CN101880665B - Promoter of rice root hair development control gene OsRHL1 and application thereof - Google Patents

Abstract

The invention discloses a promoter of a rice root hair development control gene OsRHL1 and application thereof. The promoter is a nucleotide sequence as shown by SEQ ID No. 1. The invention also discloses the application of the promoter of the rice root hair development control gene OsRHL1 in the construction of transgenic rice. The promoter can be used for starting the specific expression of a downstream coding gene in a rice root hair cell.

Description

A kind of promotor of rice root hair development control gene OsRHL 1 and application thereof

Technical field

The invention belongs to plant genetic engineering field.Specifically, the present invention relates to clone the upstream promoter sequence of rice Os RHL1 (rice roothairless 1) gene coding region, and the purposes of this upstream promoter.

Background technology

Root system is the vitals of plant absorbing moisture, nutrient, and Gen Mao is the important component part at root system of plant function section physiologically active interface.The structure of plant root tip comprises four parts: root cap, meristematic zone, elongation zone and maturation zone.Begin to occur morphological differences at meristematic zone root hair cell and non-root hair cell; Having arrived elongation zone root hair begins to form; Ripe and the differentiation fully of trichoblast in the maturation zone, the growth of root hair also reaches ripe (Dolan et al., 1993).The root hair is some tubular protrusions on the epiblem cell, and the root hair process of educating roughly can be divided into specialization of epidermic cell, initial, tip-growth and ripe 4 stages (Gilroy and Jones, 2000).

The existence of root hair can effectively enlarge the contact area of epidermic cell and rhizosphere soil, help improving root system absorb moisture and mineral nutrition in the soil efficient and with the mutual work (Grierson and Schiefelbein, 2002) of soil microorganisms.The research of plant root hair genesis and development and nutrition absorption has in recent years obtained bigger progress.Present research mainly is based on the root hair related mutants unfolded of dicotyledonous model plant Arabidopis thaliana (Arabidopsis thaliana), and is that the root hair life system research of gramineous crop of model plant is less with paddy rice (Oryzasativa).

Adopting the genetic transformation technology is to utilize an important channel of excellent genes (especially foreign gene) improvement species.Except that needs excellent genes resource, also need be applicable to the promotor of target gene performance function under optimum regime through genetic transformation technique improvement species.The international and domestic available quantity that is used for the functional gene of farm crop character improvement is increasing gradually.But by comparison, alternative promotor value volume and range of product is but very limited, especially lacks the promotor that is applicable to improvement farm crop proterties.Promotor has become one of bottleneck that adopts genetic transformation technique improvement species.The international and domestic promotor that is used for the farm crop genetic transformation mainly is composition type expression promoters such as corn ubiquitin (ubiquitin) gene promoter, rice actin (actin) gene promoter, viral 35S at present.Their goal of regulation and control genes are all expressed in a organized way in institute, and do not have space-time to limit.When expressing,, often cause species form and physiological function unusual easily because a large amount of target protein occurs in unwanted cells with these promoter regulation target genes.Though the report of a small amount of specific promoter separating clone is also arranged in the world, the kind of the farm crop that relate to seldom, quantity is very limited, and we do not have intellecture property, will be subject to production application.

OsRHL1 (Wona Ding et al., 2009) is that 200910095888.0 invention " a kind of rice root hair controlling gene OsRH L1 " informed clearly once that the albumen of this genes encoding educated the function in the regulation and control at the root hair at number of patent application.

Reference paper in the preceding text is specific as follows:

1, Dolan, L., Janmaat, K., Willemsen, V., Linstead, P., Poethig, S., Roberts, K., Scheres, B. (1993). the root cells organizational framework of Arabidopis thaliana." growth " 119:71-84

2, Gilroy, S., and Jones, D.L. (2000). the form of educating from the root hair is to the function of nutrition absorption." plant science development trend " 5,56-60.

3, Grierson, C., and Schiefelbein, J. (2002). the root hair." Arabidopis thaliana "

4, Hiei, Y., Ohta, S., Komari, T.and Kumashiro, T. (1994) is through the analysis of agriculture bacillus mediated rice high efficient conversion system and T-DNA border sequence." plant journal 6,271-282.

5, the expression of Terada R.and Shimamoto K. (1990) .CaMV35S-GUS gene in transgenic paddy rice." molecule and General Genetics " 220:389-392.

6, Wona Ding, Zhiming Yu1, Yanli Tong, Wei Huang, Hanmin Chen, Ping Wu (2009). a paddy rice bHLH transcription factor regulation and control root hair is educated." cell research " 1309-1311.

