CN112375841A

CN112375841A - Trichoderma fungus rpb2 molecular marker gene degenerate primer group and application thereof

Info

Publication number: CN112375841A
Application number: CN202011454080.XA
Authority: CN
Inventors: 蔡枫; 伊瑞娜·杜鲁兹尼娜
Original assignee: Aoshilihua Suzhou Microbial Technology Research Institute Co ltd
Current assignee: Aoshilihua Suzhou Microbial Technology Research Institute Co ltd
Priority date: 2020-12-10
Filing date: 2020-12-10
Publication date: 2021-02-19

Abstract

The invention relates to the technical field of molecular biology, in particular to a Trichoderma fungus rpb2 molecular marker gene degenerate primer group and application thereof. The degenerate primer group disclosed by the invention is designed aiming at the conserved region of the molecular marker gene of trichoderma fungus rpb2, can be used for efficiently, accurately and specifically amplifying the effective segment of the marker gene of trichoderma fungus rpb2, greatly improves the amplification success rate and accuracy, and solves the problems of difficult amplification, non-specific amplification product and long amplification product of the existing primer designed aiming at the ascomycete. The PCR reaction system disclosed by the invention has the advantages of low template concentration requirement, low detection line, sensitive detection result and high identification success rate, and the lower detection limit is 0.032 ng/microliter of template DNA. The method for identifying the trichoderma fungus strain can be directly used for sequencing without purification after electrophoresis, and has high identification efficiency. The trichoderma fungus strain identification kit is simple in components, convenient to operate, suitable for detecting a large number of samples, good in practicability and high in economic and market values.

Description

Trichoderma fungus rpb2 molecular marker gene degenerate primer group and application thereof

Technical Field

The invention relates to the technical field of molecular biology, in particular to a Trichoderma fungus rpb2 molecular marker gene degenerate primer group and application thereof.

Background

Trichoderma spp is an important fermentation and plant beneficial strain for industrial and agricultural production, belongs to the Ascomycota (Ascomycota) Hypocrea (Hypocrea), and is a ubiquitous and easily-isolated filamentous fungus.

Trichoderma fungi are widely used in the fields of industrial enzyme preparations and biofuels due to their excellent cellulose decomposition ability; and because of the unique inhibition effect on plant pathogenic fungi and the growth promoting capability on plants, the microbial agent can be widely applied to agricultural production as a biological fertilizer or a microbial agent. At present, more than 400 Trichoderma fungi are known to be reported, but not all Trichoderma strains have industrial and agricultural development value, so that it is necessary to perform accurate strain identification on the obtained strains.

However, the existing primer of rpb2 gene, one of the main molecular markers for identifying Trichoderma fungal species, is not designed for Trichoderma fungi, and is designed for Ascomycetes (Ascomycetes) by Liu J.Yajuan, Whelen Sally, Hall D.Benjamin et al (1999) Phylogenetic relationships in evaluation of RNA polymers II Subunit. mol.biol. Evol.16(12): 1799-1808 et al (comparison document 1), therefore, when the pair of primers is applied to Trichoderma fungi, a long series of problems of difficult amplification, no bands, non-specific amplification products, amplification products and the like often occur, which greatly troubles Trichoderma species identification workers, and also seriously hinders the further development of Trichoderma fungal germplasm resources.

Since the primers used in the current application for molecular marker amplification of Trichoderma fungus rpb2 have no other relatively successful primer pairs except for the primer designed by Liu et al (reference 1), rpb2 molecular marker gene amplification has been one of the bottlenecks in the identification of Trichoderma sp.

Disclosure of Invention

The invention discloses the following technical scheme for solving the technical problems that amplification fails when degenerate primers of trichoderma rpb2 do not exist in the prior art, and sequencing fails due to the fact that a corresponding amplification product has more non-specific amplification:

the invention discloses a Trichoderma fungus rpb2 molecular marker gene conserved region comprising SEQ ID NO.1 and SEQ ID NO.2, wherein the SEQ ID NO.1 is a 5' end sequence: 5 ' -ATGCGNAGRRTGAAYACBGARYTGGCHA-3 ', and the SEQ ID NO.2 is a 3 ' terminal sequence: 5 '-ATYATYCCYTTCCCYGATCRHMACCAGGTA-3';

the term "a/T/G/C", R ═ a/G, D ═ G/a/T, Y ═ C/T, W ═ a/T, B ═ C/G/T, S ═ C/G, H ═ T/C/a, K ═ G/T, M ═ a/C.

The invention also discloses a degenerate primer group, which comprises sequences SEQ ID NO.3 and SEQ ID NO.4, wherein the SEQ ID NO.3 is a forward primer, and the nucleotide sequence is as follows: 5 '-ATGCGNAGRRTGAAYACBGA-3'; the SEQ ID NO.4 is a reverse primer, and the nucleotide sequence is as follows: 5 '-RTTRTGRTCDGGRAADGGAATR-3'; wherein, N is A/C/G/T, R is A/G, Y is C/T, B is C/G/T, and D is A/G/T, preferably, the molecular marker gene conserved region of Trichoderma fungus rpb2 described in claim 1 is amplified.

The invention also discloses a PCR reaction system, which comprises template DNA, DNA polymerase, dNTPs, the degenerate primer group and deionized water.

Optionally, the degenerate primer set primer concentration is 0.4 μ M.

Optionally, the final concentration of the template DNA is 0.032-20 ng/. mu.l.

The invention also discloses application of the degenerate primer group or the PCR reaction system in the field of identification of Trichoderma fungus strains.

The invention also discloses a trichoderma fungus strain identification method, which comprises the following steps:

s1 using the degenerate primer set as described in

claim

1 or 2 as the amplification primer or the PCR reaction system as described in any one of claims 3-5 to perform PCR amplification on the rpb2 molecular marker gene effective fragment of the target bacterial species;

s2 carrying out gel electrophoresis on the amplification product;

s3 sequencing the products after gel electrophoresis confirmation to obtain the nucleotide sequence of rpb2 molecular marker gene effective fragment, and determining the species of the target strain after comparison.

Optionally, the pre-denaturation temperature in the PCR amplification process is 94-95 ℃; the annealing temperature is 55-58 ℃ and the extension temperature is 72 ℃.

The invention also discloses a trichoderma fungus strain identification kit which comprises the degenerate primer group or the PCR reaction system.

The invention also discloses a use method of the trichoderma fungus strain identification kit, which comprises the trichoderma fungus strain identification method.

The invention discloses a technical scheme, which has the following advantages:

1. the degenerate primer group disclosed by the invention is designed aiming at the conserved region of the molecular marker gene of the trichoderma fungus rpb2, can be used for efficiently, accurately and specifically amplifying the effective fragment of the rpb2 marker gene of the trichoderma fungus, has high operability, greatly improves the amplification success rate and the amplification accuracy, reduces the number of repeated failure experiments, solves a series of problems of difficult amplification, non-specific amplification products, redundant amplification products and the like of the existing primer designed aiming at the ascomycete, abandons unnecessary redundant fragment regions in the amplification target sequence of the primer pair, obviously saves the sequencing cost in the amplification process and the subsequent sequencing cost, and breaks through the technical bottleneck of identifying the trichoderma fungus by depending on the primer designed based on the ascomycete in the prior art.

2. According to the PCR reaction system disclosed by the invention, the final concentration of the template DNA is 0.032-20 ng/mu l, an ideal Ct value is obtained at 4 ng/mu l, the template concentration requirement is low, and the DNA template is not wasted; the lower detection limit is 0.032 ng/microliter of template DNA, the detection limit is low, the detection result is sensitive, and the identification success rate is high.

