CN102321665A

CN102321665A - Method for expressing human humanin protein in peanut seed

Info

Publication number: CN102321665A
Application number: CN201110293503A
Authority: CN
Inventors: 夏晗; 王兴军; 毕玉平; 肖寒; 赵传志; 李长生; 李爱芹
Original assignee: High Tech Research Center Of Shandong Academy Of Agricultural Sciences
Current assignee: High Tech Research Center Of Shandong Academy Of Agricultural Sciences
Priority date: 2011-09-29
Filing date: 2011-09-29
Publication date: 2012-01-18
Anticipated expiration: 2031-09-29
Also published as: CN102321665B

Abstract

The invention discloses a method for expressing human humanin protein in peanut seeds, which comprises the following steps: connecting humanin protein coding gene to a 3' end of an oleosin gene by a genetic engineering means, establishing an 'oleosin-erepsin-human humanin protein' plant expression vector driven by an oleosin promoter, transforming peanuts to realize high-level expression of recombinant protein in peanut seeds with the accumulation of oil body, then performing centrifugation of fusion protein, digesting the fusion protein by exo-protease, performing centrifugation, removing the oil phase and recovering water phase, performing purification to obtain human humanin protein. The recombinant protein obtained by the method of the invention is safe, has high activity, is very easy to be recovered and purified, can be stored in peanut seeds for a long term, is convenient for transportation, and greatly increases the crop added value.

Description

A kind of in peanut seed the proteic method of expressing human humanin

Technical field

The present invention relates to the proteic method of a kind of expressing human humanin, relate in particular to a kind of oil body protein system proteic method of expressing human humanin in peanut seed of utilizing, belong to biological technical field.

Background technology

Alzheimer's disease (Alzheimer disease; AD) be to be the common in older people disease of clinical manifestation with progressive hypomnesis, cognitive disorder and dementia; Sickness rate increases sharply along with the aging of population, has become the disease of the another serious harm human health after cardiovascular disorder, cancer and apoplexy.Earlier 2000s, Japanese scholar at first isolates the small peptide of a kind of Humanin of being called (HN), is made up of 24 amino acid.It can effectively suppress the AD genes involved: amyloid protein precursor (amyloid precursor; APP) gene, presenilin 1 (preseniln1; PS1) gene, presenilin 2 (preseniln2; PS2) nerve cell death that the sudden change of gene, and beta-amyloyd peptide (amyloid peptide, A β) causes ^[1-3]The primary structure of HN has the signal peptide constructional feature, can be by secretion to the extracellular, and extracellular HN is through combining with cell surface receptor, then the interior signal transduction pathway of activating cells and bring into play its cytoprotection.In addition, relevant experimentation on animals shows that intracerebral injection HN can improve the animal learning dysmnesia that Scopolamine causes.And a kind of verivate of Humanin---Humanin (HNG), it is strong 1000 times than HN to be proved effect ^[4]Research in recent years shows that HNG also has prevention and treatment apoplexy ^[5]Thereby, strengthen insulin activity treatment type ii diabetes ^[6]Effect.Humanin albumen action range, potential applicability in clinical practice is wide, and the market requirement is huge, so scale operation people humanin albumen is significant.

Utilizing plant bioreactor is the effective means of producing pharmaceutical protein.Existing various plants is as bio-reactor, and like tobacco, soybean, Arabidopis thaliana, corn, rape, potato tuber, tamato fruit, rice paddy seed etc., it is multiple that its expression product also has, like vaccine, antibody etc.The plant bioreactor cost is lower, is easy to enlargement of scale, does not have problems such as the cell cultures difficulty, the substratum that run in animal cell culture or the microbial fermentation are expensive, pollution control difficulty.Compare with the animal transgenic technology, plant transgenic technology is ripe more.Compare with microflora with animal, plant itself is not carried germ or the virus that causes human diseases, has avoided the pollution of pathogenic bacteria to the bio-reactor product.Compare with mikrobe, utilize the product of plant production generally to have higher biological activity.In addition, the oil body protein in the oil crop seeds by using can high level expression, can reach 10% of seed protein.If with foreign protein and oil body protein amalgamation and expression, when improving the exogenous protein expression level, can also simplify proteic separable programming, effectively reduce production costs.

