CN102337292B - System for deleting antibiotic marker gene from transgenic plant and application of system - Google Patents
System for deleting antibiotic marker gene from transgenic plant and application of system Download PDFInfo
- Publication number
- CN102337292B CN102337292B CN 201110295586 CN201110295586A CN102337292B CN 102337292 B CN102337292 B CN 102337292B CN 201110295586 CN201110295586 CN 201110295586 CN 201110295586 A CN201110295586 A CN 201110295586A CN 102337292 B CN102337292 B CN 102337292B
- Authority
- CN
- China
- Prior art keywords
- gene
- sequence
- plant
- marker gene
- expression cassette
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a system for deleting an antibiotic marker gene from a transgenic plant and application of the system. The system for deleting the antibiotic marker gene from the transgenic plant disclosed by the invention is formed by separately packaging two plant expression vectors which respectively contain the antibiotic marker gene and a Cre (Course Recombination Enzyme) enzyme gene. The plant expression vector containing the antibiotic marker gene has two equidirectional loxP (Locus of X-over P1) sites, and the antibiotic marker gene and a visual marker gene expression cassette are between the two loxP sites. Transgenic plant offsprings of the two plant expression vectors are hybridized, and the antibiotic marker gene can be deleted from a hybrid offspring, which provides guarantee for food security and is of significance to transgenic research. In addition, with a visual marker gene, the transgenic effect and the deletion effect can be judged only from the color of the transgenic plant and the fruit skin of a seed coat, therefore the system for deleting the antibiotic marker gene from the transgenic plant is a breakthrough in the field of transgenic research, the cost of molecular detection is greatly reduced, and the system is of significance to successive breeding.
Description
Technical field
The present invention relates to delete system and the application thereof of antibiotic marker gene from transgenic plant.
Background technology
Since transgenic technology was born, what people worried most in the transgenic product was safety issue, in the transgenic product with some selectable marker genes may have potential risks to human health, natural species and environment.Therefore, the safety issue of transgenic plant comes into one's own day by day, and become and affected the Main Bottleneck (reference: Hare P D that the transgenic plant industry develops in a healthy way, Chua N H.Excision of selectable marker genes from transgenic plants.Nature Biotechnology, 2002,20:575-580.).And wherein the most important thing is the antibiotics resistance gene problem.Antibiotics resistance gene in the genetically modified food may be by the transfection intestinal bacteria, human these microbiotic is produced resistance, namely resistance and make.Food and Argriculture OrganizationFAO and the World Health Organization united promulgation in 2003 transgenic plant food risk assessment criterion explicitly points out: " antibiotic resistance gene that the microbiotic of using is clinically had resistance should not occur in food ".Kalamycin resistance gene has resistance to kantlex, is classified as second level by the World Health Organization, is important class microbiotic, means that this antibiotics resistance gene should not occur in food.Therefore the deletion of antibiotics resistance gene is significant.
The Cre/loxP recombination system is because special, efficiently, the effect specificity is strong, thereby do not affect normal expression and the regulation and control of gene, in transgenic research, be widely used (reference: Ballester A, Cervera M, Pena L.Efficient production of transgenic citrus plants using isopentenyl transferase positive selection and removal of the marker gene by site-specific recombination.Plant Cell Reports, 2006,26:39-45. and Cao M X, Huang J Q, Yao Q H, Liu S J, Wang C L, Wei Z M.Site-specific DNA excision in transgenic rice with a cell-permeable Cre recombinase.Molecular Biotechnology, 2006,32:55-63. and Chakraborti D, Sarkar A, Mondal HA, Schuermann D, Hohn B, Sarmah BK, Das S (2008) Cre/lox system to develop selectable marker free transgenic tobacco plants conferring resistance against sap sucking homopteran insect.Plant Cell Rep 27:1623-1633. and Cuellar W, Gaudin A, Solorzano D, Casas A, Nopo L, Chudalayandi P, Medrano G, Kreuze J, Ghislain M.Self-excision of the antibiotic resistance gene nptII using a heat inducible Cre-loxP system from transgenic potato.Plant Molecular Biology, 2006,62:71-82.).Cre (causes recombination) recombinase is the class of enzymes that origin comes from the cre coded by said gene of P1 phage, belong to Int family, identification specific target site (loxP site) and catalysis are at this site fracture and restructuring (reference: Stembergn, Sauer B, Hoess R, et al.Bacteriophage P 1cre geneand its regulatory region evidence formultiple promoters and for regulation by DNA methylation[J] .Journal of Molecular Biology, 1986,187:197-121.).The loxP site is that a segment length is the dna sequence dna of 34bp, it is the specific recognition site of Cre recombinase, has typical palindrome, formed by the inverted repeats of two 13bp and the asymmetric transcribed spacer of middle 8bp, the transcribed spacer of 8bp is responsible for the orientation (reference: Ronald H H in site, Marcia Z, Nat S.P1 site2specific recombination:nucleotide sequence of recombining sites[J] .Proc NatlAcad Sci, USA, 1982,79:3398-3402.).When 2 in the same way loxP sites are arranged on the same dna molecular, the rejecting of gene between two loxP sites of Cre recombinase catalysis, only stay 1 loxP site, restructuring occurs in (reference: Hoess R H in the marker space of 8bp, Abremski K.Interaction of the bacteriophage P1 recombinase Cre with the recombining site loxP.Proceedings of the National Academy of Sciences of the United States of America, 1984,81:1026-1029.).The restriction of fragment length and position is not excised in the DNA restructuring of Cre recombinase-mediated, as long as target gene just can be carried out the DNA restructuring exactly by 2 recognition site marks.
Summary of the invention
The purpose of this invention is to provide system and the application thereof of deleting antibiotic marker gene from transgenic plant.