3. The identification method of the trichoderma fungus strain is simple to operate, can be directly used for sequencing without purification after electrophoresis, and has high identification efficiency. The trichoderma fungus strain identification kit disclosed by the invention is simple in components, convenient to operate, suitable for detecting a large number of samples, good in practicability and high in economic and market values.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed to be used in the description of the embodiments or the prior art will be briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art according to the method disclosed in the present invention without creative efforts.

FIG. 1 is a diagram of the peak of the melting curve of the quantitative PCR described in example 1 of the present invention;

FIG. 2 is a gel electrophoresis chart of the amplification product of example 2 of the present invention.

FIG. 3 shows the result of gel electrophoresis of the primer amplification product designed in test example 1 of the present invention;

FIG. 4 is a result of gel electrophoresis of the products of the amplification using the primers shown in comparative document 1 in test example 1 of the present invention.

Detailed Description

The following examples are provided to further understand the present invention, not to limit the scope of the present invention, but to provide the best mode, not to limit the content and the protection scope of the present invention, and any product similar or similar to the present invention, which is obtained by combining the present invention with other prior art features, falls within the protection scope of the present invention.

The examples do not show the specific experimental steps or conditions, and can be performed according to the conventional experimental steps described in the literature in the field. The reagents or instruments used are not indicated by manufacturers, and are all conventional reagent products which can be obtained commercially.

Example 1

The embodiment discloses a degenerate primer group and the strain detection of Trichoderma fungi by using the degenerate primer group, which comprises the following specific steps:

primers are designed by a Primer Premier 5 software formula, experiments verify that the conserved region of the trichoderma fungus rpb2 molecular marker gene is searched again, and a degenerate Primer group is designed according to the conserved region.

The full-length sequences of the non-conserved regions of Trichoderma reesei, Trichoderma spareesei, Trichoderma longibrachiatum, Trichoderma citrinoviride, Trichoderma harzianum, Trichoderma africanum, Trichoderma longibrachiatum, Trichoderma citrinoviride, Trichoderma breviciles, Trichoderma reesei, Trichoderma pleurotrocarpus, Trichoderma simi, Trichoderma semiomonii, Trichoderma cyanophoromyces, Trichoderma koninaceum, Trichoderma ardianum, Trichoderma longibrachiatum, Trichoderma viride, Trichoderma longibrachiatum, Trichoderma strain rpb2, Trichoderma viride, Trichoderma pseudoviride, Trichoderma longibrachiatum, Trichoderma strain ID, Trichoderma strain No. SEQ ID, Trichoderma longibrachiatum, Trichoderma strain ID, Trichoderma strain No. 355, Trichoderma pseudobrachiatum, Trichoderma strain ID: 5 ' -ATGCGNAGRRTGAAYACBGARYTGGCHA-3 ', and the SEQ ID NO.2 is a 3 ' terminal sequence: 5 '-ATYATYCCYTTCCCYGATCRHMACCAGGTA-3';

(1) Degenerate primer sequences were designed as follows:

the nucleotide sequence of the forward primer is SEQ ID NO. 3: 5 '-ATGCGNAGRRTGAAYACBGA-3';

the nucleotide sequence of the reverse primer is SEQ ID NO. 4: 5 '-RTTRTGRTCDGGRAADGGAATR-3';

wherein, N is A/C/G/T, R is A/G, Y is C/T, B is C/G/T, D is A/G/T.

The nucleotide sequence is synthesized by Scenario Biotech, Inc.

(2) Template DNA from Trichoderma reesei and Trichoderma harzianum at a concentration of 400 ng/. mu.l was serially diluted 5-fold to 400 ng/. mu.l, 80 ng/. mu.l, 16 ng/. mu.l, 3.2 ng/. mu.l, 0.64 ng/. mu.l, 0.128 ng/. mu.l, 0 ng/. mu.l, respectively, and the quantitative PCR reaction set at 20. mu.l was as follows:

wherein the final concentration of the primer in the PCR reaction solution is 0.4 mu M;

SYBR premix Ex Taq was SYBR premix Ex Taq (2X, cat # RR820A) manufactured by Takara Bio-engineering (Dalian) Ltd.

(3) The quantitative PCR reaction steps were set as follows:

pre-denaturation at 95 ℃ for 30 s;

40 cycles of denaturation (denaturation at 95 ℃ for 5s, annealing at 58 ℃ for 30 s);

melting curve reaction, adopting the temperature of 55-95 ℃ and increasing 1 ℃ every 6 s.

The experiment was set up in 3 replicates and the qPCR instrument was qTower 3 from Jena.

The obtained reaction results are shown in table 1 and fig. 1.

(4) Performing gel electrophoresis on a PCR product obtained by amplification, wherein the size of the PCR product is about 900bp, and the PCR product is directly sent to a sequencing company for sequencing, and the sequencing result is as follows:

trichoderma reesei (sample No.1, SEQ ID NO.5)

TGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTCAACCGCTACACGTT TGCCTCGACCCTCTCGCATTTGCGGCGTACCAACACGCCCATCGGAAGAGATGGCAAGCTGGCGAAGC CTCGACAGCTTCACAACACCCATTGGGGTCTCGTCTGCCCGGCCGAGACACCCGAAGGACAGGCCTGT GGCCTTGTCAAGAACCTGTCTCTGATGTGTTATGTCAGTGTCGGCTCTCCGTCAGAGCCCTTGATTGA GTTTATGATCAATAGGGGCATGGAAGTGGTCGAGGAATACGAGCCACTGCGTTATCCTCACGCGACCA AGATCTTCGTCAACGGTGTCTGGGTGGGCATTCACCAGGACCCTAAGCATCTCGTCCAGCAGGTCGTG GACACTCGTCGTAAATCCTACCTGCAGTACGAGGTCTCCCTCGTCAGAGAAATTCGAGACCAAGAGTT CAAGATCTTCTCGGATGCTGGCCGTGTCATGCGACCCGTTTTTACCGTCCAGCAAGATGAAGAGTCGG ACACTGGCATTCCAAAGGGCCACTTGGTACTGACCAAAGACCTCGTTAATAAGTTGGCCCAAGAGCAG GCCGAGCCGCCAGAAGACCCAAGCATGAAGATTGGATGGGAGGGGCTCATCAGGGCTGGTGCGGTTGA GTATCTCGACGCCGAGGAAGAGGAGACGGCCATGATTTGCATGACTCCCGAGGATCTCGAGCTGTATC GTGCCCAGAAGGCAGGCATTGCCACCGAAGAGGACGTGGGCGACGATCCGAACAAGCGACTCAAG

Trichoderma harzianum (sample No.2, SEQ ID NO.6)

TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACGTT TGCTTCGACCCTATCACATTTGCGTCGTACCAATACTCCTATCGGAAGAGATGGTAAGCTCGCAAAGC CTCGACAGCTTCACAACACGCACTGGGGTTTGGTCTGCCCGGCCGAGACACCCGAGGGACAGGCTTGT GGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGA GTTCATGATCAACAGAGGTATGGAAGTCGTGGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACAA AGATTTTTGTGAACGGTGTCTGGGTTGGAGTCCACCAAGACCCTAAGCACTTGGTGAACCAGGTCCTG GACACTCGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATT CAAAATCTTTCCGACCGCAGGCCGTGTAATGCGGCCAGTCTTTACCGTTCAGCAGGAAGATGACCCGG AAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAG GCTGAACCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATTAGGGCTGGTGCGGTTGA ATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATC GTCTTCAGAAGGCTGGTATTAACACTGAGGAAGACATGGGAGATGACCCGAACAAGCGACTAAAG

The nucleotide sequence of the rpb2 molecular marker gene effective segment is obtained and used for identifying Trichoderma fungal strains, and the Trichoderma reesei obtained by identification is Trichoderma reesei, Trichoderma harzianum is Trichoderma harzianum, and the sequence is in accordance with the expectation.