Research shows that oil body protein (oleosin) has hydrophilic and the lipophilic dual nature, covers the oil body surface with the film embedded mode in plant seed.The oil body protein molecule is except that the hydrophobic region high conservative of middle part, and the sequence difference of N end and C end is all very big.The character of oil body has determined that it is a kind of engineered organoid that is easy to; After small molecular weight protein is inserted into the N end or C end of oil body protein; Can not have influence on location and the expression of oil body protein on vegetable oils; The recombination fusion protein that forms is highly stable, through floating centrifugal being easy to it and other cellular constituents is separated, and is easy to large-scale separation and purification of protein.Usefulness triglyceride, phosphatide and oil body proteins such as Chen have synthesized artificial oil body (AOB), have only 1/10 of natural oil body, have kept the characteristic of natural oil body and highly stable through a series of Physiological Experiment proof AOB ^[7]Peng etc. utilize artificial oil body to optimize oil body-oil body protein expression system; In intestinal bacteria, made up " oil body protein-Xa-GFP " expression vector; Through centrifugal, the whole enrichments of oleosin-GFP separate GFP through proteolytic enzyme Xa to the surface of artificial oil body from the oil body protein that embeds oil body; Centrifugal again, collect the GFP that supernatant obtains high density ^[8]Xu etc. utilize soybean 24kDa oil body protein system, have made up " oil body protein-erepsin-r-hirudin " plant expression vector, in transgene tobacco successful expression recombinant protein, through erepsin cutting, separate having obtained r-hirudin ^[9]SemBioSys company utilizes this system of oil body-oil body protein expressing human Regular Insulin in Arabidopis thaliana, and vegetalitas Regular Insulin is accumulated to 0.13% of seed protein content ^[10], after follow-up test was optimized, the Regular Insulin that accumulates in the seed accounted for 1.15% of seed Tot Prot, reaches the commercial applications level.The said firm also utilizes oil body protein expression system expressing human Regular Insulin in safflower; Can extract 1 kilogram insulin human in the Semen Flos Carthami that every acre of safflower produced; Can effectively fill up the market requirement, utilize Canola oil body protein system to produce the r-hirudin product and also got into commercialization stage.

Peanut is important oil crops; Be China's per unit area yield, gross output and the highest oil crops of foreign exchange earning; Account for 50% of China's oil crops gross output, account for more than 30% of world's peanut gross output, peanut is being brought into play irreplaceable effect in fields such as oil expression, food-processing and chemical industry.The oleaginousness of peanut seed is up to 45-55%, and protein content reaches 25-30%, can eat raw, also can be used as the starting material of food-processing, and its protein very easily is equipped with absorption of human body, and specific absorption is more than 90%, so peanut is the excellent carrier of bio-reactor.People humanin albumen has broad clinical application prospect, through retrieval, at present also not about in peanut seed, utilizing the report of the proteic method of oil body protein expression system expressing human humanin.

Reference:

[1]Hashimoto?Y，Niikura?T，Ito?Y，Nishimoto?I.Multiple?mechanisms?underlie?neurotoxicity?by?different?types?of?Alzheimer’s?disease?mutations?of?amyloid?precursor?protein.Biol?Chem.2000，275(44)：34541-34551.

[2]Hashimoto?Y，Ito?Y，Niikura?T，Shao?Z，Hata?M，Oyama?F，Nishimoto?I.Mechanisms?of?neuroprotection?by?a?novel?rescue?factor?humanin?from?Swedish?mutant?amyloid?precursor?protein.Biochem?Biophys?Res?Commun.2001，283(2)：460-468.

[3]Hashimoto?Y，Niikura?T，Ito?Y，Sudo?H，Hata?M，Arakawa?E，Abe?Y，Kita?Y，Nishimoto?I.Detailed?characterization?of?neuroprotection?by?a?rescue?factor?humanin?against?various?Alzheimer’s?disease-relevant?insults.J?Neurosci.2002，21(23)：9235-9245.

[4]Hashimoto?Y，Niikura?T，Tajima?H，Yasukawa?T，Sudo?H，Ito?Y，Kita?Y，Kawasumi?M，Kouyama?K，Doyu?M，Sobue?G，Koide?T，Tsuji?S，Lang?J，Kurokawa?K，Nishimoto?I.A?rescue?factor?abolishing?neuronal?cell?death?by?a?wide?spectrum?of?familial?Alzheimer’s?disease?genes?andabeta.PNAS.2001，98：6336-6341.