The system of deletion antibiotic marker gene from transgenic plant provided by the present invention forms by the plant expression vector that contains the antibiotic marker gene that is used for insertion external source target DNA expression cassette with for the plant expression vector that contains Cre enzyme gene of deleting described antibiotic marker gene.
The described plant expression vector that contains the antibiotic marker gene is circular vectors, contain two in the same way loxP sites, the expression cassette of antibiotic marker gene, the expression cassette of visual marker gene, the screening transgenic plants needs the expression cassette of marker gene, and inserts the multiple clone site of external source target DNA; Described two loxP sites in the same way are divided into two sections with the described plant expression vector that contains the antibiotic marker gene, one section expression cassette that contains coding described antibiotic marker gene and described visual marker gene wherein, another section contains the expression cassette that described screening transgenic plants needs marker gene, and the multiple clone site of described insertion external source target DNA.
The plant expression vector of the described Cre of containing enzyme gene is circular vectors, this circular vectors contains two loxP sites in the same way, controllable initiating, by the Cre enzyme gene of described controllable initiating startup, the expression cassette of antibiotic marker gene, the expression cassette of visual marker gene, and the screening transgenic plants needs the expression cassette of marker gene; Described two loxP sites in the same way are divided into two sections with the plant expression vector of the described Cre of containing enzyme gene, wherein one section contains the described antibiotic gene of coding, controllable initiating and the Cre enzyme gene that is started by described controllable initiating, another section contains the expression cassette that described screening transgenic plants needs marker gene, and the expression cassette of described visual marker gene.
Described expression cassette all refers to the dna molecular that contains goal gene and express the required element of this goal gene.
The expression cassette of described antibiotic marker gene is a dna molecular that contains antibiotic marker gene and the required element of this antibiotic marker genetic expression, contains successively following fragment from the upstream to the downstream: promotor, SD sequence, started encoding sequence and the terminator (transcription termination sequence) of the described antibiotic marker gene of transcribing by described promotor.In an embodiment of the present invention, described antibiotic resistance gene expression cassette is specially kantlex (Kan) expression casette; Described Kan expression casette is a dna molecular that contains Kan gene and the required element of Kan genetic expression, contains successively following fragment from the upstream to the downstream: the Kan gene and the terminator (transcription termination sequence) that contain the prokaryotic promoter that starts the Kan gene (sequence 7 the 2630th to the 2492nd), SD sequence, started by this promotor.
The expression cassette of described visual marker gene is a dna molecular that contains visual marker gene and the required element of visual marker genetic expression, contains successively following fragment from the upstream to the downstream: promotor, started encoding sequence and the terminator (transcription termination sequence) of the described visual marker gene of transcribing by described promotor.In an embodiment of the present invention, described visual marker expression casette specifically is comprised of cl expression casette in the transcription factor bi expression casette in the anthocyanidin gene route of synthesis and the anthocyanidin gene route of synthesis.Wherein, the expression cassette of bi gene is a dna molecular that contains bi gene and the required element of bi genetic expression, contains successively following fragment from the upstream to the downstream: promotor, the bi gene and the no terminator (transcription termination sequence) that are started by this promotor; The expression cassette of cl gene is a dna molecular that contains cl gene and the required element of cl genetic expression, contains successively following fragment from the upstream to the downstream: promotor, the cl gene and the no terminator (transcription termination sequence) that are started by this promotor.Its expression product anthocyanidin can be used as the plant transgene success or not and identifies the visual marker whether transgenic plant successfully delete the antibiotic marker gene.The promotor of the expression cassette of cl gene and bi expression casette all can be any can promotor gene in the promotor of plant transcription, such as 35s promotor commonly used.
The aminoacid sequence of the protein of described bi genes encoding is shown in sequence in the sequence table 1, and the aminoacid sequence of the protein of described cl genes encoding is shown in sequence in the sequence table 2.The encoding sequence of described bi gene is shown in the 3137th to the 4796th of sequence in the sequence table 10; The encoding sequence of described cl gene is shown in the 1013rd to the 1834th of sequence in the sequence table 10.
The expression cassette of described screening transgenic plants need marker gene is one and contains the dna molecular that the screening transgenic plants needs marker gene and expresses required element, contains successively following fragment from the upstream to the downstream: encoding sequence and the terminator (transcription termination sequence) of the marker gene that promotor, the described screening transgenic plants of being transcribed by described promotor startup need.In an embodiment of the present invention, described screening transgenic plants needs the expression cassette of marker gene to be specially the EPSP expression casette; Described EPSP expression casette is a dna molecular that contains EPSP gene and the required element of EPSP genetic expression, contains successively following fragment from the upstream to the downstream: promotor, started encoding sequence and the terminator (transcription termination sequence) of the described EPSP gene of transcribing by this promotor; The aminoacid sequence of the protein of described EPSP genes encoding is shown in sequence in the sequence table 3; The encoding sequence of described EPSP gene is shown in the 1029th to the 2549th of sequence in the sequence table 8.Described screening transgenic plants need the promotor in the expression cassette of marker gene can be any can promotor gene in the promotor of plant transcription, such as 35s promotor commonly used.
In an embodiment of the present invention, the multiple clone site of described insertion external source target DNA is from upstream to the downstream and specifically is followed successively by KpnI, Hind III, EcoR I, Sma I, Xba I, Not I.Described controllable initiating is specially paddy rice heat shock protein hsp70 gene promoter hsp70; The nucleotide sequence of described paddy rice heat shock protein hsp70 gene promoter hsp70 is shown in the 1st to the 687th of sequence in the sequence table 9.
The aminoacid sequence of the protein of described Cre enzyme genes encoding is shown in sequence in the sequence table 4; The encoding sequence of described Cre enzyme gene is shown in the 694th to the 1728th of sequence in the sequence table 9.