(5) In addition, as shown in Table 1, DNA from Trichoderma reesei and Trichoderma harzianum amplified valid fragments at 16-400ng/ul, i.e., final concentrations of 0.8-20 ng/. mu.l, with Ct values falling between 20-30.

The lower limit of detection was 0.64 ng/. mu.l of template DNA, i.e., the final concentration of template DNA in the system in which the amplification product was detected was 0.032 ng/. mu.l.

TABLE 1 Ct readings for quantitative PCR

(6) In addition, the melting curve result in fig. 1 shows that the melting curve is a single peak, the primer has good specificity to the PCR product obtained by amplification, the product is single, and there is no non-specific amplification.

(7) The embodiment also provides a kit for rapidly detecting trichoderma strains, which comprises the PCR reaction system, wherein the PCR reaction system is operated by adopting the reaction steps in the embodiment to obtain the nucleotide sequence of the effective fragment of the rpb2 molecular marker gene of the target strain, and the nucleotide sequence is sequenced and compared to be used for identifying the trichoderma strains.

Example 2

The embodiment provides a method and a kit for detecting strains of trichoderma fungi by utilizing the degenerate primer group, which specifically comprise the following steps:

(1) taking 10 Trichoderma strains different from primer design, namely Trichoderma inhamatum, Trichoderma effusum, Trichoderma velutinum, Trichoderma strictipire, Trichoderma helicixii, Trichoderma minutissporum, Trichoderma sinense, Trichoderma flugelatum, Trichoderma alni and Trichoderma gamsii, extracting total DNA, diluting to 80 ng/mu l, and carrying out PCR amplification.

(2) The 20 μ l reaction was set up as follows: mu.l of template DNA, 10. mu.l of 2 XTolo FastPfu Premix (TOLOBIO, ref: 21802-3), 1. mu.l of forward primer, 1. mu.l of reverse primer, 7.4. mu.l of deionized water.

Wherein the final concentration of the forward primer and the reverse primer is 0.4. mu.M.

(3) The PCR reaction steps are as follows:

pre-denaturation at 94 ℃ for 5 min;

32 cycles (denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s and extension at 72 ℃ for 1 min);

final extension at 72 ℃ for 10 min.

The PCR instrument was nexus GX2 from Eppendorf.

(4) The result is shown in FIG. 2, the product is single, the band is bright, which indicates that the primer designed by the present invention can still specifically amplify the target rpb2 molecular marker gene fragment by using different DNA polymerases (i.e. Taq enzyme) and different Trichoderma strains for identification.

Wherein, M is a DNA molecular weight standard Marker;

n is negative control, and template DNA is not added;

1-10, respectively, are template DNAs from another 10 species of Trichoderma.

(5) The PCR product obtained by amplification is subjected to gel electrophoresis, the size of the PCR product is about 900bp, the gel tapping or the purification operation of the PCR product is not needed, and the PCR product is directly sent to a sequencing company for sequencing, and the sequencing result is as follows:

trichoderma inhaatum (sample No.1, SEQ ID NO.7)

TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGCGTGTCCCAGGTGCTTAACCGTTACACGTT TGCTTCGACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCAAAGC CTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGT GGTCTGGTCAAGAACTTGTCTTTAATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAACCTCTGATTGA GTTCATGATCAACAGAGGTATGGAAGTCGTTGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACAA AGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTCCTG GACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTCGTGAGAGAAATTCGAGACCAGGAATT CAAAATCTTTTCCGACGCAGGTCGTGTCATGCGACCAGTCTTTACCGTTCAGCAGGAAGATGATCCGG AAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAG GCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAGGGATTGATTAGGGCTGGTGCAGTTGA ATATCTCGACGCCGAAGAAGAGGAGACGTCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATC GTCTTCAGAAGGCCGGTATTAACACCGAGGAAGACATGGGAGATGACCCGAACAAGCGACTAAAG

< Trichoderma effusum (sample No.2, SEQ ID NO.8)

TGGGGTGATCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTCAACCGCTACACGTT TGCCTCGACCCTCTCGCATTTGCGCCGCACCAACACGCCCATTGGAAGAGATGGTAAGCTGGCGAAGC CTCGACAGCTTCACAACACGCATTGGGGCCTGGTCTGCCCGGCCGAGACCCCCGAAGGACAGGCCTGT GGTCTTGTCAAGAATCTGTCTCTGATGTGCTATGTCAGTGTCGGCTCTCCGTCAGAGCCGTTGATCGA GTTCATGATTAACAGAGGAATGGAAGTCGTCGAGGAGTACGAGCCACTGCGTTATCCTCACGCTACCA AGATCTTCGTCAACGGTGTCTGGGTGGGTATCCACCACGACCCCAAAAATCTGGTTCGACAGGTCGTG GACACTCGTCGTAAATCCTACCTCCAGTACGAAGTCTCCCTCGTCAGAGAAATTCGAGACCAGGAGTT CAAGATCTTCTCCGACGCAGGCCGCGTCATGCGACCCGTCTTCACCGTCCAGCAAGAGGAAGAGTCCG ATACTGGCATCGAAAAGGGCCACTTGGTACTGACCAAAGACCTGGTTAATCAGTTGGCCAAGGAGCAG GCCGAGCCCCCAGAAGACCCAAGCATGAAGATTGGCTGGGAAGGACTCATCAGGGCTGGTGCAGTCGA ATATCTCGACGCCGAGGAAGAGGAAACGGCCATGATTTGCATGACGCCCGAGGATCTCGACCTGTATC GTGCTCAAAAGGCAGGTCTTAATACCGAAGAGGACGTGGGCGACGATCCGAACAAGCGACTCAAG

Trichoderma velutinum (sample No.3, SEQ ID NO.9)

TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATT TGCTTCGACCCTGTCACATTTGCGTCGTACCAACACTCCCATTGGAAGAGATGGTAAGCTGGCGAAGC CTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCTGAAGGACAGGCTTGT GGTCTGGTCAAAAACTTGTCTTTGATGTGTTACGTCAGTGTCGGCTCTCCCTCCGAACCTCTGATTGA ATTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTACGTTATCCTCATGCTACAA AGATTTTTGTGAACGGTGTCTGGGTTGGAGTTCATCAAGACCCTAAGCACTTGGTGAACCAGGTTCTG GACACTCGTCGCAAGTCCTATCTGCAGTACGAAGTCTCTCTTGTGAGAGAAATTCGTGACCAGGAATT CAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTCTTTACTGTTCAGCAGGAAGATGACCCGG AAACAGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAG GCTGAACCTCCGGAAGATCCCAGCATGAAGATCGGATGGGAGGGATTAATCAGAGCCGGTGCGGTTGA ATATCTCGACGCCGAGGAAGAGGAGACGGCCATGATCTGCATGACGCCAGAGGATCTCGAGCTGTATC GTCTTCAGAAGGCCGGTATTTCTACTGATGAAGACATGGCAGATGATCCGAACAAGCGACTAAAG

Trichoderma strictitile (sample No.4, SEQ ID NO.10)