[5]Xu?X，Chua?C?C，Gao?J，Hamdy?R?C，Chua?B?H?L.Humanin?is?a?novel?neuroprotective?agent?against?stroke.Stroke，2006，37：2613-2619.

[6]Muzumdar?RH，Huffman?DM，Atzmon?G，Buettner?C，Cobb?LJ，et?al.Humanin：A?Novel?Central?Regulator?of?Peripheral?Insulin?Action.PLoS?ONE?2009，4(7)：e6334.doi：10.1371/journal.pone.0006334

[7]Chen?MC，Chyan?CL，Lee?TT，et?al.Constitution?of?stable?artificial?oil?bodies?with?triacylglycerol，phospholipid，and?caleosin.J?Agric?Food?Chem.2004，16；52(12)：3982-3987.

[8]Peng?CC，Chen?JC，Shyu?DJ，et?al，A?system?for?purification?of?recombinant?proteins?in?Escherichia?coli?via?artificial?oil?bodies?constituted?with?their?oleosin-fused?polypeptides.J?Biotechnol.2004，111(1)：51-7.

[9]Xu?M?Y，Liu?D?H，Li?G?Q.Cloning?of?soybean?24kDa?oleosin?gene?and?its?transient?expression?as?a?carrier?for?foreign?protein.Agricultural?Sciences?in?China，2004，3(5)：321-329.

[10]Nykiforuk?CL，Boothe?JG，Murray?EW，et?al.Transgenic?expression?and?recovery?of?biologically?active?recombinant?human?insulin?from?Arabidopsis?thaliana?seeds.Plant?Biotechnol?J.2006，(1)：77-85.

Summary of the invention

To the situation of prior art, the problem that the present invention will solve provides a kind of oil body protein system proteic method of expressing human humanin in peanut seed of utilizing.

According to the invention in peanut seed the proteic method of expressing human humanin, step comprises (1) clone peanut oil body protein Gene A holeosin and promotor thereof; (2) synthetic people humanin protein coding gene; (3) make up the pCAMBIA2300-Aholeosin-humanin-OCS plant expression vector; (4) conversion of peanut; (5) acquisition of transgenic peanut seed; (6) Western Blot detects the proteic expression of humanin in the transgenic peanut seed; (7) separation and purification and reclaim people humanin albumen from the transgenic peanut seed; It is characterized in that:

The method of said clone's peanut oil body protein Aholeosin and promotor thereof is: extract peanut genome; With it is template; To have the forward primer of EcoRI restriction enzyme site GAATTC: AGAATTCAGGTCAACTACCATTCGT; With the reverse primer that has KpnI restriction enzyme site GGTACC: GGTACCAGTTCTCTTTGAATCCTG, utilize LA TAQ enzyme to carry out the PCR reaction, the program of PCR reaction is: 94 ℃ of 5min; 94 ℃ of 45sec again, 54 ℃ of 45sec, 72 ℃ of 2min, 35 circulations; 72 ℃ of 7min; Preserve the PCR product for 16 ℃; The PCR product is connected with the T carrier, and the transformed into escherichia coli cell is chosen the order-checking of resistance mono-clonal, confirms to carry the cloning vector of Aholeosin and promotor thereof;

The method of said synthetic people humanin protein coding gene is: design and synthesize two single stranded DNA primers of part complementary, wherein forward primer comprise the KpnI enzyme cut a GGTACC with the some erepsin recognition sequence (GATGATGATGATAAG): GAAGGTACCG ATGATGATGA TAAGATGGCT CCACGAGGGT TCAGCTGTCT CTTACTTTTA ACCAGTGAAA TTGACCTGCC; Reverse primer comprises His tag sequence (CACCACCACCACCACCAC) and SalI restriction enzyme site (GTCGAC): ACGCGTCGAC TTAGTGGTGGTGGTGGTGGT GTGCCCGCCT CTTCACGGGC AGGTCAATTT CACTGGTTAA AAGTAAGAGA; Utilize the TAQ enzyme to anneal and extend, program is: 94 ℃ of 3min; 40 ℃ of 1min; 72 ℃ of 2min; Preserve product for 16 ℃; Product is connected with the T carrier, and the transformed into escherichia coli cell is chosen the order-checking of resistance mono-clonal, confirms to carry the correct cloning vector of humanin gene;

