CN102337283A - Bidirectional induction expression plasmid and construction method and application thereof - Google Patents
Bidirectional induction expression plasmid and construction method and application thereof Download PDFInfo
- Publication number
- CN102337283A CN102337283A CN2010102392521A CN201010239252A CN102337283A CN 102337283 A CN102337283 A CN 102337283A CN 2010102392521 A CN2010102392521 A CN 2010102392521A CN 201010239252 A CN201010239252 A CN 201010239252A CN 102337283 A CN102337283 A CN 102337283A
- Authority
- CN
- China
- Prior art keywords
- way
- plasmid
- abduction delivering
- gene
- green fluorescence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of the molecular biology and particularly relates to a bidirectional induction expression plasmid and a construction method and application thereof. In the invention, a vector of the bidirectional induction expression plasmid comprises a green fluorescent protein gene and a reinforced green fluorescent protein gene. The bidirectional induction expression plasmid is constructed by a gene recombination method. The green fluorescent protein gene and the reinforced green fluorescent protein gene are arranged at both sides of a restriction enzyme cutting site and are respectively regulated and controlled by corresponding promoters to obtain the bidirectional induction expression plasmid. The bidirectional induction expression plasmid is used for the substrate inducible gene expression screening and the environmental factor inducible gene expression screening. The efficiency of the substrate inducible gene expression screening is improved.
Description
Technical field
The invention belongs to technical field of molecular biology, be specifically related to a kind of two-way abduction delivering plasmid and construction process and purposes.
Technical background
From environment unit genomic library, screen the restriction that the gene with katalysis has been avoided the mikrobe pure culture, this method has broad application prospects.Substrate for induction genetic expression triage techniques (Substrate-induced gene-expressionscreening; SIGEX) owing to used supermatic flow cytometry (Flow Cytometry; FCM); So have time saving and energy saving, efficient is high, can screen novel advantages such as gene, its research also more and more comes into one's own.The theoretical basis of SIGEX technology is that the catalysis expression of gene usually receives inducing of its substrate or meta-bolites, and usually receives the control of various regulatory elements.The transcriptional regulatory of many bacteriums has similar transcriptional regulatory mechanism with host bacterium (E.coli) and can work together, like this, can screen the catalysis operon in the various bacteriums through the SIGEX technology.The SIGEX technology mainly is divided into the screening of environment unit genomic library builds storehouse, prescreen, substrate for induction and three steps of positive colony screening, and wherein, but the abduction delivering plasmid vector that is used to build storehouse machine screening is this technological core and basis.But existing abduction delivering plasmid vector p18GFP has comprised a green fluorescent protein (Green Fluorescent Protein now; GFP) reporter gene (Taku Uchiyama etc., naturebiotehnology, 23 (1); 88-93; 2005), still because nucleic acid is duplex structure and the two-way expression of ability, so but but existing abduction delivering plasmid vector can not be reported out the gene fragment of cloning the abduction delivering on this carrier fully.Making up one can be by the plasmid vector of two-way abduction delivering; And all design the Previous Report gene at cloning site forward and reverse catchment; Can make and clone on this carrier positive and negative both direction and can receive the inductive gene fragment all to obtain report, improve the screening efficiency of SIGEX.
Summary of the invention
One of the object of the invention provides a kind of two-way abduction delivering plasmid that contains green fluorescence protein gene and enhanced green fluorescence protein gene simultaneously.
Two of the object of the invention provides the construction process of above-mentioned two-way abduction delivering plasmid.
Three of the object of the invention provides the purposes of above-mentioned two-way abduction delivering plasmid.
Two-way abduction delivering plasmid of the present invention is a kind of plasmid that contains green fluorescence protein gene and enhanced green fluorescence protein gene simultaneously.
The present invention adopts the method for recombination, makes green fluorescence protein gene and enhanced green fluorescence protein gene place restriction enzyme site both sides and respectively under the regulation and control of separately promotor, obtains two-way abduction delivering plasmid.
But connect induced gene at the restriction enzyme site place, and after transformed into escherichia coli obtains genetic engineering bacterium, be inoculated in substratum, cultivate the back expression through induced growth.
This two-way abduction delivering plasmid as certain genomic library of vector construction after, can be used for genetic expression screening and the environmental factors inducible gene expression screening of substrate for induction.
This two-way abduction delivering plasmid host transformed bacterium can be intestinal bacteria E.coli JM109, E.coli DH5 α.