TGGGGTGATCAGAAGAAGGCCATGAGCTCGACTGCAGGTGTGTCCCAGGTGCTTAACCGCTACACGTT TGCTTCGACCCTGTCACATTTGCGTCGAACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGC CTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGT GGTCTGGTCAAAAACCTGTCGTTGATGTGTTATGTCAGTGTCGGTTCTCCCTCCGAACCCCTGATTGA GTTCATGATCAACAGAGGTATGGAAGTGGTTGAGGAGTACGAGCCGCTGCGGTATCCTCATGCTACCA AGATTTTTGTGAACGGTGTATGGGTTGGAGTTCACCAGGATCCTAAGCATCTGGTGAACCAGGTCCTG GACACTCGTCGCAAGTCTTACCTGCAGTACGAAGTCTCTCTCGTCAGAGAAATTCGAGACCAGGAATT CAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTATTTACCGTTCAGCAGGAAGATGACCCTG AAACGGGCATCAACAAGGGTCACTTGGTATTGACCAAGGAGCTCGTCAACAGACTGGCCAAGGAGCAG GCTGAACCTCCGGAAGACCCAAGCATGAAGATTGGATGGGAGGGATTGATCAGGGCTGGTGCAGTTGA ATATCTCGACGCCGAGGAAGAGGAGACGTCTATGATTTGCATGACACCAGAGGATCTCGAGCTGTATC GACTTCAGAAAGCCGGTATTTCTACCGAGGAAGACGTGGGAGATGATCCGAACAAGCGACTAAAG

Trichoderma helicixii (sample No.5, SEQ ID NO.11)

TGGGGTGATCAAAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCTCAGGTGCTTAACCGTTACACGTT TGCTTCGACCCTATCACATTTGCGTCGTACCAACACCCCCATCGGAAGAGATGGTAAGCTGGCGAAAC CTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCTTGT GGTCTGGTCAAGAATCTGTCTTTGATGTGTTACGTCAGTGTCGGTTCACCCTCCGAGCCCCTGATTGA GTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACAA AGATTTTTGTAAACGGTGTCTGGGTTGGAGTTCACCAAGACCCTAAACACCTGGTGAACCAGGTTCTG GATACTCGTCGCAAATCCTATCTGCAATACGAAGTCTCCCTTGTCAGAGAAATTCGAGACCAGGAATT CAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCTGTCTTTACCGTTCAGCAGGAAGATGATCCGG AAACAGGCATCAACAAGGGTCACTTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAG GCTGAACCTCCGGAAGACCCGAGCATGAAGATTGGATGGGAAGGATTAATCAGGGCTGGTGCGGTTGA ATATCTCGACGCTGAGGAAGAGGAGACCTCCATGATCTGCATGACGCCAGAAGATCTCGAGCTGTATC GCCTTCAGAAAGCCGGTATCTCTACCGAGGAAGATATAGGAGATGATCCGAACAAGCGACTAAAG

Trichoderma minutisporum (sample No.6, SEQ ID NO.12)

TGGGGTGATCAGAAAAAGGCAATGAGCTCGACCGCAGGTGTGTCACAGGTGCTTAACCGTTACACTTT TGCTTCGACACTGTCCCATTTGCGTCGTACCAACACACCCATCGGAAGAGATGGTAAGCTGGCGAAGC CTCGACAGCTTCACAACACACATTGGGGTTTGGTCTGCCCGGCCGAGACGCCTGAAGGACAGGCTTGT GGCCTGGTCAAAAACTTGTCTTTGATGTGCTACGTCAGTGTCGGGTCTCCCTCCGAGCCCCTGATTGA GTTTATGATCAACAGAGGTATGGAAGTCGTCGAGGAGTACGAGCCACTGCGGTATCCCCATGCCACAA AGATCTTTGTGAACGGTGTCTGGGTCGGAATTCACCAGGATCCCAAGCATCTGGTGAACCAGGTGCTG GACACTCGTCGCAAATCTTATCTACAATACGAAGTCTCTCTGATTAGAGACATTCGTGATCAGGAATT CAAAATCTTCTCTGACGCAGGTCGTGTGATGCGTCCTGTCTTTACTGTGCAGCAAGAAGATGATCCGG AAACGGGCATCAACAAGGGCCATCTGGTCTTGACCAAGGATCTCGTCAACAGACTGGCCAAGGAGCAG GCTGAGCCTCCAGAAGACCCAAGCATGAAGCTTGGATGGGAGGGATTAATTAGGGCTGGCGCGGTGGA ATATCTCGATGCCGAGGAAGAAGAGACGTCTATGATATGCATGACCCCAGAGGATCTCGAGCTTTATC GTCTTCAGAAAGCTGGCATTGCCACAGAGGAAGACATTGGAGATGATCCAAACAAGCGACTCAAG

Trichoderma sinense (sample No.7, SEQ ID NO.13)

TGGGGCGACCAGAAGAAGGCCATGAGCTCGACCGCCGGTGTGTCTCAGGTGCTCAACCGGTACACGTT TGCCTCGACGCTCTCGCATTTGCGACGCACCAACACGCCCATCGGAAGAGATGGCAAGCTGGCGAAGC CTCGACAGCTTCACAATACCCATTGGGGTCTGGTTTGCCCAGCAGAGACGCCCGAAGGACAGGCTTGT GGCCTTGTCAAGAATCTGTCTCTGATGTGCTACGTGAGTGTCGGCTCTCCGTCAGAGCCGTTGATTGA GTTCATGATCAACAGGGGCATGGAGGTGGTCGAGGAATACGAGCCACTGCGTTATCCTCACGCCACAA AGATCTTTGTCAACGGTGTCTGGGTGGGCATCCACCATGACGCAAAAACTCTGGTGTCGCAAGTTCTG GAGACTCGTCGTAAGTCGTACCTGCAGTACGAGGTCTCGCTCGTCAGAGAAATTCGAGACCAGGAATT CAAGATCTTCTCGGACGCAGGCCGCGTCATGCGACCCGTCTTCACCGTCCAGCAAGATGACAATGCCG AGAATGGCGTCGAAAAGGGCCACTTGATCTTGACGAAAGAGCTTGTTAATACACTGGCGAAGGAGCAG GTCGAGCCTCCGGAAGACCCGAGCATGAAGCTCGGCTGGGAAGGACTCATCAGGGCTGGTGCAGTTGA GTATCTCGACGCTGAAGAAGAGGAAACGGCCATGATTTGCATGACGCCCGAGGATCTCGACATCTATC GTGCTCAGAAGGCAGGTATCAACACGGATGAGGACGTGGGTGACGATCCGAACAAGCGACTCAAG

Trichoderma flagelatum (sample No.8, SEQ ID NO.14)

TGGGGCGACCAGAAGAAGGCCATGAGCTCGACCGCAGGTGTGTCTCAGGTGCTCAACCGGTACACGTT TGCCTCGACGCTCTCGCATTTGCGACGCACCAACACGCCCATCGGAAGAGATGGCAAGCTGGCGAAGC CTCGACAGCTACACAACACCCATTGGGGTCTGGTCTGCCCAGCAGAGACACCCGAAGGACAGGCTTGT GGTCTTGTCAAGAATCTGTCTCTGATGTGTTACGTCAGTGTCGGCTCTCCGTCAGAGCCGTTGATTGA GTTTATGATAAACAGGGGCATGGAGGTGGTCGAGGAATACGAGCCACTACGCTATCCGCACGCTACTA AGATCTTTGTCAACGGTGTCTGGGTGGGCATTCACCATGACGCAAAAACCCTGGTGTCGCAAGTTCTG GAGACTCGTCGTAAGTCGTACCTGCAGTACGAGGTCTCGCTCGTCAGGGAAATTCGAGACCAGGAGTT CAAGATCTTCTCGGACGCAGGCCGCGTCATGCGACCCGTCTTTACCGTCCAGCAAGAGGACAACGCCG AGAATGGCGTCGAAAAAGGCCACTTGATCCTGACCAAAGAGCTTGTTAATACACTGGCGAAGGAGCAG GCCGAGCCTCCGGAAGACCCGAGCACTAAGGTTGGCTGGGAAGGACTCATCAGGGCTGGTGCAGTTGA GTATCTCGACGCTGAAGAAGAGGAAACGGCCATGATCTGCATGACGCCTGAGGATCTCGACATCTATC GTGCTCAGAAGGCTGGTATTAACACTGATGNGTTNGTGGGTGACGATCCGAACAAACGACTCAAG