Said plant expression vector pCAMBIA2300-Aholeosin:humanin-OCS construction process is: will be connected on the pCAMBIA2300-35S-OCS plant expression vector through EcoRI and KpnI restriction enzyme site according to Aholeosin and the promotor thereof that above-mentioned cloning process obtains; Obtain the pCAMBIA2300-Aholeosin-OCS carrier; To be connected on the pCAMBIA2300-Aholeosin-OCS carrier through KpnI and SalI restriction enzyme site according to the humanin protein coding gene that above-mentioned cloning process obtains again, obtain the pCAMBIA2300-Aholeosin-humanin-OCS plant expression vector;

The method for transformation of said peanut is: the plant expression vector pCAMBIA2300-Aholeosin-humanin-OCS that will have goal gene infects peanut through agrobacterium mediation method;

The method of the acquisition of said transgenic peanut seed is: the homozygotic peanut seed of results s-generation transgenic peanut;

The method that said Western Blot detects people humanin protein expression in the transgenic peanut seed is: personnel selection humanin antibody is anti-as one, and horseradish peroxidase detects as the two anti-western blot hybridizations that carry out;

Said separation and purification and reclaim the proteic method of people humanin and be meant from the transgenic peanut seed: the peanut seed that obtains is pulverized, extracting liquid, centrifugal recovery upper oil phase obtains containing the liquid of fusion rotein; Fusion rotein is centrifugal after enzyme is cut, remove oil phase and reclaim water, purified acquisition people humanin albumen.

Above-mentioned in peanut in the proteic method of expressing human huamnin: the order of connection of the oil body protein gene of peanut and promotor, recombinant protein encoding sox is " peanut oil body protein promotor+peanut oil body protein gene+erepsin recognition site+people humanin protein gene+terminator " in the said plant expression vector.

People humanin albumen has broad clinical application prospect; Perhaps activity is very low to utilize the prokaryotic system recombinant protein often not have activity; Utilize zooblast to express as bio-reactor that the exogenous protein expression amount is low, cost is high, plant bioreactor has the advantage of producing pharmaceutical protein.The oil body protein system proteic method of expressing human humanin in peanut seed of utilizing provided by the invention has realized mode and the transgenic peanut oil body protein co expression and high level accumulation of people humanin albumen to merge.

As recipient plant, the seed of peanut adopts the clone of peanut oil body protein gene and promotor as the carrier of expressing protein with peanut in the present invention; The structure of expression vector; The genetic transformation of peanut, the expression of people humanin protein gene is confirmed, the separation and purification of recombinant protein and the method for recovery; Successfully realized utilizing peanut seed as bio-reactor expressing human humanin albumen efficiently and safely in the transgenic peanut, and then purifying and recovering albumen.

To sum up, the inventive method has the following advantages:

(1) the peanut oleaginousness is high, and oil body protein is abundant, accounts for more than 10% of seed protein, mode and the peanut oil body protein co expression of people humanin albumen to merge, and high level accumulation.

(2) the humanin protein stability of express recombinant is good in peanut, can and maintain vigour in the medium-term and long-term storage of peanut seed, and convenient transportation.

(3) the peanut cultivation area is wide; Flexibility is strong, utilizes purification system, easy recovery and the purifying of oil body protein, has advantage easy to operate, that cost is low; Increased additional value of farm products simultaneously, for the development of bio-pharmaceuticals and molecule agricultural new industry provides technical support.

Description of drawings

Fig. 1 plant expression vector pCAMBIA2300-Aholeosin-humanin-OCS according to the invention makes up synoptic diagram.

Embodiment

Below in conjunction with instance the present invention is further specified, but be not limited thereto.

Embodiment 1 comprises the clone of the peanut oil body protein gene of promotor

According to the promotor of peanut oil body protein among the Genbank and the sequence of encoding sox (gene accession number: EF695400), design the forward primer primer1:AGAAT TCAGG TCAAC TACCA TTCGT that contains EcoRI restriction enzyme site (GAATTC); According to the open reading frame sequence of peanut oil body protein gene, remove the termination codon, design has the reverse primer primer2:GGTACCAGTTCTCTTTGAATCCTG of KpnI restriction enzyme site (GGTACC).