The described independent packing of plant expression vector difference that contains plant expression vector and the described Cre of the containing enzyme gene of antibiotic marker gene.
The described plant expression vector that contains the antibiotic marker gene is pBAC9008, pBAC9008 makes up as follows: the loxP site of 1) inserting respectively shown in sequence in the sequence table 5 at the 1648th of the pGreen carrier and the 2635th place obtains recombinant vectors pBAC814, and two loxP site directions among the pBAC814 are identical; 2) expression cassette that inserts described EPSP gene of the Nde I restriction enzyme site place before the multiple clone site of pBAC814 obtains recombinant vectors pBAC823; 3) cutting with the DraIII enzyme above-mentioned pBAC823 carrier, add AgeI/PacI linker, expression cassette with described anthocyanidin route of synthesis transcription factor bi gene and transcription factor cl gene inserts between AgeI and the PacI site carrier called after pBAC9008 that obtains afterwards.
The sequence of described pGreen carrier is shown in sequence in the sequence table 7; The sequence of the expression cassette of described EPSP gene is shown in sequence in the sequence table 8, wherein the 1st is the nucleotide sequence of described 35S promoter to the 434th, the 461st to the 994th is the nucleotide sequence of the Intron1 of described corn Adh1 gene, and the 1029th is the encoding sequence of described EPSP gene to the 2549th; The nucleotide sequence of described AgeI/PacI linker is shown in sequence in the sequence table 6.
The plant expression vector of the described Cre of containing enzyme gene is pBAC9009, pBAC9009 makes up as follows: the expression cassette that a) makes up the described Cre enzyme gene that is started by described hot activation protein gene promoter, Dra III restriction enzyme site place with this expression cassette inserts described pBAC823 carrier obtains recombinant vectors pBAC830; B) expression cassette of the transcription factor bi gene in the described anthocyanidin gene route of synthesis and transcription factor cl gene is inserted the EcoR I restriction enzyme site of pBAC830 carrier, obtain the pBAC9009 carrier.
The nucleotide sequence of the expression cassette of the described Cre enzyme gene that is started by described hot activation protein gene promoter is shown in sequence in the sequence table 9, wherein, the 1st to the 687th is the nucleotide sequence of described hsp70 promotor, and the 694th to the 1725th is the encoding sequence of described Cre enzyme gene; The sequence of the expression cassette of the expression cassette of the transcription factor bi gene in the described anthocyanidin gene route of synthesis and described anthocyanidin gene route of synthesis transcription factor cl gene is shown in sequence in the sequence table 10, wherein, the 1st is the gene order of described cl expression cassette to the 2112nd, the 2125th is the sequence of described bi expression cassette to the 5074th, the 1013rd to the 1834th is the encoding sequence of cl gene, and the 3137th is the encoding sequence of bi to the 4796th.
The application of the system of described deletion antibiotic marker gene from transgenic plant in deletion transgenic plant antibiotic resistance gene also belongs to protection scope of the present invention.
Another object of the present invention provides the method for the system cultivation transgenic plant that utilize above-mentioned deletion antibiotic marker gene from transgenic plant.The method comprises the steps: a, goal gene is inserted described multiple clone site in the described plant expression vector that contains the antibiotic marker gene, and the destination gene expression carrier obtains recombinating.
B, change vegetable cell over to by the direct transfer method of DNA respectively with described restructuring destination gene expression carrier and the plant expression vector that contains Cre enzyme gene, obtain the transfer-gen plant of the plant expression vector of the transfer-gen plant of described restructuring destination gene expression carrier and the described Cre of containing enzyme gene.In the transfer-gen plant of described restructuring destination gene expression carrier, described goal gene, described screening transgenic plants need marker gene and these three genes of described visual marker gene all to express, and described three genes are denoted as three genes that contain goal gene; In the transfer-gen plant of the described plant expression vector that contains Cre enzyme gene, described Cre enzyme gene, described screening transgenic plants need marker gene and these three genes of described visual marker gene all to express, and described three genes are denoted as three genes that contain Cre enzyme gene.
C, from the transfer-gen plant self progeny of described restructuring destination gene expression carrier, select the described plant that contains the equal stably express of three genes of goal gene and isozygoty as male parent, the plant of selecting the equal stably express of three genes of the described Cre of containing enzyme gene and isozygoty from the transfer-gen plant self progeny of the plant expression vector of the described Cre of containing enzyme gene is as female parent, described female parent and described male parent are hybridized, the cenospecies that obtains is processed, described controllable initiating is activated, this seed is planted, the plant that does not contain described visual marker gene expression product that obtains is the deleted transfer-gen plant of antibiotic marker gene again.
The direct transfer method of described DNA comprises electric shocking method (electroporation), particle bombardment (micropellet bombardment method), microbeam laser method, microinjection, liposome mediated-method, polymer mediated method, pollen tube admittance method etc.The concrete grammar that adopts in an embodiment of the present invention is particle bombardment.
In an embodiment of the present invention, described transgenic plant specifically can be monocotyledons, such as corn; Describedly the cenospecies that obtains is processed the method that described controllable initiating is activated be specially 40 ℃ of thermal inductions and process.
The present invention by the Cre-loxP system constructing deletion system of antibiotic marker gene.Contain the loxP site the expression goal gene transfer-gen plant by with the transfer-gen plant hybridization of expressing Cre enzyme gene, just can from the offspring of transfer-gen plant, delete the antibiotic marker gene, give security for food safety, in transgenic research, have great importance.In addition, the present inventor has introduced again two transcription factors of visual marker gene anthocyanidin route of synthesis simultaneously in deletion system, so that the present invention only just can judge genetically modified effect and deletion effect on the color of corn peel, therefore should the deletion system be a breakthrough in the transgenic research field, greatly saved the cost of Molecular Detection, also had great significance for follow-up breeding.