Summary of the invention

The technical problem that the present invention will solve provides a kind of promotor of rice root hair development control gene OsRHL 1, utilizes this promotor (OsRHL1 gene promoter) can carry out the Plant Transformation of root hair cell expression efficiently.

In order to solve the problems of the technologies described above, the present invention provides a kind of promotor of rice root hair development control gene OsRHL 1, and this promotor is the nucleotide sequence shown in the SEQ ID NO:1.

Improvement as the promotor of rice root hair development control gene OsRHL 1 of the present invention: promotor also is included in the nucleotide sequence shown in the SEQ IDNO:1 to be added, replace, inserts and lack two mutants, allelotrope and the verivate that one or more Nucleotide generate.

Further improvement as the promotor of rice root hair development control gene OsRHL 1 of the present invention: promotor also comprises it being under the rigorous condition of height, can and have the nucleotide sequence of identical function with the nucleotide sequence hybridization shown in the SEQ ID NO:1.

The present invention also discloses the purposes of the promotor of above-mentioned rice root hair development control gene OsRHL 1 simultaneously: be used to make up transgenic paddy rice.

Improvement as the purposes of the promotor of rice root hair development control gene OsRHL 1 of the present invention: the function of this promotor is to start the specifically expressing of downstream coding gene in the rice root hair cell.

Promotor of the present invention is the upstream sequence that the rice root hair is educated the gene coding region of regulatory gene OsRHL1.The plant expression vector that contains this promotor through structure; It is transformed in the transgenic paddy rice; The multiple different tissues such as common leaf, sword-like leave, flower and root of transgenic line have been carried out the GUS histochemical stain detect, the result has confirmed this promotor specific expressed in root hair cell.The root hair be root system absorb in the soil moisture and mineral nutrition and with the soil microorganisms vital tissue position of work mutually.Except that needs excellent genes resource, also need be applicable to the promotor of target gene performance function under optimum regime through genetic transformation technique improvement species.Rice root hair specificity promoter can be applicable to the improvement of farm crop nutrition absorption, and this all has big practical significance for improving crop yield and reducing the pollution that causes of applying fertilizer.

Utilize promotor of the present invention to make up transgenic paddy rice, have following advantage: can start the downstream corresponding gene and efficiently express specifically, and not start of the expression of this corresponding gene at other position in the root hair.The root hair is the vital tissue of moisture and mineral nutrition in the plant absorbing soil; The method that this specific tissue of root hair is improved can be applied to following improvement root hair to nutrient absorbing ability in the soil, can not produce adverse influence to other organ-tissue again simultaneously.We have put a reporter gene (GUS) in the downstream of OsRHL1 promotor in the present invention, because this gus gene can be dyed blueness at the position of expressing, so can intuitively demonstrate the tissue specificity of promotor.And this report gene (GUS) is if be connected on traditional composition type expression promoter (like 35S promoter etc.) following time; Then can regulate and control gus gene and in all organs such as stem, leaf, flower, seed, all express, and the expression in root can only not be confined to root hair tissue (Terada and Shimamoto1990) yet.During with these composition type expression promoter goal of regulation and control genetic expressions,, often cause species form and physiological function unusual easily because a large amount of target protein occurs in unwanted cells.And application of the present invention is intended in the future that the promotor downstream connect specific nutrition absorption gene, makes it special enhancing to be expressed in the root hair, and this only has very big using value to the target sex-controlled inheritance improvement of root hair.

Description of drawings

Do further explain below in conjunction with the accompanying drawing specific embodiments of the invention.

Fig. 1 is a pBI101.1-GUS plus carrier synoptic diagram.

Fig. 2 is the coloration result that the OsRHL1 promotor merges the gus gene transgenic line;

A, more than the main root meristematic zone; B, the root-hair zone; C, the root hair; D, the paraffin rip cutting figure of root-hair zone; Bar=100 μ m (b) bars=40 μ m (c, d).

Embodiment

Following examples of the present invention use molecular biological method to be known technology.The Current Protocols in Molecular Biology that publishes in the JohnWiley and Sons company that Ausubel writes; Write the Molecular Cloning:A Labortory Manual that Cold Spring Harbor Laboratory Press (2001) publishes with J.Sambrook etc., documents such as 3rd ED. all have detailed explanation.