Extract the genomic dna of peanut (Shandong spends 14), method is following:

(1) gets the peanut young leaflet tablet of 1g, become powder, place the Eppendof pipe of liquid nitrogen precooling with liquid nitrogen grinding;

(2) in 65 ℃ of water-baths preheating CTAB extracting solution (2%CTAB, 1.4mol/L NaCl, 20mmo/L EDTA (pH8.0), 100mmol/L Tris-Cl (pH8.0), 2%pvp-40);

(3) quality of estimation sample tissue adds the CTAB extracting solution of 700 μ L preheatings in every 200mg sample, and mixing is bathed 10-30min 65 ℃ of temperature rapidly, during mixing 2-5 time;

(4) add the phenol/chloroform/primary isoamyl alcohol (12: 12: 1) of 1 times of volume, mixing;

(5) the centrifugal 10min of 12000rpm room temperature;

(6) supernatant is transferred in the new centrifuge tube;

(7) repeat the 4-6 step with chloroform/primary isoamyl alcohol (24: 1);

(8) add the Virahol of 0.7 times of volume-20 ℃ precooling, put upside down mixing, room temperature is placed 10min;

(9) the centrifugal 15min of 12000rpm room temperature;

(10) outwell supernatant, wash deposition 2-3 time with 70% ethanol of 500 μ l-20 ℃ precoolings;

(11) deposition drying after, with 50 μ l deionized waters or TE dissolving DNA, place-20 ℃ subsequent use.

(12) draw 5 μ l dissolved DNA, add 45 μ l deionized waters, mixing is for use.

The pcr amplification of peanut oil body protein promotor and gene:

With above-mentioned primer1, primer2 is a primer, and peanut genome is a template, and pcr amplification obtains the promotor and the full-length gene of peanut oil body protein.Response procedures is following: template DNA 1 μ l, 2 * LATaq mix, 10 μ l, primer1 (10 μ M) 0.5 μ l, primer2 (10 μ M) 0.5 μ l, ddH ₂O 8.0 μ l.On PCR appearance (TaKaRa TP650), 94 ℃ of 5min are set, 94 ℃ of 45sec subsequently, 54 ℃ of 45sec, 72 ℃ of 2min, totally 35 back 72 ℃ of 7min of circulation finish reaction.

The acquisition of peanut oil body protein promotor and gene order:

Get the PCR product through 1% agarose gel electrophoresis, observations under the uv lamp, glue reclaims the purpose band about 2100bp; Connection T carrier (pMD18-T, TaKaRa, Dalian); Linked system 10 μ l: reclaim product 4 μ l, pMD18-T carrier 1 μ l, Solution I 5 μ l; Carry out under 16 ℃ more than the ligation 4h, connect product transformed into escherichia coli DH5 α cell.

The preparation of bacillus coli DH 5 alpha competent cell: the E.coli DH5 α with aseptic inoculation ring picking-70 ℃ glycerine is preserved, cultivate 16-20h for 37 ℃ through the method warp of line dilution, on flat board, obtain single bacterium colony of DH5 α; Choose a single bacterium colony in the LB of 3ml liquid nutrient medium, 180rpm shaking culture 12h; Get 1ml DH5 α LB bacterium liquid in the LB of 100ml liquid nutrient medium, the 180rpm shaking culture is to OD value 0.4; Place 15min on ice, change under the aseptic condition in the 50ml Beckman centrifuge tube, 4 ℃, the centrifugal 10min of 4500rpm abandons supernatant; Deposition is with the 0.1M CaCl of 30ml ice precooling ₂Solution is resuspended; 4 ℃, the centrifugal 10min of 4500rpm carefully pours out supernatant; Deposition is resuspended in the 15% glycerine 0.1M CaCl that contains of 2ml ice precooling ₂Solution; These competent cells are pressed every part 70 μ l packing ,-80 ℃ of preservations.

Colibacillary conversion: the connection liquid of above-mentioned 10 μ l is added mixing in the 70 μ l DH5 α competent cells, place 30min on ice, 42 ℃ of heat shock 90sec; Ice bath 5min adds 150 μ l liquid LB (NaCl 10g/L, Tryptone 10g/L; Yeast powder 5g/L), 37 ℃ of 120rpm shaking culture 1h evenly are coated with rag (NaCl 10g/L on the solid LB of the penbritin that contains 100 μ g/ml substratum with bacterium liquid; Tryptone 10g/L; Yeast powder 5g/L, Agar powder 15g/L), 37 ℃ of overnight cultures.Picking list bacterium colony is in 4mL liquid LB; 37 ℃ are shaken bacterium 8-10h, extract DNA (Omega), use the checking of (EcoRI, KpnI) double digestion respectively; Positive colony is carried out sequence verification (seeing sequence table SEQ ID No.1) with the M13 universal primer, obtain cloning vector T-AhOleosin plasmid.

