CN101544976A - Bidirectional promoter bi-visual fluorescent protein report gene plant expression vector - Google Patents
Bidirectional promoter bi-visual fluorescent protein report gene plant expression vector Download PDFInfo
- Publication number
- CN101544976A CN101544976A CN200910083479A CN200910083479A CN101544976A CN 101544976 A CN101544976 A CN 101544976A CN 200910083479 A CN200910083479 A CN 200910083479A CN 200910083479 A CN200910083479 A CN 200910083479A CN 101544976 A CN101544976 A CN 101544976A
- Authority
- CN
- China
- Prior art keywords
- enzyme recognition
- recognition sequence
- sequence
- expression vector
- fluorescent protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a bidirectional promoter bi-visual fluorescent protein report gene plant expression vector. The promoter bi-visual fluorescent protein report gene plant expression vector is a recombinant expression vector of which the multiple cloning sites of an initial vector are inserted with the following DNA molecules: an EcoRI enzyme recognition sequence, an NoS terminator, an SacI enzyme recognition sequence, a kpnI enzyme recognition sequence, a red fluorescent protein gene, an SmalI enzyme recognition sequence, a BamHI enzyme recognition sequence, an XbalI enzyme recognition sequence, a bidirectional promoter, an XholI enzyme recognition sequence, an SpeI enzyme recognition sequence, a green fluorescent protein, an HindIII enzyme recognition sequence, an HpaI enzyme recognition sequence, an SalI enzyme recognition sequence, an NoS terminator and a Clal contained in turn from 5' end; and the nucleotide sequence of the bidirectional promoter is from the 5917th site to the 6834th site from the 5' end in a sequence 1 of a sequence list. The bidirectional promoter bi-visual fluorescent protein report gene plant expression vector can be applied to fusing functional genes by simple operation of direct enzyme cutting and connection.
Description
Technical field
The present invention relates to bidirectional promoter bi-visual fluorescent protein report gene plant expression vector.
Background technology
The conversion carrier that contains two or more genes plays an important role in gene therapy and the application of acquisition good character transgenosis body.The transgene carrier of a common above gene of expression comprises a plurality of promotors, internal ribosome entry site element (IRES), splicing signal and fusion rotein.But use a plurality of promotors may have two problems such as interaction, promotor silence, carriers rearrangement or deletion between the promotor.
Bidirectional promoter can be regulated the gene in two downstreams and receive great concern.Usually, two genes arranging in mode head to head, Nucleotide less than 1000bp is arranged between their transcription initiation sites approximately, this gene inside is less than the long Nucleotide zone of 1kb, both sides are all contained transcription initiation site TSS (gene normal chain has TSS on one side, Yi Bian the gene minus strand also has TSS) and are defined as bidirectional promoter.Bidirectional promoter can be regarded as two the shared same genome of unilateral initiative spaces simply.Bidirectional promoter all has in unicellular lower eukaryote intestinal bacteria, Penicillium notatum, aspergillus tubigensis, Escherichia, trypanosome and higher organism plant, animal, the mankind to be found and uses.
Summary of the invention
The purpose of this invention is to provide a kind of bidirectional promoter bi-visual fluorescent protein report gene plant expression vector.
Bidirectional promoter bi-visual fluorescent protein report gene plant expression vector provided by the present invention is the recombinant expression vector that inserts following dna molecular in the multiple clone site of the carrier that sets out:
Contain EcoRI enzyme recognition sequence, NoS terminator, SacI enzyme recognition sequence, kpnI enzyme recognition sequence, red fluorescent protein gene, SmalI enzyme recognition sequence, BamHI enzyme recognition sequence, XbalI enzyme recognition sequence, bidirectional promoter, XholI enzyme recognition sequence, SpeI enzyme recognition sequence, green fluorescent protein, HindIII enzyme recognition sequence, HpaI enzyme recognition sequence, SalI enzyme recognition sequence, NoS terminator and Clal enzyme recognition sequence successively from 5 ' end; The nucleotides sequence of described bidirectional promoter is classified in the sequence table sequence 1 as from 5 ' terminal 5917-6834 position.
The nucleotides sequence of described dna molecular is classified sequence 1 in the sequence table as from 5 ' terminal 4536-7858 position.