Can obtain containing the bacterial classification of this two-way abduction delivering plasmid behind this plasmid transformation escherichia coli; This bacterial classification on July 14th, 2010 in China Committee for Culture Collection of Microorganisms's common micro-organisms center preservation; Preserving number is CGMCC NO.4004, classification called after ETEC Escherichia coli.
Preserve the method for this two-way abduction delivering plasmid: it is transformed get into escherichia coli Escherichia coli,, perhaps be dissolved in the redistilled water, in preserving below 0 ℃ in preserving below 0 ℃.
The present invention provides two-way abduction delivering plasmid, is used for SIGEX and can makes and clone on this carrier positive and negative both direction and can receive the inductive gene fragment all to obtain report, improves the screening efficiency of SIGEX.
Description of drawings
Fig. 1 is the synoptic diagram of two-way abduction delivering plasmid p18BG
Fig. 2 is the screening process of SIGEX technology to environment unit genomic library
Fig. 3 is the structure flow process of two-way abduction delivering plasmid p18BG
Fig. 4 is that flow cytometer is to the genomic library prescreen figure of environment unit
Fig. 5 for flow cytometer to through prescreen and the genomic library screening figure of the environment after inducing unit
Embodiment
Through making up two-way abduction delivering plasmid p18BG the present invention is done further elaboration below, but do not limit the scope of the invention.
The structure of recombinant plasmid p18BG:
With gfp and egfp recombination to the pUC18 plasmid vector, so that gfp and egfp gene place restriction enzyme site both sides and respectively under the regulation and control of separately promotor, obtain a kind of two-way abduction delivering plasmid p18BG.For this reason, we utilize polymerase chain reaction (PCR) technology to obtain the gfp gene fragment from the expansion of pGFP plasmid, and design BamH I and sph I restriction enzyme site at its two ends.Utilize the aforementioned gfp gene fragment that obtains of restriction enzyme BamH I and sph I double digestion digestion, and enzyme is cut the resulting gfp gene fragment in back link to each other, obtain recombinant plasmid p18GFP with the vector plasmid pUC18 that cuts through same enzyme.Then utilize round pcr to obtain the egfp gene fragment again, and design BamH I and Kpn I restriction enzyme site at its two ends from the amplification of pEGFP plasmid.Utilize the aforementioned egfp gene fragment that obtains of restriction enzyme BamH I and Kpn I double digestion digestion, and enzyme is cut the resulting egfp gene fragment in back link to each other, obtain recombinant plasmid p18BG with the vector plasmid p18GFP that cuts through same enzyme.
The enzyme that relates in the present embodiment is cut, the preparation of connection, competent cell, electric shock transform the equimolecular biological method all with reference to " Molecular Cloning-A laboratory Mannual " ed.by J.Sambrook; E.F.Fritsch and T.Maniatis; 1989, CSHL Press.
The related research material of present embodiment sees the following form
GFP-F：
5’-GGGGATCCTAATTAATTAAGAAGGAGATATACATATGAGTAAAGGAGAAGAAC-3’；
GFP-R:5 '-GCTTGCATGCTTAGTATAGTTCATCCATGC-3 ' carries out pcr amplification; Behind the PCR product purification test kit recovery purifying of amplified production with hundred Imtech; With restriction enzyme BamH I and Sph I the PCR product is carried out complete degestion, reclaim green fluorescence protein gene (gfp) fragment of the 700bp that produces after purifying enzyme is cut with the PCR product purification test kit of hundred Imtech.
Step 2. is with restriction enzyme BamH I and Sph I digested plasmid pUC18.Enzyme reaction is used phenol respectively, phenol after finishing: chloroform (1: 1) extracting enzyme reaction solution, and to remove the zymoprotein in the reaction solution.Add the absolute ethyl alcohol deposit D NA of two volumes afterwards, DNA heavily is dissolved in the redistilled water.
Through phenol, phenol: chloroform (1: 1) after the extracting, adds the absolute ethyl alcohol deposit D NA of two volumes respectively to step 4., and DNA heavily is dissolved in the 5 μ l redistilled waters with the connection mixed solution of step 3.Click the competent cell of Transformed E .coli JM109 with the resuspended DNA of 1 μ l.Containing 100 μ g/mL Ampicillin Trihydrates, and be coated with on the LB substratum of 40 μ l X-Gal (20mg/ml) and 7 μ l IPTG (100mg/ml) and obtain transformant.Picking white colony extracting DNA and enzyme are cut evaluation after the incubated overnight, confirm to contain in the DNA of transformed bacteria the external source gfp gene fragment of 700bp, this plasmid called after p18GFP.