Embodiment 1,

Contain the primer that HindIII and KpnI enzyme are cut recognition site (underscore) respectively according to the sequences Design two ends of the initiator codon ATG front of OsRHL1 gene; Kan gene group DNA with wild-type Kasalath is a template; Amplify the OsRHL1 gene promoter of total length 2443bp, its nucleotides sequence is classified as shown in the SEQ ID NO:1.

Primer sequence is following:

Upstream primer: AAC GGTACCTGGCACTGATATTCTAATGGT

Downstream primer: AAC GTCGACGCTTAGCTTAGCTTAGCTGAAG

Utilize LA Taq DNA Polymerase to come out whole promoter DNA sequence amplification, the PCR condition is 94 ℃ of sex change 4min, gets into the i.e. 94 ℃ of 30s of circulating reaction then, 50 ℃ of 30s, and 72 ℃ of 2.5min, cycle number is 30, extends 7min at last again and finishes.The PCR product is electrophoresis and rubber tapping recovery purpose band on 0.8% sepharose, connects the pMD19-T carrier, connects product thermal shock transformed into escherichia coli DH5 α competent cell, draws plate and chooses the positive monoclonal order-checking.The pBI101.1-GUS plus carrier (Fig. 1) that transform in correct clone who identifies and laboratory is used HindIII and KpnI double digestion respectively, reclaims the back and connects, and connects product thermal shock transformed into escherichia coli DH5 α competent cell, draws plate and chooses positive monoclonal.Enzyme is cut and is accredited as male mono-clonal bacterium liquid and expands and to take out plasmid after numerous, and electric shock is transformed into Agrobacterium EHA105 competent cell.This agrobacterium strains is used for the paddy rice transgenic.

PBI101.1-GUS plus carrier remodeling method is specific as follows: the method for the GUS plus sequence on the pCAMBIA1305.1 with PCR amplified; Upstream primer 5 ' termination has added BamH I and Kpn I enzyme cut-grafting head, and downstream primer 5 ' termination has added Sac I enzyme cut-grafting head.The PCR product is connected among the pBI101.3 that cuts with same enzyme after cutting with BamH I and Sac I enzyme.Be called pBI101.1-GUS plus carrier through improved carrier unification.Identify through order-checking between its MCS and the GUS plus reading frame.

The primer sequence is:

GUS?plus-up AACGGATCCACGGTACCATGGTAGATCTGAGGGTAAATTTC

GUS?plus-low?ACGGAGCTCTCACACGTGATGGTGATGGTGATGG。

Rice callus through cultivate in advance, Agrobacterium is infected, cultivate altogether, callus that screening has kalamycin resistance, break up, take root, practice transplantation of seedlings, obtains transfer-gen plant.The rice genetic transformation system of Agrobacterium (EHA105) mediation is mainly used on people (1994) the reported method basis such as Hiei and is optimized.See shown in Figure 2ly after the transgenic seedling offspring who obtains dyes with the GUS dye liquor, show that OsRHL1 gene promoter driven GUS expresses in the root hair of the elongation zone of root and maturation zone.

Because root hair inserted part is the root-hair zone at root; So the expression of GUS (blueness) in Fig. 2 a it is thus clear that more than the root elongated region, just occurs; Further amplify and see that the GUS in the root hair shown in Fig. 2 b and Fig. 2 c expresses; Can see that from vertical paraffin section of Fig. 2 d the root hair cell that has only epidermis has GUS to express, the inner tegumental cell of root is not then expressed.Though the root hair cell outside in the process of paraffin section, extending in has not been to keep very completely, epiblem cell and inner tegumental cell all are complete.The GUS expression difference is clearly between other cellular layer of root hair cell and root.

At last, it is also to be noted that what more than enumerate only is several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be arranged.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention all should be thought protection scope of the present invention.

