344963B (en) | Detection method for genetically modified wheat B102-1-2 | |
| CN102409082B (en) | Five-gene standard plasmid molecule for transgenic soybean detection and construction thereof | |
| CN112592995B (en) | Universal primer for detecting target gene expression in transgenic plant and detection method | |
| CN107988410A (en) | Identify molecular labeling, identification method and the application of rice blast resistant gene Pita | |
| CN102628040A (en) | Flanking sequence of exogenous insert vector for transgenic rice and application of flanking sequence | |
| CN107326088B (en) | Method for detecting insect-resistant herbicide-tolerant corn GH5112E-117C | |
| CN107267503B (en) | Nucleic acid, method for detecting transgenic rice B1C893 and derivative line thereof, kit and application thereof | |
| CN106755408B (en) | Plant allele imbalance expression detection method | |
| CN109735646B (en) | CAPS molecular marker and method for identifying rice variety and application thereof | |
| CN109161605B (en) | Development and application of SNP molecular marker of rice blast resistance gene Pi1 | |
| CN112375841A (en) | Trichoderma fungus rpb2 molecular marker gene degenerate primer group and application thereof | |
| CN104561313A (en) | Endogenous reference gene suitable for detection of sesame exogenous gene copy number and building method and application of endogenous reference gene | |
| CN105274229A (en) | Method and kit for detecting homozygous or heterozygous state of exogenous gene of genetically-modified corn T4-1-1 | |
| CN105483252B (en) | The PCR detection primers and detection method of transgenic line containing gus reporter gene | |
| CN104073562A (en) | Molecular marker for identifying different ecotypic species of coilia ectenes | |
| CN102409080A (en) | Two-gene standard plasmid molecule used for detecting genetically modified soybeans and building method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: XU JUNYI XU YANG Free format text: FORMER OWNER: XU JUNYI Effective date: 20130516 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Cao Jijuan Inventor after: Xu Junyi Inventor after: Xu Yang Inventor before: Cao Jijuan Inventor before: Xu Junyi |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: CAO JIJUAN XU JUNYI TO: CAO JIJUAN XU JUNYI XU YANG |
|
| TA01 | Transfer of patent application right |
Effective date of registration: 20130516 Address after: 116001 No. 60 Changjiang East Road, Zhongshan District, Liaoning, Dalian Applicant after: Cao Jijuan Applicant after: Xu Junyi Applicant after: Xu Yang Address before: 116001 No. 60 Changjiang East Road, Zhongshan District, Liaoning, Dalian Applicant before: Cao Jijuan Applicant before: Xu Junyi |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: XU JUNYI XU YANG ZHONG JIWEI Free format text: FORMER OWNER: XU JUNYI XU YANG Effective date: 20130929 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Cao Jijuan Inventor after: Xu Junyi Inventor after: Xu Yang Inventor after: Zhong Jiwei Inventor before: Cao Jijuan Inventor before: Xu Junyi Inventor before: Xu Yang |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: CAO JIJUAN XU JUNYI XU YANG TO: CAO JIJUAN XU JUNYI XU YANG ZHONG JIWEI |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20130929 Address after: 116001 No. 60 Changjiang East Road, Zhongshan District, Liaoning, Dalian Patentee after: Cao Jijuan Patentee after: Xu Junyi Patentee after: Xu Yang Patentee after: Zhong Jiwei Address before: 116001 No. 60 Changjiang East Road, Zhongshan District, Liaoning, Dalian Patentee before: Cao Jijuan Patentee before: Xu Junyi Patentee before: Xu Yang |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130626 Termination date: 20151020 |
|
| EXPY | Termination of patent right or utility model |