EGFP-F：5’-CGGGATCCTAATTAATTAAGAAGGAGATATACATATGGTGAGCAAGGGCGAG
GAGCT-3 '; EGFP-R:5 '-GCTTGCATGCTTACTTGTACAGCTGCTCCATGCC-3 ' carries out pcr amplification; Behind the PCR product purification test kit recovery purifying of amplified production with hundred Imtech; With restriction enzyme BamH I and Kpn I the PCR product is carried out complete degestion, reclaim enhanced green fluorescence protein gene (egfp) fragment of the 700bp that produces after purifying enzyme is cut with the PCR product purification test kit of hundred Imtech.
Step 6. is with restriction enzyme BamH I and Kpn I digested plasmid p18GFP.Enzyme reaction is used phenol respectively, phenol after finishing: chloroform (1: 1) extracting enzyme reaction solution, and to remove the zymoprotein in the reaction solution.Add the absolute ethyl alcohol deposit D NA of two volumes afterwards, DNA heavily is dissolved in the redistilled water.
Through phenol, phenol: chloroform (1: 1) after the extracting, adds the absolute ethyl alcohol deposit D NA of two volumes respectively to step 8., and DNA heavily is dissolved in the 5 μ l redistilled waters with the connection mixed solution of step 7.Competent cell with the resuspended DNA electric shock Transformed E .coli JM109 of 1 μ l.Containing 100 μ g/mL Ampicillin Trihydrates, and be coated with on the LB substratum of 7 μ l IPTG (100mg/ml) and obtain transformant.The bacterium colony extracting DNA and the enzyme that do not send green fluorescence under the picking UV-irradiation after the incubated overnight are cut evaluation, confirm to contain in the DNA of transformed bacteria the external source egfp gene fragment of 700bp, this plasmid called after p18BG.
With recombinant plasmid p18BG is the environment unit genomic library construction of carrier:
With plasmid p18BG with restriction enzyme BamH I complete degestion after dephosphorylation be prepared into linear p18BG carrier, extract the total DNA in the environmental sample, after BamH I is partially digested, be connected with aforementioned linear p18BG carrier with the T4 ligase enzyme.Connect product Transformed E .coli JM109 competent cell, transformant is inoculated in the LB substratum that contains the Ampicillin Trihydrate, and 37 ℃ jolt and promptly make up successful environment unit genomic library after the overnight cultures.
This experimental procedure reference Taku Uchiyama et al, Nature Protocol 2008,3 (7): 1202～1212.
Step 2. is carried out partially digested to the genomic dna that obtains in the step 1 with restriction enzyme BamH I, and control final enzyme and cut product length at 5～10kb, cuts 5～10kb fragment that the back produces with the glue recovery test kit recovery genomic dna enzyme of hundred Imtech.
Step 4. is mixed the linearizing p18BG carrier DNA that the genomic dna that obtained by step 2 and step 3 obtain, and adds the T4DNA ligase enzyme, in 16 ℃ of reactions 12 hours.
Through phenol, phenol: chloroform (1: 1) after the extracting, adds the absolute ethyl alcohol deposit D NA of two volumes respectively to step 5., and DNA heavily is dissolved in the 5 μ l redistilled waters with the connection mixed solution of step 3.Click the competent cell of Transformed E .coli JMl09 with the resuspended DNA of 1 μ l.37 ℃ of overnight cultures in the LB liquid nutrient medium that contains 100 μ g/mL Ampicillin Trihydrates.
The prescreen of environment unit genomic library:
The intestinal bacteria that environment unit genomic library is comprised are screened with flow cytometer, and clone's that sends green fluorescence that abandons as shown in Figure 4 is collected clone's that does not send green fluorescence, is the environment unit genomic library behind the prescreen.
This experimental procedure reference Taku Uchiyama et al, Nature Protocol 2008,3 (7): 1202～1212.
The bacterium of overnight cultures is diluted to 10 with the PBS damping fluid
6/ mL screens it with flow cytometer, and clone's that sends green fluorescence that abandons as shown in Figure 4 is collected clone's about 3 * 10 that does not send green fluorescence
6Individual, this is the environment unit genomic library behind the prescreen.