> Trichoderma alni (sample No.9, SEQ ID NO.15)

TGGGGTGATCAGAAGAAGGCCATGAGCTCAACTGCAGGTGTGTCCCAGGTGCTTAACCGTTACACATT TGCTTCGACCCTATCACATTTGCGTCGTACCAACACTCCTATCGGAAGAGATGGTAAGCTGGCGAAGC CTCGACAGCTTCACAACACGCATTGGGGTTTGGTCTGCCCAGCCGAGACACCCGAAGGACAGGCCTGT GGTCTGGTCAAGAACTTGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCTGAGCCTCTGATTGA GTTCATGATCAACAGAGGTATGGAAGTGGTCGAAGAGTACGAGCCGCTGCGGTATCCTCATGCTACCA AGATTTTTGTGAACGGTGTCTGGGTCGGAATTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCTA GACACTCGTCGCAAGTCCTATCTCCAGTACGAAGTCTCTCTCGTGAGAGAAATCCGAGACCAGGAATT CAAAATCTTTTCCGACGCAGGCCGTGTCATGCGACCAGTCTTTACCGTTCAACAGGAAGATGACCCGG AAACGGGCATCAACAAGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGGAGCAG GCCGAGCCTCCGGAAGACCCCAGCATGAAGATGGGATGGGAGGGATTGATTAGGGCTGGTGCGGTTGA ATATCTCGACGCCGAGGAAGAGGAGACGTCCATGATCTGCATGACACCAGAGGATCTCGAAATGTATC GTCTTCAGAAGGCCGGTATTAACACCGAGGAAGACATGGGAGATGATCCGAACAAGCGACTCAAG

Trichloroerma gamsii (sample No.10, SEQ ID NO.16)

TGGGGTGACCAGAAGAAGGCAATGAGCTCGACTGCGGGTGTCTCACAGGTGCTTAACCGTTACACTTT TGCTTCTACACTTTCCCATTTGCGTCGTACCAATACACCCATCGGAAGAGATGGTAAGCTGGCGAAGC CTCGACAGCTCCACAACACACACTGGGGTTTGGTGTGCCCGGCCGAGACCCCTGAAGGACAGGCTTGT GGTCTGGTCAAGAATTTGTCTCTGATGTGTTACGTCAGTGTTGGATCTCCTTCCGAGCCTTTGATTGA GTTTATGATCAACAGAGGTATGGAAGTCGTTGAGGAGTATGAGCCACTGAGGTATCCCCATGCCACAA AGATCTTTGTGAATGGTGTCTGGGTTGGAATCCATCAAGACCCAAAGCATCTGGTAAACCAAGTCTTG GATACTCGTCGCAAGTCCTATCTGCAGTACGAGGTCTCTCTGATCAGAGAAATTCGAGACCAAGAATT CAAAATCTTCTCTGATGCCGGTCGTGTTATGCGACCCGTCTTCACTGTACAGCAGGAAGATGACCCGG AAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGACCTCGTCAATAGACTGGCCAAAGAGCAG GCTGAGCCTCCAGAAGACCCAAGCATGAAGCTCGGATGGGAGGGGCTGATCAGGGCTGGTGCGGTGGA ATATCTCGACGCCGAGGAGGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTATC GTCTTCAAAAGGCCGGCATTGCCACGGATGAAGACATAGGAGATGACCCAAATAAGCGTCTCAAG obtaining the nucleotide sequence of rpb2 molecular marker gene effective fragment: the 4 th to 5 th intron regions are used for identifying Trichoderma fungal strains, and the 10 samples obtained by identification belong to Trichoderma inhamatum, Trichoderma eferusum, Trichoderma velutinum, Trichoderma strictipire, Trichoderma helicium, Trichoderma ministerisporum, Trichoderma silicon, Trichoderma orientale, Trichoderma alni and Trichoderma gamsii respectively, which are consistent with the expectation.

(6) The embodiment also provides a kit for rapidly detecting trichoderma strains, which comprises the PCR reaction system, wherein the nucleotide sequence of the rpb2 molecular marker gene effective fragment of the target strain is obtained by adopting the reaction steps in the embodiment, and is used for identifying the trichoderma strains through sequencing and comparison.

Test example 1

The experimental example was used to determine the specificity of the degenerate primer set as follows:

(1) 10 strains of Trichoderma, i.e., Trichoderma reesei, Trichoderma longibrachiatum, Trichoderma harzianum, Trichoderma africanum, Trichoderma guiguyense, Trichoderma virens, Trichoderma pleuroticola, Trichoderma atrovirride, Trichoderma asperellum, and Trichoderma asperelles, which were derived from the primer design, were extracted for total DNA, diluted to 80 ng/. mu.l, and subjected to PCR amplification.

(2) Set up 25 μ l system as follows: mu.l of template DNA, 12.5. mu.l of 2 XPhanta Max Master Mix (Novovazan, ref: P515), 1. mu.l of forward primer, 1. mu.l of reverse primer, 9.5. mu.l of deionized water.

The final concentration of the forward and reverse primers in the system was 0.4. mu.M.

(3) The reaction steps are as follows:

pre-denaturation at 95 ℃ for 3 min;

32 cycles (denaturation at 95 ℃ for 15s, annealing at 55 ℃ for 15s, and extension at 72 ℃ for 1 min);

final extension at 72 ℃ for 5 min.

The PCR reaction product is subjected to gel electrophoresis, the result is shown in figure 3, the product is single, the strip is bright, and the degenerate primer designed by the invention can specifically amplify the nucleotide sequence of the effective fragment of the molecular marker gene of the target strain rpb 2;

wherein M in the figure is a DNA molecular weight standard Marker;

n is negative control, and template DNA is not added;

1-10, respectively, template DNAs from 10 Trichoderma reesei, Trichoderma longibrachiatum, Trichoderma harzianum, Trichoderma africanum, Trichoderma guizhuense, Trichoderma virgines, Trichoderma pleuroticola, Trichoderma atroviride, Trichoderma asperellum, and Trichoderma asperelles, when primers were designed, and the subsequent sequencing results for the 10 samples were consistent with expectations, all correct.

(4) The amplification was carried out in the manner described in this example using the primer set of comparative document 1 (upstream primer fRPB2-5f:5 '-GAYGAYMGWGATCAYTTYGG-3' and downstream primer fRPB2-7cr:5 '-CCCATRGCTTGTYYRCCCAT-3') in place of the degenerate primer set of this example, and the results are shown in FIG. 4;

wherein M in the figure is a DNA molecular weight standard Marker;

n is negative control, and template DNA is not added;

1-10, template DNAs from 10 Trichoderma reesei, Trichoderma longibrachiatum, Trichoderma harzianum, Trichoderma africanum, Trichoderma guidizuense, Trichoderma virgines, Trichoderma pleuroticola, Trichoderma atroviride, Trichoderma asperellum, and Trichoderma asperelles, respectively, when designing primers.

(5) The PCR product obtained by amplification is subjected to gel electrophoresis, the size of the PCR product is about 1100bp, the product is not single, the band is disordered, the amplification effect is poor, wherein the sequencing of samples No.4, 5, 6, 7, 8 and 10 fails, only the sequencing of samples No.1, 2, 3 and 9 succeeds, and the sequencing success rate is far different from that of the primer pair designed by the invention.