The described carrier that sets out can be for the various expression vectors that obtain from commercial channels, as Yeast expression carrier, plant expression vector or coli expression carrier etc.The nucleotide sequence of described recombinant expression vector can be the sequence 1 in the sequence table.
Described dna molecular also belongs to protection scope of the present invention.
The transgenic cell or the reorganization bacterium that contain described dna molecular, described recombinant expression vector also belong to protection scope of the present invention.
Bidirectional promoter bi-visual fluorescent protein report gene plant expression vector of the present invention possesses the purpose that just can be used for the fusion function gene by direct enzyme cutting connection simple operations.
Bidirectional promoter bi-visual fluorescent protein report gene plant expression vector of the present invention infects tobacco, obtain transgenic tobacco plant, through checking, the fluorescence report gene gfp and the DsRed of both direction are expressed, illustrate that this carrier bidirectional promoter has the transcriptional activity of both direction, foreign gene can be replaced any one reporter gene by restriction enzyme site, thereby carrying out recombinant expression vector easily makes up, the recombinant expression vector that makes up can be expressed target protein and fluorescin simultaneously, is convenient to screening.
Description of drawings
Fig. 1 is the PCR electrophorogram of AD.
Fig. 2 cuts evaluation figure for the pBD-AD-930 enzyme.
Fig. 3 is universal plant bidirectional promoter expression vector collection of illustrative plates.
Fig. 4 is the expression of results of GFP and dsRed in transgene tobacco and the contrast.
Embodiment
Among the following embodiment if no special instructions method therefor be ordinary method, agents useful for same all can obtain from commercial channels.
Make up universal plant bidirectional promoter expression vector
On pBI121 carrier basis, change the p131 plasmid that the gus gene obtains with the gfp gene, be template with the p131 plasmid, D1, D2 are the one section sequence of primer PCR amplification Pmini to terminator:
D1：5’-AAGCTTGGTACCCCTTCGCAAGACCCTTC-3’，
D2：5’-GAAGCTTGTCACTGGATTTTGGTTTTAGG-3’。
The pcr amplification condition is: pre-94 ℃ of 5mins of sex change; 94 ℃ of 30s, 67 ℃ of 30s, 72 ℃ of 1min, 25 circulations; 72 ℃ of 10mins; 4 ℃ of preservations.
The PCR product is reclaimed, be connected, make up cloning vector pT-MGN, on the LB substratum, carry out blue hickie screening with pMD18 T-Vector.The several hickies of picking are cultivated, and extract plasmid, after the HindIII enzyme is cut preliminary identification, and send company's order-checking.HindIII enzyme cutting clone carrier pT-MGN is usefulness again, reclaims 1.3kb purpose fragment, is connected with the pBI121 plasmid that the HindIII enzyme is cut, and makes up the plant binary expression vector pBDGG of two-way pair of reporter gene.
Design primer a, b, c and d, their nucleotide sequence is as follows:
a：5’-GGTCTAGACTCGAGAGGAGGGTCGACGTCCGCAAAAATCACCAGTC-3’；
b：5’-GTGACCATGATTACGCCAGGGTTGTCACTGGATTTTGG-3’；
c：5’-GCCAAAATCCAGTGACAACCCTGGCGTAATCATGGTCA-3’；
d：5’-GGATCGATGGTTTCATTGGTGACG-3’。
Wherein, the recognition sequence that has XbalI, XholI, SalI and noster among the primer a;
HindIII site (the aggcct → agggtt) that contains sudden change among the primer b;
Primer c and primer b are two primers of reverse complemental;
Contain the Clal enzyme recognition sequence among the primer d.
With a and b is primer, is template with carrier pBDGG, pcr amplification, the PCR product called after AB that obtains;
Reaction system is: cumulative volume 100 μ l, and template 100ng, primer a15pmol, primer b15pmol, 10 * PCR damping fluid, 10 μ l, 10 * dNTP, 10 μ l, Taq enzyme 2.5U, all the other are aqua sterilisa.
With c and d is primer, is the template pcr amplification with carrier pBDGG, the PCR product called after CD that obtains.
Reaction system is: cumulative volume 100 μ l, and template 100ng, primer c15pmol, primer d15pmol, 10 * PCR damping fluid, 10 μ l, 10 * dNTP, 10 μ l, Taq enzyme 2.5U, all the other are aqua sterilisa.