Description of drawings
Fig. 1 is the pBAC823 plasmid map.
Fig. 2 is the pBAC9008 plasmid map.
Fig. 3 is the pBAC830 plasmid map.
Fig. 4 is the pBAC9009 plasmid map.
Fig. 5 is differentiation and the field transplanting of transgenic corn plant.The A evoked callus; B transformation tissue culture plant; The C field transplanting; The solid seed of D transformed plant.
Fig. 6 is that the PCR of pBAC9008 transfer-gen plant detects.1:2K plus marker; 2: negative control (water); 3: the non-transgenic plant; 5: plasmid pBAC9008; 6～18: transformed plant.
Fig. 7 is that the PCR of pBAC9009 transfer-gen plant detects.1:2K plus marker; 2～17: transformed plant; 18: negative control (water); 19: the non-transgenic plant; 20: plasmid pBAC9009.
Fig. 8 is Kan gene elmination synoptic diagram in the transgenic corns.Wherein, the A representative turns goal gene corn (male parent); The B representative turns recombinase gene corn (female parent); The C representative turns goal gene corn (deletion antibiotic resistance gene); The D representative turns the recombinase gene corn; E and F all represent and turn goal gene corn/the turn heterozygote of recombinase gene corn.
Embodiment
Employed experimental technique is ordinary method if no special instructions among the following embodiment.
Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.
Maize elite inbred line 501 (Yang Dongge, Yang Fengping, Chen Xuqing, Zhang Liquan, Zhang Xiaodong. the acquisition of external source dewatered response transcription factor CBF4 gene transformation corn. Acta Agronomica Sinica, 2009,35 (10): 1759-1763)
T4DNA ligase enzyme, Taq enzyme, card are received the reagent such as mycin, IPTG, X-gal all available from the precious biotechnology in Dalian company limited; DNA reclaims test kit available from sky root biochemical technology company; Restriction enzyme is available from Promega, New England Biolabs; Common biochemical reagents are available from Sigma company, Promega company or domestic.Particle gun model: PDS-1000/He (BioRad).
Carrier is carrier pGreen, available from Britain John Innes Centre[contact person: Mark Smedley, John Innes Centre, Norwich Research Park, Colney, Norwich, NR47UH, UK.e-mail:mark.smedleybbsrc.ac.uk, Fax:(+44) 1603450045].
Below in conjunction with specific embodiment, elaborate the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.
One, the transformation of pGreen carrier
According to the both sides sequence of Kan gene among the pGreen respectively forward, reverse totally four primers (seeing Table 1) in synthetic amplification loxP site, wherein front 4 nucleotide residues of two forward primer PF1648 (sequence is shown in sequence in the sequence table 11) and PF2635 (sequence is shown in sequence in the sequence table 12) are rear 4 of 8bp transcribed spacer of loxP sequence, and 5-17 position nucleotide residue is the inverted repeats of the 13bp of loxP sequence; Front 4 nucleotide residues of two reverse primer PR1648 (sequence is shown in sequence in the sequence table 13) and PR2635 (sequence is shown in sequence in the sequence table 14) are front 4 of 8bp transcribed spacer of loxP sequence, and 5-17 position nucleotide residue is the inverted repeats of the 13bp of loxP sequence.Utilize the method for twice PCR, the loxP site is added the both sides of Kan gene expression frame among the pGreen.
Concrete operation method is as described below: at first take pGreen basic framework carrier as template, utilize the PF1648/PR1648 primer to carrying out pcr amplification, product is from connecting Transformed E .coli JM110.Determine by sequencing whether the loxP site correctly inserts in the pGreen carrier.Correct carrier called after pGreen-loxp (1648 site at pGreen are inserted the recombinant vectors that the loxP site shown in sequence in the sequence table 5 obtains) will be identified, take the pGreen-loxp carrier as template, to carrying out the PCR second time, step is the same with the PF2635/PR2635 primer.The carrier called after pBAC814 that checks order correct (2635 site at corresponding pGreen among the pGreen-loxp are inserted the recombinant vectors that the loxP site shown in sequence in the sequence table 5 obtains, and two loxP site directions among the pBAC814 are identical).Nde I restriction enzyme site place before the pBAC814 multiple clone site inserts the EPSP gene (EPSP expression casette) of the Intron1 driving of CaMV 35S promoter and corn Adh1 gene, and described EPSP gene is as the selectable marker gene of screening transgenic plant.Identify correct carrier called after pBAC823 (plasmid map of pBAC823 as shown in Figure 1) through order-checking.The sequence of the EPSP gene (EPSP expression casette) that the Intron1 of CaMV 35S promoter and corn Adh1 gene drives among the pBAC823 is shown in sequence in the sequence table 8, wherein the 1st is the nucleotide sequence of described 35S promoter to the 434th, the 461st to the 994th is the nucleotide sequence of the Intron1 of described corn Adh1 gene, and the 1029th is the encoding sequence of described EPSP gene to the 2549th
Four primer sequences in table 1 amplification loxP site
Two, pBAC9008 Vector construction
With cutting with the DraIII enzyme of the pBAC823 carrier of above-mentioned structure, add AgeI/PacI linker, the expression cassette with two transcription factor bi in the anthocyanidin route of synthesis and cl inserts between AgeI and the PacI site carrier called after pBAC9008 that obtains afterwards.Among the pBAC9008, the sequence of transcription factor bi gene expression frame and cl gene expression frame is shown in sequence in the sequence table 10, wherein the 1st is the gene order of described cl expression cassette to the 2112nd, the 2125th is the sequence of described bi expression cassette to the 5074th, the 1013rd encoding sequence to the 1834th cl gene that is, the 3137th is the encoding sequence of bi gene to the 4796th.