Therefore, the primers disclosed in the application have a significantly superior technical effect compared with the comparison documents.

It is to be understood that the above examples are illustrative only for the purpose of clarity of description and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications of the invention may be made without departing from the spirit or scope of the invention.

Sequence listing

<110> Applicant

<120> Trichoderma fungus rpb2 molecular marker gene degenerate primer group and application thereof

<130> 2

<141> 2020-12-10

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 28

<212> DNA

<213> Artificial sequence (Artificial sequence)

<220>

<221> misc_feature

<222> (6)..(6)

<223> n is a, c, g, or t

<400> 1

atgcgnagrr tgaayacbga rytggcha 28

<210> 2

<211> 30

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 2

atyatyccyt tcccygatcr hmaccaggta 30

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<220>

<221> misc_feature

<222> (6)..(6)

<223> n is a, c, g, or t

<400> 3

atgcgnagrr tgaayacbga 20

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

rttrtgrtcd ggraadggaa tr 22

<210> 5

<211> 813

<212> DNA

<213> Trichoderma reesei (Trichoderma reesei)

<400> 5

tggggtgatc agaagaaggc catgagctcg accgcaggtg tgtctcaggt gctcaaccgc 60

tacacgtttg cctcgaccct ctcgcatttg cggcgtacca acacgcccat cggaagagat 120

ggcaagctgg cgaagcctcg acagcttcac aacacccatt ggggtctcgt ctgcccggcc 180

gagacacccg aaggacaggc ctgtggcctt gtcaagaacc tgtctctgat gtgttatgtc 240

agtgtcggct ctccgtcaga gcccttgatt gagtttatga tcaatagggg catggaagtg 300

gtcgaggaat acgagccact gcgttatcct cacgcgacca agatcttcgt caacggtgtc 360

tgggtgggca ttcaccagga ccctaagcat ctcgtccagc aggtcgtgga cactcgtcgt 420

aaatcctacc tgcagtacga ggtctccctc gtcagagaaa ttcgagacca agagttcaag 480

atcttctcgg atgctggccg tgtcatgcga cccgttttta ccgtccagca agatgaagag 540

tcggacactg gcattccaaa gggccacttg gtactgacca aagacctcgt taataagttg 600

gcccaagagc aggccgagcc gccagaagac ccaagcatga agattggatg ggaggggctc 660

atcagggctg gtgcggttga gtatctcgac gccgaggaag aggagacggc catgatttgc 720

atgactcccg aggatctcga gctgtatcgt gcccagaagg caggcattgc caccgaagag 780

gacgtgggcg acgatccgaa caagcgactc aag 813

<210> 6

<211> 813

<212> DNA

<213> Trichoderma harzianum (Trichoderma harzianum)

<400> 6

tggggtgatc agaagaaggc catgagctca actgcaggtg tgtcccaggt gcttaaccgt 60

tacacgtttg cttcgaccct atcacatttg cgtcgtacca atactcctat cggaagagat 120

ggtaagctcg caaagcctcg acagcttcac aacacgcact ggggtttggt ctgcccggcc 180

gagacacccg agggacaggc ttgtggtctg gtcaagaact tgtctttgat gtgttacgtc 240

agtgtcggtt ctccctccga acctctgatt gagttcatga tcaacagagg tatggaagtc 300

gtggaagagt acgagccgct gcggtatcct catgctacaa agatttttgt gaacggtgtc 360

tgggttggag tccaccaaga ccctaagcac ttggtgaacc aggtcctgga cactcgtcgc 420

aagtcctatc tgcaatacga agtctctctc gtgagagaaa ttcgagacca ggaattcaaa 480

atctttccga ccgcaggccg tgtaatgcgg ccagtcttta ccgttcagca ggaagatgac 540

ccggaaacgg gcatcaacaa gggccacctg gtattgacca aggagctcgt caatagattg 600

gccaaggagc aggctgaacc tccggaagac cccagcatga agattggatg ggagggattg 660

attagggctg gtgcggttga atatctcgac gccgaggaag aggagacgtc catgatctgc 720

atgacgccag aggatctcga gctgtatcgt cttcagaagg ctggtattaa cactgaggaa 780

gacatgggag atgacccgaa caagcgacta aag 813

<210> 7

<211> 813

<212> DNA

<213> Trichoderma inhaatum (Trichoderma inhaatum)

<400> 7

tggggtgatc agaagaaggc catgagctca actgcaggcg tgtcccaggt gcttaaccgt 60

tacacgtttg cttcgaccct atcacatttg cgtcgtacca acactcctat cggaagagat 120

ggtaagctgg caaagcctcg acagcttcac aacacgcatt ggggtttggt ctgcccagcc 180

gagacacccg aaggacaggc ctgtggtctg gtcaagaact tgtctttaat gtgttacgtc 240

agtgtcggtt ctccctccga acctctgatt gagttcatga tcaacagagg tatggaagtc 300

gttgaagagt acgagccgct gcggtatcct catgctacaa agatttttgt gaacggtgtc 360

tgggttggag ttcaccaaga ccctaagcac ttggtgaacc aggtcctgga cactcgtcgc 420

aagtcctatc tgcagtacga agtctctctc gtgagagaaa ttcgagacca ggaattcaaa 480

atcttttccg acgcaggtcg tgtcatgcga ccagtcttta ccgttcagca ggaagatgat 540

ccggaaacgg gcatcaacaa gggccacctg gtattgacca aggagctcgt caatagattg 600

gccaaggagc aggctgagcc tccggaagac cccagcatga agattggatg ggagggattg 660

attagggctg gtgcagttga atatctcgac gccgaagaag aggagacgtc catgatctgc 720

atgacgccag aggatctcga gctgtatcgt cttcagaagg ccggtattaa caccgaggaa 780

gacatgggag atgacccgaa caagcgacta aag 813

<210> 8

<211> 813

<212> DNA

<213> Trichoderma effusum (Trichoderma effusum)

<400> 8

tggggtgatc agaagaaggc catgagctcg accgcaggtg tgtctcaggt gctcaaccgc 60

tacacgtttg cctcgaccct ctcgcatttg cgccgcacca acacgcccat tggaagagat 120

ggtaagctgg cgaagcctcg acagcttcac aacacgcatt ggggcctggt ctgcccggcc 180

gagacccccg aaggacaggc ctgtggtctt gtcaagaatc tgtctctgat gtgctatgtc 240

agtgtcggct ctccgtcaga gccgttgatc gagttcatga ttaacagagg aatggaagtc 300

gtcgaggagt acgagccact gcgttatcct cacgctacca agatcttcgt caacggtgtc 360

tgggtgggta tccaccacga ccccaaaaat ctggttcgac aggtcgtgga cactcgtcgt 420

aaatcctacc tccagtacga agtctccctc gtcagagaaa ttcgagacca ggagttcaag 480

atcttctccg acgcaggccg cgtcatgcga cccgtcttca ccgtccagca agaggaagag 540

tccgatactg gcatcgaaaa gggccacttg gtactgacca aagacctggt taatcagttg 600

gccaaggagc aggccgagcc cccagaagac ccaagcatga agattggctg ggaaggactc 660

atcagggctg gtgcagtcga atatctcgac gccgaggaag aggaaacggc catgatttgc 720

atgacgcccg aggatctcga cctgtatcgt gctcaaaagg caggtcttaa taccgaagag 780

gacgtgggcg acgatccgaa caagcgactc aag 813

<210> 9

<211> 813

<212> DNA

<213> Trichoderma velutinum (Trichoderma velutinum)