The mixed template of doing of AB and CD equivalent is the primer PCR amplification with a and d, obtains PCR product called after AD.
Reaction system is: cumulative volume 100 μ l, and template 100ng, primer c15pmol, primer d15pmol, 10 * PCR damping fluid, 10 μ l, 10 * dNTP, 10 μ l, Taq enzyme 2.5U, all the other are aqua sterilisa.
Above-mentioned PCR response procedures: 94 ℃ of 5min, annealing temperature is respectively 65 ℃, 63 ℃, 61 ℃, 59 ℃, 57 ℃, 55 ℃ and 72 ℃, and 10min is extended in totally 30 circulations at last.
The electrophoresis result of AD as shown in Figure 2, among Fig. 2, M1:100bp DNA Laber, 2 and 3:PCR product A D, M2:15000 molecular weight standard.
Through the AD of XbaI and ClaI double digestion be connected with the carrier pBDGG of same double digestion, make up recombinant vectors pBD-AD.
EcoRI and SacI double digestion carrier pBDGG, the fragment of recovery 2839bp is connected with the carrier pUC18 of same double digestion, makes up recombinant vectors pUC-E-S.XbaI and XhoI double digestion pUC-E-S, the fragment of recovery 930bp is connected with the pET30a of same double digestion, makes up recombinant vectors pET-930.
With recombinant vectors pET-930 KpnI, HindIII is two cut after, reclaim with ethanol sedimentation, handle with T4 DNAPolymerase and Klenow Fragment, these 2 restriction enzyme sites promptly disappear.
KpnI, HindIII double digestion system 100ul: plasmid pET-930 110ug, Kpn I5ul, HindIII 3ul, 10 * M buffer 10ul, all the other are aqua sterilisa.37 ℃, 3 hours.The 3M sodium-acetate (pH5.2) that adds 1/10 volume behind double digestion in the system adds the dehydrated alcohol of 2 times of volumes again, and-20 ℃, 20min, 12000rpm, centrifugal 10min abandons supernatant, uses 70% ethanol rinsing post precipitation air-dry again.The DNA of post precipitation is handled with T4DNApolymerase, it is as follows that the 25ul enzyme is cut system: DNA 4ug, 10 * T4DNApolymerase buffer2.5ul, 0.1% BSA 2.5ul, 2.5mM dNTP2.5ul, all the other are aqua sterilisa for T4 DNApolymerase 0.3ul.37 ℃, 5min, phenol/chloroform is handled, and ethanol sedimentation reclaims, and connects with the T4 ligase enzyme again, transforms the JM109 competence, extracts plasmid.Plasmid is cut with the HindIII enzyme, handles with Klenow Fragment again, and the 25ul system is as follows: plasmid 500ng, and 10 * buffer2.5ul, dNTP final concentration 0.1mM, klenow fragment 0.5U, aqua sterilisa is mended to 25ul,, 37 ℃, 15min.Phenol/chloroform is handled, and ethanol sedimentation reclaims, and connects with the T4 ligase enzyme again, transforms the JM109 competence, extracts plasmid.
P1:GCCCGGGATGAAGCTTGCCTCCTCCGA (containing the SmaI recognition sequence);
P2:GGGAGCTCGGTACCCTAGGTTAGTGGTGGTGGTG (containing KpnI and SacI recognition sequence);
P3:GGCTCGAGACTAGTATGGTGAGCAAGGGCGAGG (containing XhoI and SpeI recognition sequence);
P4:GGGTCGACGTTAACAAGCTTTTACTTGTACAGCTCGTCC (containing HindIII, HpaI and SalI recognition sequence).
(CLOTECH USA) is template, primer P1, the P2 red fluorescence gene dsRed that is used for increasing with pDsRed2-C1;
The PCR response procedures is: 94 ℃ of sex change 30s, and 65 ℃ of annealing 30s, 72 ℃ are extended 50s, totally 30 circulations.
(CLOTECH USA) is template, primer P3, the P4 green fluorescence gene gfp that is used for increasing with pEGFP-N1.
The PCR response procedures is: 94 ℃ of sex change 30s, and 60 ℃ of annealing 30s, 72 ℃ are extended 50s, totally 30 circulations.