The substrate for induction of environment unit genomic library and positive colony screening:
Environment behind prescreen unit genomic library is inoculated in the dLB substratum, when cultivating OD
600Add when reaching 0.6-0.8 and induce substrate, continue overnight cultures.Will be through prescreen and the intestinal bacteria that comprised of the unit of the environment after inducing genomic library screen with flow cytometer, clone's that does not send green fluorescence that abandons as shown in Figure 5 is collected clone's that sends green fluorescence and is coated on the LB plate culture medium.Detect clone's on the flat board with ultraviolet light, picking does not send clone's of green fluorescence and analyzes.Wherein do not send green fluorescence under the substrate condition not adding to induce, and induce clone's that sends green fluorescence under the substrate condition to be positive colony adding, extract its plasmid and sequencing analysis.
This experimental procedure reference Taku Uchiyama et al, Nature Protocol 2008,3 (7): 1202～1212.
Microbionation behind the prescreen in the dLB liquid nutrient medium that contains the Ampicillin Trihydrate, is cultivated OD for 30 ℃
600Add when reaching 0.6-0.8 and induce substrate, continue overnight cultures.Overnight culture is diluted to 10 with the PBS damping fluid
6/ mL screens it with flow cytometer.Clone's that does not send green fluorescence that abandons as shown in Figure 5, collection is sent 500～1000 of clone's of green fluorescence and is coated on the LB plate culture medium that contains the Ampicillin Trihydrate.After 37 ℃ of overnight cultures, detect clone's on the flat board with ultraviolet light, picking does not send clone's of green fluorescence and analyzes.Wherein do not send green fluorescence under the substrate condition not adding to induce, and induce clone's that sends green fluorescence under the substrate condition to be positive colony adding, extract its plasmid and sequencing analysis.
SEQUENCE?LISTING
< 110>Chengdu Inst. of Biology, Chinese Academy of Sciences
< 120>a kind of two-way abduction delivering plasmid, its construction process and purposes
< 130>specification sheets
<160>4
<170>PatentIn?version?3.3
<210>1
<211>53
<212>DNA
<213>Escherichia?coli
<400>1
ggggatccta?attaattaag?aaggagatat?acatatgagt?aaaggagaag?aac 53
<210>2
<211>30
<212>DNA
<213>Escherichia?coli
<400>2
gcttgcatgc?ttagtatagt?tcatccatgc 30
<210>3
<211>57
<212>DNA
<213>Escherichia?coli
<400>3
cgggatccta?attaattaag?aaggagatat?acatatggtg?agcaagggcg?aggagct 57
<210>4
<211>34
<212>DNA
<213>Escherichia?coli
<400>4
gcttgcatgc?ttacttgtac?agctgctcca?tgcc 34
Claims (5)
1. a two-way abduction delivering plasmid vector is characterized in that comprising green fluorescence protein gene and enhanced green fluorescence protein gene.
2. the construction process of two-way abduction delivering plasmid as claimed in claim 1; It is characterized in that adopting the method for recombination; Make green fluorescence protein gene and enhanced green fluorescence protein gene place restriction enzyme site both sides and respectively under the regulation and control of separately promotor, obtain two-way abduction delivering plasmid.
3. like the phraseology of right 1 described two-way abduction delivering plasmid, but it is characterized in that connecting induced gene, and after transformed into escherichia coli obtains genetic engineering bacterium, be inoculated in substratum, cultivate the back expression through induced growth at the restriction enzyme site place.
4. the purposes of two-way abduction delivering plasmid as claimed in claim 1 in substrate for induction genetic expression screening and the screening of environmental factors inducible gene expression.