Sequence table

SEQ?ID?NO：1

tggcactgat?attctaatgg?tgatcgaatg?aataatcctc?ttgctaattg?tgattcacaa 60

tatattttaa?cagttcacag?ttcactctct?ctccaatgaa?actctgaatc?ttctgcaact 120

gctgataact?gatcacattt?acactttcat?cggatgccga?atgactgcat?taatcgatct 180

tgagttctcc?agcgttgact?cgcttcgcat?tgcacacgag?cgcacggaga?ggagcacgtg 240

tggccagtat?gcgcatgtgt?gcacgcacac?aaggcagcca?tggattaaag?gccaagctgc 300

atgaagcatt?caccaccaag?gttgtcagta?tcccgattcg?tatcctaata?tcttacgata 360

ctacgatcct?accaagccga?aacgataccg?ataccaccta?gtatcttaat?agtatctcga 420

tcctactatt?cattactaca?cgatcctacg?aaatcttaga?tgatatcccg?attctacgat 480

ccctacgata?ctacaaaata?ttatttaaaa?taacatggtt?tgaaaataat?gtaactaaat 540

atactcaaat?ttatatgaaa?atcggttaaa?tatatcaaaa?ccaacgtggt?ttctcttgat 600

aaatgtctct?atttgcatga?catatatcat?tactatattt?ttttatagaa?tagccatata 660

taattaatat?aaatattaat?taaacttaaa?aaaataaaat?ctcatagtat?cccgatacta 720

cgatacgatc?ctacgatacg?gtattacttt?aagcaaaacg?atactaccta?gtatcccgat 780

cctgacaacc?ttattcacca?ccattgctct?tggcatgttg?ctctctttta?agagcaagtt 840

taatagtata?gccaactact?agtttcaaat?catctatatc?taatgtagta?gtcaattcat 900

acaatagttg?tttaGtatac?tattaatata?tatttggtcc?cacctatcat?acacatatta 960

tgtcttggag?tccgtgctgt?aactgggcta?cagatctgta?gcccgttgct?cttctatctc 1020

ttcctttatc?tctttaaaat?atagccagtt?ataaacatat?ttgctcttag?ctataaacat 1080

attttaaaga?gataaaagag?gagagagaag?agcagcggac?tatagatctg?tagccagctg 1140

tagcacggac?tctaagacac?tgataggtgg?gaccatgtat?taatagtgta?gtacgaaact 1200

attatatgaa?ttggctatta?agttgactat?atgtgatttg?gagctagtag?ttggctatac 1260

tattaaactt?gctcttaagg?ataacagagc?aatggattag?tgcgcttgct?aagctcctta 1320

atgatagtag?tacggttttc?attacaaaat?ttatgagaat?tttaagaaac?taatttagat 1380

ccatttttca?atttcacaat?atatttcatt?cgtttataca?tttgaataat?gtgattacaa 1440

aatcattgag?ctatttaggg?gaaaaaagga?ggccttcaac?ccttgatttt?taatttaata 1500

atgaaatcca?ctgctccata?ctctctctag?ttctatatta?attgacgttt?tggacaaggt 1560

taagattaaa?cttttataac?tttgaccatc?aataacttta?aaaatattta?gtttaaagaa 1620

actagaaaaa?catatataga?tttgtctttc?aaaacactat?aataaaagta?acatgcattt 1680

atttattgta?tatattataa?tagaaaaata?aggttaaaga?tatatcttgt?agagcatgtc 1740

attgtccaaa?gcgtcaatta?aaatgaaacc?ggagggagta?cacaatcagt?tcaattttcg 1800

tagaaactat?gaatagttac?catccgcagg?caaaaaaaaa?tgctacatcc?gtcccaaaat 1860

aagtgcagcc?atgaatatcc?gtgcccaacg?tttgatcgtc?cgtcttattt?gaataatttg 1920

tgaaaaattt?gaaagtattt?agtcacacat?aaaatattta?tcatctaata?gtaataaaaa 1980

tactaatcat?aaaaagtttt?caaataaaac?gaacggtcaa?acgttgaacg?tgaatagtgc 2040

agaactgcac?ttattttggg?atggagggag?tatataaaaa?ttgcaccagt?tctaaagttt 2100

gtcgtggcat?gattatatta?cgtgccagga?acagtgcagc?atttaaaaca?ttcaaacatt 2160

ttttgtgttc?attttgtagc?tacatgactc?acacaaacca?gctgtacgtg?agtactatat 2220

gtcaaccgtt?taaactaagt?ccatgagaat?taatgtagcg?ccgattataa?aatcgctctg 2280

aactgccgca?cgaactgaga?ttaatctccc?aattttttaa?gagaaaattt?gaggcctaaa 2340

tcgccattat?aaaacctagc?ttacgacacc?ctgtgcagct?gtgctctgct?gcctaattag 2400

caagcagctt?gtcagcttga?gcttcagcta?agctaagcta?agc 2443

Claims (3)

1. the promotor of a rice root hair development control gene OsRHL 1, it is characterized in that: this promotor is the nucleotide sequence shown in the SEQ ID NO:1.

2. the purposes of the promotor of rice root hair development control gene OsRHL 1 as claimed in claim 1: be used to make up transgenic paddy rice.

3. the purposes of the promotor of rice root hair development control gene OsRHL 1 according to claim 2: start the specifically expressing of downstream coding gene in the rice root hair cell.

Images