Detect the PCR product with 0.8% agarose gel electrophoresis, glass milk reclaims the PCR product that test kit reclaims, and is connected with the pMD18-T carrier respectively, makes up recombinant vectors T-GFP and T-dsRed.
SacI and SmaI double digestion T-dsRed, the fragment of recovery 735bp is connected with the carrier pBD-AD of same double digestion, obtains carrier pBD-AD-Red; XbalI and XholI double digestion pET-930 reclaim the fragment of 930bp, and insert carrier T-GFP, connect carrier construction T-GFP-930; XbaI and SalI double digestion are cut T-GFP-930 and pBD-AD-Red, reclaim the fragment of 1726bp and 12903bp, they are connected obtain universal plant bidirectional promoter expression vector, and its carrier collection of illustrative plates as shown in Figure 3.
2) universal bidirectional promoter expression vector transformation of tobacco
Universal plant bidirectional promoter expression vector electric shock is transformed the competent cell of Agrobacterium LBA4404, adding 1ml YEB liquid nutrient medium cultivated 3 hours for 28 ℃, get 200 μ l and be coated with YEB resistant panel (kantlex 50mg/l, Rifampin 50mg/l), 28 ℃ of cultivations, the reorganization Agrobacterium of acquisition are used for tobacco and transform.Method is with reference to " plant genetic engineering ".The transgene tobacco that obtains detects the expression of green fluorescent protein and red fluorescent protein with fluorescent microscope (OLYMPUS BX-61).With wild-type tobacco in contrast.
Fluorescent microscope result such as Fig. 4, green fluorescent protein and red fluorescent protein all have expression in transgene tobacco.Illustrate that universal bidirectional promoter expression vector of the present invention can make foreign gene express in plant.
A among Fig. 4: contrast; B: transgene tobacco.
Sequence table
＜110〉Beijing Forestry University
＜120〉bidirectional promoter bi-visual fluorescent protein report gene plant expression vector
<160>1
<210>1
<211>14629
<212>DNA
＜213〉artificial sequence
<220>
<230>
<400>1
Claims (6)
1, a kind of dna molecular contains EcoRI enzyme recognition sequence, NoS terminator, SacI enzyme recognition sequence, kpnI enzyme recognition sequence, red fluorescent protein gene, SmalI enzyme recognition sequence, BamHI enzyme recognition sequence, XbalI enzyme recognition sequence, bidirectional promoter, XholI enzyme recognition sequence, SpeI enzyme recognition sequence, green fluorescent protein, HindIII enzyme recognition sequence, HpaI enzyme recognition sequence, SalI enzyme recognition sequence, NoS terminator and Clal enzyme recognition sequence successively from 5 ' end; The nucleotides sequence of described bidirectional promoter is classified in the sequence table sequence 1 as from 5 ' terminal 5917-6834 position.
2, dna molecular according to claim 1 is characterized in that: the nucleotides sequence of described dna molecular is classified in the sequence table sequence 1 as from 5 ' terminal 4536-7858 position.
3, the recombinant expression vector that contains claim 1 or 2 described dna moleculars.
4, recombinant expression vector according to claim 3 is characterized in that: the nucleotides sequence of described recombinant expression vector is classified the sequence 1 in the sequence table as.
5, the transgenic cell or the reorganization bacterium that contain claim 1 or 2 described dna moleculars, claim 3 or 4 described recombinant expression vectors.