The pBAC9008 of gained is for the plant expression vector that contains the antibiotic marker gene that inserts the external source target DNA, and its plasmid map as shown in Figure 2.PBAC9008 is circular vectors, contains two in the same way loxP sites, antibiotic marker expression casette, visual marker expression casette, the marker gene expression cassette that the screening transgenic plants needs, the multiple clone site of insertion external source target DNA.Described two loxP sites in the same way are divided into two sections with the described plant expression vector that contains the antibiotic marker gene, one section expression cassette that contains coding described antibiotic marker gene and described visual marker gene wherein, another section contains the expression cassette that described screening transgenic plants needs marker gene, and the multiple clone site of described insertion external source target DNA.Kantlex marker gene and transcription termination sequence that the expression cassette of described antibiotic marker gene contains the prokaryotic promoter that starts the kantlex marker gene, SD sequence, started by this promotor.The expression cassette of described visual marker gene is comprised of these two expression cassettes of cl expression casette in the transcription factor bi expression casette in the anthocyanidin gene route of synthesis and the anthocyanidin gene route of synthesis.The multiple clone site of described insertion external source target DNA is from upstream to the downstream and is followed successively by Kpn I, Hind III, EcoR I, Sma I, Xba I, Not I.
Utilize PCR method, from rice genome, clone hot activation albumen hsp70 gene promoter, according to the sequence of cre gene, the cre enzyme gene that synthetic is optimized, the expression cassette of the cre enzyme gene that the thermal induction of structure hsp70 promotor is expressed.This expression cassette is inserted the DraIII restriction enzyme site of pBAC823 carrier.Called after pBAC830 (plasmid map of pBAC830 as shown in Figure 3).Among the pBAC830, the nucleotide sequence of the expression cassette of the cre enzyme gene that described hsp70 promotor thermal induction is expressed is shown in sequence in the sequence table 9, wherein, the 1st to the 687th is the nucleotide sequence of described hsp promotor, and the 694th to the 1725th is the encoding sequence of described Cre enzyme gene.Again with the EcoR I site of the insertion pBAC830 carrier of bi expression cassette in the anthocyanidin route of synthesis and cl expression cassette, called after pBAC9009.The sequence of bi expression cassette and cl expression cassette is shown in sequence in the sequence table 10 in the route of synthesis of anthocyanidin described in the pBAC9009, wherein, the 1st is the gene order of described cl expression cassette to the 2112nd, the 2125th is the sequence of described bi expression cassette to the 5074th, the 1013rd to the 1834th is the encoding sequence of cl gene, and the 3137th is the encoding sequence of bi gene to the 4796th.
PBAC9009 is be used to the plant expression vector that contains Cre enzyme gene of deleting described antibiotic marker gene, and its plasmid map as shown in Figure 4.PBAC9009 is circular vectors, contains two in the same way loxP sites, controllable initiating, by the Cre enzyme gene of described controllable initiating startup, the expression cassette of antibiotic marker gene, the expression cassette of visual marker gene, and the screening transgenic plants needs the expression cassette of marker gene.Described two loxP sites in the same way are divided into two sections with the plant expression vector of the described Cre of containing enzyme gene, wherein one section contains the described antibiotic marker gene of coding, controllable initiating and the Cre enzyme gene that is started by described controllable initiating, another section contains described screening transgenic plants needs the expression cassette of marker gene and the expression cassette of described visual marker gene.Described controllable initiating is the hot activation protein gene promoter.Kantlex marker gene and transcription termination sequence that described antibiotic marker expression casette contains the prokaryotic promoter that starts the kantlex marker gene, SD sequence, started by this promotor.The expression casette of described visual marker is comprised of these two expression cassettes of cl expression casette in the transcription factor bi expression casette in the anthocyanidin gene route of synthesis and the anthocyanidin gene route of synthesis.
Inducing culture: N6 minimum medium+10mg L
-1AgNO
3+ 100mg L
-1Inositol+2mg L
-12,4-D+30g L
-1Sucrose+7g L
-1Agar.
Division culture medium: N6 minimum medium+0.5mg L
-1AgNO
3+ 100mg L
-1Inositol+1.5mg L
-1KT+30g L
-1Sucrose+7g L
-1Agar+0.5mg L
-1Glyphosate.
One, the independent maize transformation of pBAC9008 and pBAC9009 difference
Get the fruit ear of the corn inbred line 501 of the rear 10-12d of pollination, 75% ethanol carries out surface sterilization, gets rataria and is inoculated on the inducing culture, secretly cultivates and carries out via Particle Bombardment Transformation after 3～5d induces embryo callus.It is 1 μ g/ μ L that the pBAC9008 that purifying is good and pBAC9009 carrier are adjusted respectively concentration
-1Press (the Zhang Xiaodong such as Zhang Xiaodong, Liang Rongqi, Chen Xvqing, Yang Fengping, Zhang Liquan, Transgene inheritance and quality improvement by expressing novel HMW glutenin subunit (HMW-GS) genes in winter wheat.Chinese Science Bulletin, 2003,48 (8): 771-776.) described method is carried out the bullet preparation, PDS-1000/He type particle gun bombardment embryo callus is transferred to the screening culture medium that contains glyphosate with callus behind the 5d and (is added 1mg L in the inducing culture
-1Glyphosate) upper dark the cultivation about 20d.Then choose well-grown callus and transfer to and carry out illumination cultivation on the division culture medium, differentiate seedling, will break up seedling behind the 20-30d and transfer to and carry out Rooting and hardening-off culture on the strong seedling culture base, obtain T
0For regeneration plant.And then breed in the base, field of being transplanted to Hainan, and (culture temperature of dark cultivation and illumination cultivation is 26 ℃, the illumination cultivation is 16: 8 with the time ratio of dark cultivation during illumination cultivation) (Yang Dongge, Yang Fengping, Chen Xuqing, Zhang Liquan, Zhang Xiaodong. the acquisition [J] of external source dewatered response transcription factor CBF4 gene transformation corn. Acta Agronomica Sinica, 2009,35 (10): 1759-1763).