Synthesizing of embodiment 2 people Humanin genes

According to humanin gene (NP_001177635) sequence among the Genbank; Design and synthesize two single stranded DNA primers of part complementary, wherein forward primer comprises KpnI (GGTACC) site and erepsin recognition sequence (GATGATGATGATAAG) primer3:GAAGGTACCG ATGATGATGA TAAGATGGCT CCACGAGGGT TCAGCTGTCT CTTACTTTTA ACCAGTGAAA TTGACCTGCC; Reverse primer comprises His tag sequence (CACCAC CACCAC CACCAC) and SalI restriction enzyme site (GTCGAC) primer4:ACGCGTCGAC TTAGTGGTGG TGGTGGTGGT GTGCCCGCCT CTTCACGGGC AGGTCAATTT CACTGGTTAA AAGTAAGAGA.

Utilize the TAQ enzyme to anneal and extend, primer3 (100 μ M) 1 μ l, primer4 (100 μ M) 1 μ l, program is: 94 ℃ of 3min; 40 ℃ of 1min; 72 ℃ of 2min; Preserve product for 16 ℃; Product is through 1% agarose gel electrophoresis; Observations under the uv lamp, glue reclaims the purpose band, will reclaim product and be connected with the T carrier; Press the method transformed into escherichia coli DH5 α cell among the embodiment 1; Choose the order-checking of resistance mono-clonal, the correct clone (seeing sequence table SEQ ID No.2) that the humanin gene is carried in affirmation obtains cloning vector T-humanin plasmid.

The structure of embodiment 3 plant expression vectors

The building process of plant expression vector is as shown in Figure 1:

(1) peanut oil body protein promotor and ORF are connected to the pCAMBIA2300-35S-OCS plant expression vector, this plant expression vector skeleton derives from Cambia company, transforms (Luo et al.Journal of integrative plant biology by Inst. of Genetics and Development Biology, CAS; 2005; 47 (6), 745-752): pCAMBIA2300-35S-OCS plasmid and T-AhOleosin plasmid are used EcoRI and KpnI double digestion respectively, reclaim carrier sequence and AhOleosin sequence; With the T4DNA ligase enzyme both are connected: 10 * T4D NA ligase buffer, 1 μ l; AhOleosin 6 μ l, pCAMBIA2300 2 μ l, T4 DNA ligase 1 μ l; 16 ℃ of connections are spent the night; Connect product and press the method transformed into escherichia coli DH5 α among the embodiment 1,, obtain the pCAMBIA2300-AhOleosin-OCS expression vector with EcoRI and the correct clone of KpnI double digestion checking.

People humanin protein gene is connected to the pCAMBIA2300-AhOleosin-OCS expression vector: pCAMBIA2300-AhOleosin-OCS plasmid and T-humanin plasmid are used KpnI and SalI double digestion respectively; Reclaim carrier sequence and humanin sequence; With the T4DNA ligase enzyme both are connected: 10 * T4DNA ligase buffer, 1 μ l; Humanin 6 μ l, pCAMBIA 2300-AhOleosin-OCS 2 μ l, T4DNA ligase 1 μ l; 16 ℃ of connections are spent the night; Connect product and press the method transformed into escherichia coli DH5 α among the embodiment 1,, obtain the pCAMBIA2300-AhOleosin-humanin-OCS expression vector with KpnI and the correct clone of SalI double digestion checking.

(2) Agrobacterium-mediated Transformation of expression vector

The competent cell of preparation Agrobacterium EHA105: the single bacterium colony of picking Agrobacterium EHA105 shakes bacterium for 28 ℃ to 3ml LB substratum (containing Rifampin 25 μ g/ml) and spends the night; Get 1ml then and be inoculated in the 50ml liquid LB substratum and (contain Rifampin 50 μ g/ml), 28 ℃ of enlarged culturing, the 200rpm concussion is cultured to OD ₆₀₀=0.5; Ice bath 10min, 4 ℃ of 4500rpm, centrifugal 10min; Thalline is with the 0.1M CaCl of 50ml precooling ₂Resuspended, 4 ℃ of 4500rpm recentrifuge 10min; The thalline of collecting adds 2ml 20mM CaCl ₂Suspension-s (containing 15% glycerine), 80 μ l/ manage packing ,-80 ℃ of preservations behind the liquid nitrogen flash freezer.