<400> 9

tggggtgatc agaagaaggc catgagctca actgcaggtg tgtcccaggt gcttaaccgt 60

tacacatttg cttcgaccct gtcacatttg cgtcgtacca acactcccat tggaagagat 120

ggtaagctgg cgaagcctcg acagcttcac aacacgcatt ggggtttggt ctgcccagcc 180

gagacacctg aaggacaggc ttgtggtctg gtcaaaaact tgtctttgat gtgttacgtc 240

agtgtcggct ctccctccga acctctgatt gaattcatga tcaacagagg tatggaagtc 300

gtcgaagagt acgagccgct acgttatcct catgctacaa agatttttgt gaacggtgtc 360

tgggttggag ttcatcaaga ccctaagcac ttggtgaacc aggttctgga cactcgtcgc 420

aagtcctatc tgcagtacga agtctctctt gtgagagaaa ttcgtgacca ggaattcaaa 480

atcttttccg acgcaggccg tgtcatgcga cctgtcttta ctgttcagca ggaagatgac 540

ccggaaacag gcatcaacaa gggccacctg gtattgacca aggagctcgt caatagattg 600

gccaaggagc aggctgaacc tccggaagat cccagcatga agatcggatg ggagggatta 660

atcagagccg gtgcggttga atatctcgac gccgaggaag aggagacggc catgatctgc 720

atgacgccag aggatctcga gctgtatcgt cttcagaagg ccggtatttc tactgatgaa 780

gacatggcag atgatccgaa caagcgacta aag 813

<210> 10

<211> 813

<212> DNA

<213> Trichoderma strictipile (Trichoderma strictipile)

<400> 10

tggggtgatc agaagaaggc catgagctcg actgcaggtg tgtcccaggt gcttaaccgc 60

tacacgtttg cttcgaccct gtcacatttg cgtcgaacca acacacccat cggaagagat 120

ggtaagctgg cgaagcctcg acagcttcac aacacgcatt ggggtttggt ctgcccagcc 180

gagacacccg aaggacaggc ttgtggtctg gtcaaaaacc tgtcgttgat gtgttatgtc 240

agtgtcggtt ctccctccga acccctgatt gagttcatga tcaacagagg tatggaagtg 300

gttgaggagt acgagccgct gcggtatcct catgctacca agatttttgt gaacggtgta 360

tgggttggag ttcaccagga tcctaagcat ctggtgaacc aggtcctgga cactcgtcgc 420

aagtcttacc tgcagtacga agtctctctc gtcagagaaa ttcgagacca ggaattcaaa 480

atcttttccg acgcaggccg tgtcatgcga cctgtattta ccgttcagca ggaagatgac 540

cctgaaacgg gcatcaacaa gggtcacttg gtattgacca aggagctcgt caacagactg 600

gccaaggagc aggctgaacc tccggaagac ccaagcatga agattggatg ggagggattg 660

atcagggctg gtgcagttga atatctcgac gccgaggaag aggagacgtc tatgatttgc 720

atgacaccag aggatctcga gctgtatcga cttcagaaag ccggtatttc taccgaggaa 780

gacgtgggag atgatccgaa caagcgacta aag 813

<210> 11

<211> 813

<212> DNA

<213> Trichoderma helicixii (Trichoderma helicixii)

<400> 11

tggggtgatc aaaagaaggc catgagctca actgcaggtg tgtctcaggt gcttaaccgt 60

tacacgtttg cttcgaccct atcacatttg cgtcgtacca acacccccat cggaagagat 120

ggtaagctgg cgaaacctcg acagcttcac aacacgcatt ggggtttggt ctgcccagcc 180

gagacacccg aaggacaggc ttgtggtctg gtcaagaatc tgtctttgat gtgttacgtc 240

agtgtcggtt caccctccga gcccctgatt gagttcatga tcaacagagg tatggaagtc 300

gtcgaagagt acgagccgct gcggtatcct catgctacaa agatttttgt aaacggtgtc 360

tgggttggag ttcaccaaga ccctaaacac ctggtgaacc aggttctgga tactcgtcgc 420

aaatcctatc tgcaatacga agtctccctt gtcagagaaa ttcgagacca ggaattcaaa 480

atcttttccg acgcaggccg tgtcatgcga cctgtcttta ccgttcagca ggaagatgat 540

ccggaaacag gcatcaacaa gggtcacttg gtattgacca aggagctcgt caatagattg 600

gccaaggagc aggctgaacc tccggaagac ccgagcatga agattggatg ggaaggatta 660

atcagggctg gtgcggttga atatctcgac gctgaggaag aggagacctc catgatctgc 720

atgacgccag aagatctcga gctgtatcgc cttcagaaag ccggtatctc taccgaggaa 780

gatataggag atgatccgaa caagcgacta aag 813

<210> 12

<211> 813

<212> DNA

<213> Trichoderma minutisporum (Trichoderma minutisporum)

<400> 12

tggggtgatc agaaaaaggc aatgagctcg accgcaggtg tgtcacaggt gcttaaccgt 60

tacacttttg cttcgacact gtcccatttg cgtcgtacca acacacccat cggaagagat 120

ggtaagctgg cgaagcctcg acagcttcac aacacacatt ggggtttggt ctgcccggcc 180

gagacgcctg aaggacaggc ttgtggcctg gtcaaaaact tgtctttgat gtgctacgtc 240

agtgtcgggt ctccctccga gcccctgatt gagtttatga tcaacagagg tatggaagtc 300

gtcgaggagt acgagccact gcggtatccc catgccacaa agatctttgt gaacggtgtc 360

tgggtcggaa ttcaccagga tcccaagcat ctggtgaacc aggtgctgga cactcgtcgc 420

aaatcttatc tacaatacga agtctctctg attagagaca ttcgtgatca ggaattcaaa 480

atcttctctg acgcaggtcg tgtgatgcgt cctgtcttta ctgtgcagca agaagatgat 540

ccggaaacgg gcatcaacaa gggccatctg gtcttgacca aggatctcgt caacagactg 600

gccaaggagc aggctgagcc tccagaagac ccaagcatga agcttggatg ggagggatta 660

attagggctg gcgcggtgga atatctcgat gccgaggaag aagagacgtc tatgatatgc 720

atgaccccag aggatctcga gctttatcgt cttcagaaag ctggcattgc cacagaggaa 780

gacattggag atgatccaaa caagcgactc aag 813

<210> 13

<211> 813

<212> DNA

<213> Trichoderma sinense (Trichoderma sinense)

<400> 13

tggggcgacc agaagaaggc catgagctcg accgccggtg tgtctcaggt gctcaaccgg 60

tacacgtttg cctcgacgct ctcgcatttg cgacgcacca acacgcccat cggaagagat 120

ggcaagctgg cgaagcctcg acagcttcac aatacccatt ggggtctggt ttgcccagca 180

gagacgcccg aaggacaggc ttgtggcctt gtcaagaatc tgtctctgat gtgctacgtg 240

agtgtcggct ctccgtcaga gccgttgatt gagttcatga tcaacagggg catggaggtg 300

gtcgaggaat acgagccact gcgttatcct cacgccacaa agatctttgt caacggtgtc 360

tgggtgggca tccaccatga cgcaaaaact ctggtgtcgc aagttctgga gactcgtcgt 420

aagtcgtacc tgcagtacga ggtctcgctc gtcagagaaa ttcgagacca ggaattcaag 480

atcttctcgg acgcaggccg cgtcatgcga cccgtcttca ccgtccagca agatgacaat 540

gccgagaatg gcgtcgaaaa gggccacttg atcttgacga aagagcttgt taatacactg 600

gcgaaggagc aggtcgagcc tccggaagac ccgagcatga agctcggctg ggaaggactc 660

atcagggctg gtgcagttga gtatctcgac gctgaagaag aggaaacggc catgatttgc 720

atgacgcccg aggatctcga catctatcgt gctcagaagg caggtatcaa cacggatgag 780

gacgtgggtg acgatccgaa caagcgactc aag 813

<210> 14

<211> 813

<212> DNA

<213> Trichoderma flagelatum (Trichoderma flagelatum)