The result shows that the pBAC9008 carrier obtains transformed plant 29 strains, has 23 strains solid, and wherein the seed of 7 strains has the expression of anthocyanidin gene; The pBAC9009 carrier obtains transformed plant 155 strains, has 97 strains solid, and wherein the seed of 10 strains has the expression of anthocyanidin gene.The differentiation of transgenic corn plant and field transplanting flow process are as shown in Figure 5.
Two, the PCR of transfer-gen plant foreign gene detects
Extract the genomic dna of transgenic corns tender leaf with modified CTAB method, designing upstream primer according to the 35s promoter sequence is TCCACTGACGTAAGGGAT (the 2466-2483 position of sequence 10), designing downstream primer according to the an-B gene order is TGGACCAGAAGAGGGCAT (the 3240-3257 position of sequence 10), and the purpose clip size of amplification is 792bp; Be TGGAAGATGCTACTGTCTGTC (the 817-837 position of sequence 9) according to cre gene design upstream primer, downstream primer is CAGTGCTGACCAGAGTCTTA (the 1293-1312 position of sequence 9), and the purpose clip size of amplification is 495bp.With the negative contrast of non-transgenic plant, respectively with pBAC9008 and the positive contrast of pBAC9009 plasmid, ddH
2O is blank, transfer-gen plant is carried out PCR detect.Reaction system is dna profiling 100 μ g, 10 * PCR Reaction Buffer, 2.5 μ L, dNTPs 2.5mmol/L) 2 μ L, upstream primer (10 μ mol/L) 1 μ L, downstream primer (10 μ mol/L) 1 μ L, Taq archaeal dna polymerase (5U/ μ L) 0.2 μ L uses ddH at last
2O mend to cumulative volume be 25 μ L.Response procedures is: 95 ℃ of sex change 5min; 94 ℃ of sex change 50s, 58 ℃ of annealing 50s, 72 ℃ are extended 50s, totally 35 circulations; Last 72 ℃ are extended 10min again.Reaction product detects with 0.8% agarose gel electrophoresis.
Extract total DNA of pBAC9008 transformed plant, according to the special primer of designed 35s promotor and an-B gene, carry out PCR and detect, the result as shown in Figure 6.This result shows, the Partial Conversion plant that obtains and positive control plasmid (swimming lane 5) can both amplify the specific fragment of the bi expression casette of 792bp, negative control is (without template DNA, swimming lane 2) and non-transformed plant (swimming lane 3) do not have amplified band, according to this result, the an-C of our preliminary judgement external source and an-B gene successfully change in the corn.In addition, directly be reflected in purple on plant and the seed as the anthocyanidin of visual marker and further specify the an-C of external source and an-B gene by complete having changed in the milpa.
Extract total DNA of pBAC9009 transformed plant, according to the special primer of designed cre gene, carry out PCR and detect, the result as shown in Figure 7.This result shows, the Partial Conversion plant that obtains and positive control plasmid (swimming lane 20) can both amplify the specific fragment of the cre gene about 495bp, negative control is (without template DNA, swimming lane 18) and non-transformed plant (swimming lane 19) do not have amplified band, show that external source cre enzyme gene successfully changes in the corn.
According to embodiment 3 described methods with the plant expression vector that contains the antibiotic marker gene (pBAC9008) of embodiment 1 and 2 gained and the plant expression vector (pBAC9009) that contains Cre enzyme gene conversion of plant respectively, select through T1 generation, T2 two generations of generation, obtain Cre enzyme gene or external source goal gene, anthocyanidin route of synthesis transcription factor bi and cl gene and EPSP gene pBAC9009 equal stably express, that isozygoty and pBAC9008 transfer-gen plant (if T2 for the seed of plant full purple be the offspring of isozygotying).Delete the Kan resistant maker gene by hybridization again.Below just describe as an example of transgenic corns example.
In the T3 generation (female parent) that turns recombinase gene (pBAC9009) plant (seed is purple entirely), hybridized with the T3 generation (male parent) that turns goal gene (pBAC9008) plant (seed is purple entirely), seed carries out 40 ℃ of thermal inductions process after plantation, can delete Kan gene and anthocyanidin transcription factor among the offspring of pBAC9008 transfer-gen plant.After thermal induction is processed, suppose that deletion efficiency is 100%, the present age, solid seed separated in theory at 3: 1,1/4 is yellow, be the offspring of pBAC9008 (goal gene) transfer-gen plant after the deletion of Kan resistant gene, have 3/4 to be purple, the latter wherein has 1/3 to be the offspring of pBAC9009 (recombinase) transfer-gen plant, 2/3 for containing simultaneously the heterozygote (Fig. 8) of the transfer-gen plant of pBAC9008 (goal gene) and pBAC9009 (recombinase), and the isolated yellow corn of heterozygote is still the offspring of pBAC9008 (goal gene) transfer-gen plant after the deletion of Kan resistant gene.Even deletion is not exclusively, also just in purple seeds, be mixed with the offspring of part goal gene transfer-gen plant, 100% be the offspring of pBAC9008 (goal gene) transfer-gen plant still in the amber seed.Only from the color of kind of skin to judge genetically modified effect and deletion effect, should the deletion system be a breakthrough in the transgenic research field therefore, greatly saved the cost of Molecular Detection, also have great significance for follow-up breeding.