Recombinant plasmid transformed Agrobacterium: get pCAMBIA2300-AhOleosin-humanin-OCS plasmid 5 μ l and add 80 μ lEHA105 Agrobacterium competent cells, place 30min on ice; Quick-frozen 90sec in the liquid nitrogen; 37 ℃ of water-bath quick-thawings, 3min; Add 800 μ l LB substratum, 28 ℃, 3h is cultivated in the 150rpm concussion; Moment is centrifugal, removes supernatant, and thalline band 200 μ l LB are coated on the LB flat board that is added with 25 μ g/ml Rifampins and 50 μ g/ml kantlex, cultivates 2-3d for 28 ℃.Get 1 μ l bacterium liquid and do template and carry out PCR checking, respectively with 3 pairs of primers: (primer1, primer2), (primer3, primer4), (primer1 primer4) carries out the PCR checking, and correct clone shakes bacterium through the PCR checking, preserves bacterial strains for-80 ℃.

The genetic transformation of embodiment 4 peanuts and the acquisition of transgenic peanut seed

(1) genetic transformation of peanut plumular axis

The preparation of ectoplast: ripe peanut seed decapsidate, with 70% ethanol seed soaking 1min, aseptic water washing 3 times; Use 0.1% mercuric chloride (w/v) to handle 15-25min again; Use then aseptic water washing 4-6 time, constantly shake seed during the sterilization, to guarantee the seed-coat sterilization thoroughly.Peel off kind of a skin, embryo is inoculated on the germination medium (sucrose 30g/L, agar 0.7%, MS macroelement, MS trace element), plumular axis gos deep in the substratum, cultivates about 4d and gets plumular axis as explant.25 ± 1 ℃ of culture temperature, intensity of illumination 3500lux.

Infecting of peanut plumular axis explant: the Agrobacterium EHA105 that contains plant expression vector of fresh culture, the centrifugal collection thalline of 5000g/min is resuspended in the liquid inducing culture, and the optimum concn of agroinfection is OD ₆₀₀=0.5-0.8.Scalpel cuts the peanut plumular axis of the 4d of sprouting, in agrobacterium suspension, soaks 25-30min, and the taking-up explant is inhaled on filter paper and removed unnecessary bacterium liquid; Be inoculated into inductive differentiation medium (MS+ sucrose 30g/l, agar 0.7%, 6-BA 10mg/l then; NAA 0.8mg/l) on, the dark place is cultivated 2d altogether.

Select the regeneration of substratum and transformed plant: after cultivating altogether; Explant is received recovery cultivation 7d on the inductive differentiation medium that contains the 500mg/L Pyocianil; Receive the enterprising row filter of inductive differentiation medium that contains 10mg/L Totomycin and 500mg/L Pyocianil again; Be transferred to further screening on the inductive differentiation medium that contains the 25mg/L Totomycin after cultivating 7d, the about 3-4 bud point that occurs after week growing thickly, later per 2 weeks are changed a fresh culture.When the bud of waiting to grow thickly is grown to 1-2cm it is downcut, move to differentiation elongation medium (MS+ sucrose 30g/L, agar 0.7%, GA ₃4mg/l, 6-BA2mg/l) on, Totomycin concentration is reduced to 10mg/l, when seedling grows to 3-5cm, with its move to root media (1/2MS+ sucrose 30g/L, agar 0.7%, NAA2.0mg/l) in, the transplanting of refining seedling, transfer-gen plant.

(2) acquisition of transgenic peanut seed

The results peanut seed, plantation and results s-generation seed extract DNA and carry out PCR detection and Southern hybridization, and the checking transfer-gen plant obtains the transgenic peanut seed.

Embodiment 5Western Blot detects the proteic expression of humanin in the transgenic peanut seed

From the transgenic peanut seed, extract recombinant protein:

(1) gets the 0.5g dry seeds and extract damping fluid (sucrose 0.6M, KCl 10mM, MgCl in 8ml ₂1mM, Tris-Cl 0.15M pH 7.5) in, homogenate.