<220>

<221> misc_feature

<222> (779)..(779)

<223> n is a, c, g, or t

<220>

<221> misc_feature

<222> (783)..(783)

<223> n is a, c, g, or t

<400> 14

tggggcgacc agaagaaggc catgagctcg accgcaggtg tgtctcaggt gctcaaccgg 60

tacacgtttg cctcgacgct ctcgcatttg cgacgcacca acacgcccat cggaagagat 120

ggcaagctgg cgaagcctcg acagctacac aacacccatt ggggtctggt ctgcccagca 180

gagacacccg aaggacaggc ttgtggtctt gtcaagaatc tgtctctgat gtgttacgtc 240

agtgtcggct ctccgtcaga gccgttgatt gagtttatga taaacagggg catggaggtg 300

gtcgaggaat acgagccact acgctatccg cacgctacta agatctttgt caacggtgtc 360

tgggtgggca ttcaccatga cgcaaaaacc ctggtgtcgc aagttctgga gactcgtcgt 420

aagtcgtacc tgcagtacga ggtctcgctc gtcagggaaa ttcgagacca ggagttcaag 480

atcttctcgg acgcaggccg cgtcatgcga cccgtcttta ccgtccagca agaggacaac 540

gccgagaatg gcgtcgaaaa aggccacttg atcctgacca aagagcttgt taatacactg 600

gcgaaggagc aggccgagcc tccggaagac ccgagcacta aggttggctg ggaaggactc 660

atcagggctg gtgcagttga gtatctcgac gctgaagaag aggaaacggc catgatctgc 720

atgacgcctg aggatctcga catctatcgt gctcagaagg ctggtattaa cactgatgng 780

ttngtgggtg acgatccgaa caaacgactc aag 813

<210> 15

<211> 813

<212> DNA

<213> Trichoderma Nickel alloy steel (Trichoderma alni)

<400> 15

tggggtgatc agaagaaggc catgagctca actgcaggtg tgtcccaggt gcttaaccgt 60

tacacatttg cttcgaccct atcacatttg cgtcgtacca acactcctat cggaagagat 120

ggtaagctgg cgaagcctcg acagcttcac aacacgcatt ggggtttggt ctgcccagcc 180

gagacacccg aaggacaggc ctgtggtctg gtcaagaact tgtctttgat gtgttacgtc 240

agtgtcggtt ctccctctga gcctctgatt gagttcatga tcaacagagg tatggaagtg 300

gtcgaagagt acgagccgct gcggtatcct catgctacca agatttttgt gaacggtgtc 360

tgggtcggaa ttcaccaaga ccctaagcac ttggtgaacc aggttctaga cactcgtcgc 420

aagtcctatc tccagtacga agtctctctc gtgagagaaa tccgagacca ggaattcaaa 480

atcttttccg acgcaggccg tgtcatgcga ccagtcttta ccgttcaaca ggaagatgac 540

ccggaaacgg gcatcaacaa gggccacctg gtattgacca aggagctcgt caatagattg 600

gccaaggagc aggccgagcc tccggaagac cccagcatga agatgggatg ggagggattg 660

attagggctg gtgcggttga atatctcgac gccgaggaag aggagacgtc catgatctgc 720

atgacaccag aggatctcga aatgtatcgt cttcagaagg ccggtattaa caccgaggaa 780

gacatgggag atgatccgaa caagcgactc aag 813

<210> 16

<211> 813

<212> DNA

<213> Trichoderma gamsii (Trichoderma gamsii)

<400> 16

tggggtgacc agaagaaggc aatgagctcg actgcgggtg tctcacaggt gcttaaccgt 60

tacacttttg cttctacact ttcccatttg cgtcgtacca atacacccat cggaagagat 120

ggtaagctgg cgaagcctcg acagctccac aacacacact ggggtttggt gtgcccggcc 180

gagacccctg aaggacaggc ttgtggtctg gtcaagaatt tgtctctgat gtgttacgtc 240

agtgttggat ctccttccga gcctttgatt gagtttatga tcaacagagg tatggaagtc 300

gttgaggagt atgagccact gaggtatccc catgccacaa agatctttgt gaatggtgtc 360

tgggttggaa tccatcaaga cccaaagcat ctggtaaacc aagtcttgga tactcgtcgc 420

aagtcctatc tgcagtacga ggtctctctg atcagagaaa ttcgagacca agaattcaaa 480

atcttctctg atgccggtcg tgttatgcga cccgtcttca ctgtacagca ggaagatgac 540

ccggaaacgg gtatcaacaa gggccacctg gttttgacca aggacctcgt caatagactg 600

gccaaagagc aggctgagcc tccagaagac ccaagcatga agctcggatg ggaggggctg 660

atcagggctg gtgcggtgga atatctcgac gccgaggagg aagaaacgtc catgatttgc 720

atgacaccgg aagatcttga gctttatcgt cttcaaaagg ccggcattgc cacggatgaa 780

gacataggag atgacccaaa taagcgtctc aag 813

Claims

1. A trichoderma fungus rpb2 molecular marker gene conserved region is characterized by comprising SEQ ID NO.1 and SEQ ID NO.2, wherein the SEQ ID NO.1 is a 5' end sequence: 5 ' -ATGCGNAGRRTGAAYACBGARYTGGCHA-3 ', and the SEQ ID NO.2 is a 3 ' terminal sequence: 5 '-ATYATYCCYTTCCCYGATCRHMACCAGGTA-3';

2. A degenerate primer set is characterized by comprising sequences SEQ ID NO.3 and SEQ ID NO.4, wherein the SEQ ID NO.3 is a forward primer, and the nucleotide sequence is as follows: 5 '-ATGCGNAGRRTGAAYACBGA-3'; the SEQ ID NO.4 is a reverse primer, and the nucleotide sequence is as follows: 5 '-RTTRTGRTCDGGRAADGGAATR-3'; wherein, N is A/C/G/T, R is A/G, Y is C/T, B is C/G/T, and D is A/G/T, preferably, the molecular marker gene conserved region of Trichoderma fungus rpb2 described in claim 1 is amplified.

3. A PCR reaction system, comprising: template DNA, DNA polymerase, dNTPs, the degenerate primer set of claim 2, and deionized water.

4. The PCR system of claim 3, wherein the degenerate primer set primer is present at a final concentration of 0.4. mu.M.

5. The PCR reaction system according to claim 3 or 4, wherein the final concentration of the template DNA is 0.032-20 ng/. mu.l.

6. Use of a degenerate primer set according to claim 2 or a PCR reaction system according to any one of claims 3 to 5 in the field of identification of a trichoderma fungal species.

7. A method for identifying Trichoderma fungus strain is characterized by comprising the following steps:

s1 using the degenerate primer set as described in claim 2 as the amplification primer or the PCR system as described in any one of claims 3-5 to perform PCR amplification of rpb2 molecular marker gene effective fragment of the target bacterial species;

s2 carrying out gel electrophoresis on the amplification product;

8. The method of identifying a Trichoderma fungal species of claim 7 wherein the pre-denaturation temperature during PCR amplification is 94-95 ℃; the annealing temperature is 55-58 ℃ and the extension temperature is 72 ℃.

9. A kit for identifying Trichoderma fungal species, comprising the degenerate primer set of claim 2 or the PCR reaction system of any one of claims 3 to 5.

10. A method of using the trichoderma fungus strain identification kit of claim 9, comprising the method of identifying a trichoderma fungus strain of claim 7 or 8.