6, claim 3 or 4 application of described recombinant expression vector in exogenous protein expression.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100834799A CN101544976B (en) | 2009-05-06 | 2009-05-06 | Bidirectional promoter bi-visual fluorescent protein report gene plant expression vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100834799A CN101544976B (en) | 2009-05-06 | 2009-05-06 | Bidirectional promoter bi-visual fluorescent protein report gene plant expression vector |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101544976A true CN101544976A (en) | 2009-09-30 |
| CN101544976B CN101544976B (en) | 2011-07-20 |
Family
ID=41192354
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100834799A Expired - Fee Related CN101544976B (en) | 2009-05-06 | 2009-05-06 | Bidirectional promoter bi-visual fluorescent protein report gene plant expression vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101544976B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102337283A (en) * | 2010-07-28 | 2012-02-01 | 中国科学院成都生物研究所 | Bidirectional induction expression plasmid and construction method and application thereof |
| CN108220313A (en) * | 2018-01-12 | 2018-06-29 | 辽宁科技大学 | A kind of fusion expression method of green fluorescent protein |
| CN111394385A (en) * | 2020-03-30 | 2020-07-10 | 扬州大学 | Method for rapidly identifying bidirectional promoter of rice |
| CN114686483A (en) * | 2014-06-16 | 2022-07-01 | 约翰斯·霍普金斯大学 | Compositions and methods for expressing CRISPR guide RNA using H1 promoter |
-
2009
- 2009-05-06 CN CN2009100834799A patent/CN101544976B/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102337283A (en) * | 2010-07-28 | 2012-02-01 | 中国科学院成都生物研究所 | Bidirectional induction expression plasmid and construction method and application thereof |
| CN114686483A (en) * | 2014-06-16 | 2022-07-01 | 约翰斯·霍普金斯大学 | Compositions and methods for expressing CRISPR guide RNA using H1 promoter |
| US11896679B2 (en) | 2014-06-16 | 2024-02-13 | The Johns Hopkins University | Compositions and methods for the expression of CRISPR guide RNAs using the H1 promoter |
| CN108220313A (en) * | 2018-01-12 | 2018-06-29 | 辽宁科技大学 | A kind of fusion expression method of green fluorescent protein |
| CN111394385A (en) * | 2020-03-30 | 2020-07-10 | 扬州大学 | Method for rapidly identifying bidirectional promoter of rice |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101544976B (en) | 2011-07-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Goderis et al. | A set of modular plant transformation vectors allowing flexible insertion of up to six expression units | |
| CN101544976A (en) | Bidirectional promoter bi-visual fluorescent protein report gene plant expression vector | |
| CN101139615B (en) | Method for quickly and highly effectively constructing mammal cell RNA interference carrier and its checking carrier | |
| CN101418311A (en) | A kind of structure and screening method of new rna interference vector | |
| Vlad et al. | A modular steroid-inducible gene expression system for use in rice | |
| CN103732747A (en) | Method for identification and isolation of terminator sequences causing enhanced transcription | |
| Lee et al. | Translation start sequences affect the efficiency of silencing of Agrobacterium tumefaciens T-DNA oncogenes | |
| CN103667296B (en) | A composition type expression promoter and application thereof | |
| CN101880665B (en) | Promoter of rice root hair development control gene OsRHL1 and application thereof | |
| Hermann et al. | pYLZ vectors: Saccharomyces cerevisiae/Escherichia coli shuttle plasmids to analyze yeast promoters | |
| Zhang et al. | Construction and analysis of a plant transformation binary vector pBDGG harboring a bi-directional promoter fusing dual visible reporter genes | |
| AU2014329590B2 (en) | Zea mays metallothionein-like regulatory elements and uses thereof | |
| Meyer et al. | Vectors for RNAi technology in poplar | |
| Nguyen et al. | Bacteriophage T7 RNA polymerase‐directed, inducible and tissue‐specific over‐expression of foreign genes in transgenic plants | |
| CN109207510B (en) | Construction method of monocotyledon miRNA (micro ribonucleic acid) efficient silencing vector | |
| CN110628799A (en) | Construction method and application of bacterial promoter report vector | |
| CN106148344A (en) | A kind of have 5 ' UTR sequence and the application thereof strengthening gene expression in plants activity | |
| US11390877B2 (en) | Blue-grained genes in wheat and application thereof | |
| CN101294165B (en) | Method for constructing pROKII plant bivalent expression vector and used general primer thereof | |
| CN105316333A (en) | Identification and application of plant anther specific expression promoter pTaASG005 | |
| Mardanova et al. | The 5′-untranslated region of the maize alcohol dehydrogenase gene provides efficient translation of mRNA in plants under stress conditions | |
| CN116083432B (en) | Mulberry U6 promoter and application thereof | |
| Dong et al. | Construction of a new type of multi-gene plant transformation vector and genetic transformation of tobacco | |
| CN102676457A (en) | Function and application of flower-specific expression promoter KT631P | |
| CN101407823B (en) | Method for constructing yeast bivalent universal expression vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110720 Termination date: 20140506 |