Claims (8)
1. the carrier of deletion antibiotic marker gene from transgenic plant forms by the plant expression vector that contains the antibiotic marker gene that is used for insertion external source target DNA with for the plant expression vector that contains Cre enzyme gene of deleting described antibiotic marker gene;
The described plant expression vector that contains the antibiotic marker gene is circular vectors, contain two in the same way loxP sites, the expression cassette of antibiotic marker gene, the expression cassette of visual marker gene, the screening transgenic plants needs the expression cassette of marker gene, inserts the multiple clone site of external source target DNA; Described two loxP sites in the same way are divided into two sections with the described plant expression vector that contains the antibiotic marker gene, one section expression cassette that contains coding described antibiotic marker gene and described visual marker gene wherein, another section contains the expression cassette that described screening transgenic plants needs marker gene, and the multiple clone site of described insertion external source target DNA;
The plant expression vector of the described Cre of containing enzyme gene is circular vectors, this circular vectors contains two loxP sites in the same way, controllable initiating, by the Cre enzyme gene of described controllable initiating startup, the expression cassette of antibiotic marker gene, the expression cassette of visual marker gene, and the screening transgenic plants needs the expression cassette of marker gene; Described two loxP sites in the same way are divided into two sections with the plant expression vector of the described Cre of containing enzyme gene, wherein one section contains the described antibiotic marker gene of coding, controllable initiating and the Cre enzyme gene that is started by described controllable initiating, another section contains described screening transgenic plants needs the expression cassette of marker gene and the expression cassette of described visual marker gene;
Described expression cassette all refers to contain the dna molecular of goal gene and the required element of this destination gene expression;
Described transgenic plant are corn;
Described visual marker gene is by the transcription factor bi gene in the anthocyanidin gene route of synthesis and anthocyanidin gene route of synthesis transcription factor cl genomic constitution; The expression cassette of described visual marker gene is for to be comprised of the expression cassette of described transcription factor bi gene and the expression cassette of described transcription factor cl gene; The aminoacid sequence of the protein of described bi genes encoding is shown in sequence in the sequence table 1, and the aminoacid sequence of the protein of described cl genes encoding is shown in sequence in the sequence table 2;
The encoding sequence of described bi gene is shown in the 3137th to the 4796th of sequence in the sequence table 10; The encoding sequence of described cl gene is shown in the 1013rd to the 1834th of sequence in the sequence table 10.
2. carrier according to claim 1 is characterized in that: described controllable initiating is the hot activation protein gene promoter; The nucleotide sequence of described hot activation protein gene promoter is shown in the 1st to the 687th of sequence in the sequence table 9; The sequence of the protein of described Cre enzyme genes encoding is shown in sequence in the sequence table 9.
3. carrier according to claim 2 is characterized in that: the encoding sequence of described Cre enzyme gene is shown in the 694th to the 1725th of sequence in the sequence table 9.
4. carrier according to claim 3 is characterized in that: the described independent packing of plant expression vector difference that contains plant expression vector and the described Cre of the containing enzyme gene of antibiotic marker gene.
5. carrier according to claim 4, it is characterized in that: the described plant expression vector that contains the antibiotic marker gene is pBAC9008, pBAC9008 makes up as follows: 1) obtain recombinant vectors pBAC814 in the 1649th of the pGreen carrier shown in sequence in the sequence table 7 and the 2635th loxP site of inserting respectively shown in sequence in the sequence table 5, two loxP site directions among the pBAC814 are identical; 2) the EPSP expression casette that inserts shown in sequence in the sequence table 8 at the Nde of pBAC814 I restriction enzyme site place obtains recombinant vectors pBAC823; 3) cutting with the DraIII enzyme above-mentioned pBAC823 carrier, the AgeI/PacI linker of adding shown in sequence in the sequence table 6, the expression cassette of anthocyanidin route of synthesis transcription factor cl gene and transcription factor bi gene inserts between AgeI and the PacI site as described in afterwards will be shown in sequence in the sequence table 10, the carrier called after pBAC9008 that obtains;
The plant expression vector of the described Cre of containing enzyme gene is pBAC9009, pBAC9009 makes up as follows: a) make up by described hot activation protein gene promoter start shown in sequence in the sequence table 9 as described in the expression cassette of Cre enzyme gene, Dra III restriction enzyme site place with this expression cassette inserts described pBAC823 carrier obtains recombinant vectors pBAC830; B) the transcription factor bi gene as described in will be shown in sequence in the sequence table 10 in the anthocyanidin gene route of synthesis and the expression cassette of transcription factor cl gene insert the EcoR I restriction enzyme site of pBAC830 carrier, obtain the pBAC9009 carrier.
6. the application of arbitrary described deletion antibiotic marker gene from transgenic plant carrier in deletion transgenic plant antibiotic marker gene among the claim 1-4;
Described transgenic plant are corn.
7. utilize the method that arbitrary described carrier is cultivated transgenic plant among the claim 1-4, comprise the steps: a, goal gene is inserted described multiple clone site in the described plant expression vector that contains the antibiotic marker gene, the destination gene expression carrier obtains recombinating;
B, change vegetable cell over to by the direct transfer method of DNA respectively with described restructuring destination gene expression carrier and the plant expression vector that contains Cre enzyme gene, obtain the transfer-gen plant of the plant expression vector of the transfer-gen plant of described restructuring destination gene expression carrier and the described Cre of containing enzyme gene;
In the transfer-gen plant of described restructuring destination gene expression carrier, described goal gene, described screening transgenic plants need marker gene and these three genes of described visual marker gene all to express, and described three genes are denoted as three genes that contain goal gene; In the transfer-gen plant of the described plant expression vector that contains Cre enzyme gene, described Cre enzyme gene, described screening transgenic plants need marker gene and these three genes of described visual marker gene all to express, and described three genes are denoted as three genes that contain Cre enzyme gene;
C, from the transfer-gen plant self progeny of described restructuring destination gene expression carrier, select the described plant that contains the equal stably express of three genes of goal gene and isozygoty as male parent, the plant of selecting the equal stably express of three genes of the described Cre of containing enzyme gene and isozygoty from the transfer-gen plant self progeny of the plant expression vector of the described Cre of containing enzyme gene is as female parent, described female parent and described male parent are hybridized, the cenospecies that obtains processed described controllable initiating is activated, this seed is planted, the plant that obtains expressing described goal gene and do not contain described visual marker gene expression product is the deleted transfer-gen plant of antibiotic marker gene again;
Described transgenic plant are corn.