5. a method of preserving the described two-way abduction delivering plasmid of claim 1 is characterized in that it is transformed entering escherichia coli (Escherichia coli), in preserving below 0 ℃, perhaps is dissolved in the redistilled water, in preserving below 0 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102392521A CN102337283A (en) | 2010-07-28 | 2010-07-28 | Bidirectional induction expression plasmid and construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102392521A CN102337283A (en) | 2010-07-28 | 2010-07-28 | Bidirectional induction expression plasmid and construction method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102337283A true CN102337283A (en) | 2012-02-01 |
Family
ID=45513234
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102392521A Pending CN102337283A (en) | 2010-07-28 | 2010-07-28 | Bidirectional induction expression plasmid and construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102337283A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103865943A (en) * | 2014-02-24 | 2014-06-18 | 南京仙奕基因科技有限公司 | Novel T vector and application method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101544976A (en) * | 2009-05-06 | 2009-09-30 | 北京林业大学 | Bidirectional promoter bi-visual fluorescent protein report gene plant expression vector |
-
2010
- 2010-07-28 CN CN2010102392521A patent/CN102337283A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101544976A (en) * | 2009-05-06 | 2009-09-30 | 北京林业大学 | Bidirectional promoter bi-visual fluorescent protein report gene plant expression vector |
Non-Patent Citations (5)
| Title |
|---|
| DE LORENZO V ET AL: "Problemswith metagenomic screening", 《NAT BIOTECHNOL》, 31 December 2005 (2005-12-31), pages 1045 * |
| UCHIYAMA T ET AL: "Substrate2induced gene2exp ression screening of environmentalmetagenome libraries for isolation of catabolic genes", 《NAT BIOTECHNOL》, 31 December 2005 (2005-12-31), pages 88 - 93 * |
| 徐士庆等: "深海沉积物微生物元基因组文库来源的新的酯酶基因的克隆、表达及酶学性质", 《微生物学报》, 4 July 2010 (2010-07-04), pages 891 - 895 * |
| 徐晓宇等: "环境微生物基因组技术研究进展", 《生物技术通报》, 31 December 2006 (2006-12-31) * |
| 李武等: "元基因组文库分析技术研究进展", 《生态学报》, 30 May 2007 (2007-05-30), pages 2070 - 2073 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103865943A (en) * | 2014-02-24 | 2014-06-18 | 南京仙奕基因科技有限公司 | Novel T vector and application method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hernanz-Koers et al. | FungalBraid: A GoldenBraid-based modular cloning platform for the assembly and exchange of DNA elements tailored to fungal synthetic biology | |
| Hynes et al. | DNA packaging bias and differential expression of gene transfer agent genes within a population during production and release of the Rhodobacter capsulatus gene transfer agent, RcGTA | |
| Jin et al. | Construction of a shuttle vector using an endogenous plasmid from the cyanobacterium Synechocystis sp. PCC6803 | |
| CN105296486A (en) | Promoter library construction method and strong promoter | |
| CN101413010B (en) | Plasmids for transforming bacteria of the Acidithobacillus spp. genus, and transformation method | |
| WO2017045281A1 (en) | Vibrio universal suicide vector for gene knockout and use thereof | |
| CN106947766A (en) | A kind of bacillus subtilis has DNA fragmentation and its application of promoter function | |
| CN103626852B (en) | A kind of AraC mutant protein and application thereof | |
| CN105400809A (en) | Cloning vector and preparation and application thereof | |
| CN103865944B (en) | A kind of produce riboflavin coli strain and construction process and purposes | |
| CN104593312A (en) | Genetic engineering bacterial strain for expressing bacillus subtilis laccase in strain cell and method for realizing secreting and expressing laccase in bacterial strain | |
| CN105505975A (en) | Bacillus gene traceless knockout/knockin plasmid and method, and kit | |
| CN103642743A (en) | Method for producing alpha-phenylpyruvic acid efficiently through whole cell transformation | |
| CN103160528A (en) | Enhanced monomer bacterial luciferase gene luxAB and application | |
| CN103898135B (en) | A kind of double T-DNA expression vector of acquisition non selecting sign transgene biology of optimization and application thereof | |
| CN101475954A (en) | Preparation of recombinant spore with surface for displaying lipase having catalytic activity | |
| CN106086025A (en) | A kind of DNA fragmentation with promoter function and application thereof | |
| CN102337283A (en) | Bidirectional induction expression plasmid and construction method and application thereof | |
| CN102559760B (en) | Construction method for linearized shuttle vector BmBacmid | |
| CN102311970A (en) | Expression cassette mazF-cassette for expressing escherichia coli toxin protein mazF gene and construction method and application thereof | |
| CN101182533B (en) | Design and construction method of high efficiency temperature controlled positive screening cloning carrier | |
| CN102286515A (en) | Method for constructing T vector | |
| CN102234660A (en) | Method for constructing saccharopolyspora erythraea expression plasmid (pBlueV) containing vitreoscilla hemoglobin gene (vgb) | |
| CN101230329A (en) | Bacillus licheniformis industrial production strain genetic transformation method | |
| CN104513830A (en) | Gene expression vector applicable to gluconobacter oxydans and application of gene expression vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120201 |