8. described method according to claim 7 is characterized in that: described the cenospecies that obtains is processed the method that described controllable initiating is activated is that 40 ℃ of thermal inductions are processed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110295586 CN102337292B (en) | 2011-09-27 | 2011-09-27 | System for deleting antibiotic marker gene from transgenic plant and application of system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110295586 CN102337292B (en) | 2011-09-27 | 2011-09-27 | System for deleting antibiotic marker gene from transgenic plant and application of system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102337292A CN102337292A (en) | 2012-02-01 |
| CN102337292B true CN102337292B (en) | 2013-04-10 |
Family
ID=45513242
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110295586 Expired - Fee Related CN102337292B (en) | 2011-09-27 | 2011-09-27 | System for deleting antibiotic marker gene from transgenic plant and application of system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102337292B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10017832B2 (en) * | 2015-08-25 | 2018-07-10 | Washington University | Compositions and methods for site specific recombination at asymmetric sites |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102618528B (en) * | 2012-03-31 | 2014-02-12 | 西南大学 | Deleting system for long fragments in genome based on TALEN (transcription activator-like effector Nuclease) and ssODNs (single stranded oligonucleotides) and application thereof |
| CN103798124A (en) * | 2012-11-07 | 2014-05-21 | 张建福 | Heat shock method for deleting selective marker in transgene rice |
| CN107099531B (en) * | 2017-05-23 | 2020-04-17 | 华南农业大学 | Anther specific expression promoter PV4 and application thereof |
| CN107142276B (en) * | 2017-05-23 | 2020-11-13 | 华南农业大学 | Transgenic breeding method for synthesizing anthocyanin in crop seed endosperm |
| CN111303259B (en) * | 2019-12-27 | 2022-01-28 | 中国农业科学院生物技术研究所 | Application of rice transcription factor gene OsBEAR1 in cultivation of rice variety with increased coleoptile or suitable for direct seeding in field |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1324141C (en) * | 2004-02-09 | 2007-07-04 | 中国科学院遗传与发育生物学研究所 | Method for cultivating transgenic plant without selective marker and its special expression vector |
| JP2008529533A (en) * | 2005-02-10 | 2008-08-07 | ノース カロライナ セントラル ユニヴァーシティ | Method for cutting off both ends of a large DNA fragment |
| CN101845445B (en) * | 2010-02-04 | 2012-05-09 | 东北农业大学 | Cre recombinase recombination gene and Cre/loxP-mediated transgene safe plant expression vector |
-
2011
- 2011-09-27 CN CN 201110295586 patent/CN102337292B/en not_active Expired - Fee Related
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10017832B2 (en) * | 2015-08-25 | 2018-07-10 | Washington University | Compositions and methods for site specific recombination at asymmetric sites |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102337292A (en) | 2012-02-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1742527B1 (en) | Regulatory sequences for expressing gene products in plant reproductive tissue | |
| CN102337292B (en) | System for deleting antibiotic marker gene from transgenic plant and application of system | |
| US20160264982A1 (en) | Method for plant genome site-directed modification | |
| EP4023665A1 (en) | Stsci protein for changing self-crosslinking incompatibility of diploid potato materials | |
| US10808257B2 (en) | Recombinant DNA constructs employing site-specific recombination | |
| Gadaleta et al. | A transgenic durum wheat line that is free of marker genes and expresses 1Dy10 | |
| US11104910B2 (en) | Compositions and methods for regulating gene expression for targeted mutagenesis | |
| CN110305896B (en) | Construction method of zebra fish kidney progenitor cell marker transgenic line | |
| WO2019219046A1 (en) | Method for rapidly and efficiently obtaining non-transgenic, gene-targeted mutated plant and use thereof | |
| CN108034671B (en) | Plasmid vector and method for establishing plant population by using same | |
| CN113801891B (en) | Construction method and application of beet BvCENH3 gene haploid induction line | |
| CN104846009A (en) | Construction method and application of rice engineering maintainer line | |
| US20230279418A1 (en) | Plant haploid induction | |
| WO2019129145A1 (en) | Flowering time-regulating gene cmp1 and related constructs and applications thereof | |
| CN102286511A (en) | Gene-auto-excision binary system (GAEBS) for biological safety control of exogenous gene in sexual reproduction plant and related plant expression vector | |
| US20150344895A1 (en) | Methods of modifying algal cell genomes | |
| CN104341525A (en) | Application of CDS (coding sequence) of gene for coding oryza sativa L. transcription factor Os02g47744 | |
| AU2000270487B2 (en) | Reduction of transmission of transgenes in plants | |
| CN110129357A (en) | A kind of no label is used for the reagent combination and its application of gene editing | |
| CN102352375B (en) | Plant transgenic visual tracking expression system and application thereof | |
| Eike | Characterising transgene silencing in single-copy Arabidopsis thaliana lines: DNA methylation in view of genomic and transcriptional context | |
| Hinze et al. | Next generation biotechnology: how sophisticated constructs lead to further insights and new approaches towards biotechnology’s demands | |
| ZA200302291B (en) | Reduction of transmission of transgenes in plants. | |
| Akbudak | Applications of site-specific recombination systems in transgene expression and marker gene removal |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130410 Termination date: 20140927 |
|
| EXPY | Termination of patent right or utility model |