(2) the centrifugal 20min of 12000rpm gets oil phase.

(3) add the resuspended mixing of extraction damping fluid, the centrifugal 20min of 12000rpm collects oil phase.

(4) add the floating damping fluid of 5ml (sucrose 0.4M, KCl 10mM, MgCl ₂1mM, Tris-Cl 0.15M pH 7.5) resuspended, the centrifugal 20min of 12000rpm collects oil phase.

(5) add NaHCO ₃Ice bath 30min, the centrifugal 20min of 12000rpm collects oil phase.

(6) with excessive propanone 0 ℃ of extracting 3 times, remove triacylglycerol and dry up sedimentary albumen, be dissolved in then in an amount of sterilized water.Western Blot hybridization:

(1) the recombinant protein 50 μ g with extraction pass through 12% SDS-PAGE gel electrophoresis separation.

(2) electrophoresis cuts into suitable size with glue after finishing, with changeing film liquid balance 3 times, each 5 minutes.

(3) nitrocellulose filter is used the zero(ppm) water rinse, the electricity consumption shifting method with the protein transduction on the glue to film.

(4) after the commentaries on classics film is put into staining fluid 50s, it is clear to background in 50% methyl alcohol, to decolour, and cleans with distilled water then.

(5) with 0.01M PBS (NaCl 8.0g, KCl 0.2g, Na ₂HPO ₄1.44g, KH ₂PO ₄0.24g add H ₂O is settled to 1000ml) wash film 3 times, each 15min washes 3h with the immersion of 3% gelatin then, seals non-specific site.

(6) film is taken out, wash 2 times, each 10min with 0.01M PBS.

(7) add one anti-(Monoclonal anti-human BMP7 antibody) with 1000 times of PBS dilutions, room temperature combines 2h, and negative control is with 1% BSA.

(8) abandon an anti-and BSA, wash film 4 times with the PBS of 0.01M, at every turn 5min.

(9) add two of horseradish peroxidase and resist (with 2000 times of PBS dilutions), room temperature jog 2h.

(10) abandon two and resist, wash film 4 times, each 5min with PBS.

(11) add colour developing liquid, the distilled water termination reaction is put in the lucifuge colour developing when band occurring.

Embodiment 6 is extensive the separation and recovery people humanin albumen from the transgenic peanut seed

People humanin albumen sepn also reclaims, with the homogenate of transgenic peanut seed, squeezing; Remove deposition (seed hair etc.) after centrifugal, reclaim the oil phase on upper strata, clean back, the centrifugal oil phase of getting the upper strata again; Add erepsin and carry out the enzymic digestion reaction, the centrifugal oil phase that removes the upper strata reclaims the purified people humanin albumen that obtains of water.

Claims

1. proteic method of expressing human humanin in peanut seed, step comprise (1) clone peanut oil body protein Gene A holeosin and promotor thereof; (2) synthetic people humanin protein coding gene; (3) make up the pCAMBIA2300-Aholeosin-humanin-OCS plant expression vector; (4) conversion of peanut; (5) acquisition of transgenic peanut seed; (6) Western Blot detects the proteic expression of humanin in the transgenic peanut seed; (7) separation and purification and reclaim people humanin albumen from the transgenic peanut seed; It is characterized in that:

The method of said synthetic people humanin protein coding gene is: design and synthesize two single stranded DNA primers of part complementary, wherein forward primer comprise the KpnI enzyme cut a GGTACC with the some erepsin recognition sequence (GATGATGATGATAAG): GAAGGTACCG ATGATGATGA TAAGATGGCT CCACGAGGGT TCAGCTGTCT CTTACTTTTA ACCAGTGAAA TTGACCTGCC; Reverse primer comprises His tag sequence (CACCACCACCACCACCAC) and SalI restriction enzyme site (GTCGAC): ACGCGTCGAC TTAGTGGTGG TGGTGGTGGT GTGCCCGCCT CTTCACGGGC AGGTCAATTT CACTGGTTAA AAGTAAGAGA; Utilize the TAQ enzyme to anneal and extend, program is: 94 ℃ of 3min; 40 ℃ of 1min; 72 ℃ of 2min; Preserve product for 16 ℃; Product is connected with the T carrier, and the transformed into escherichia coli cell is chosen the order-checking of resistance mono-clonal, confirms to carry the correct cloning vector of humanin gene;

2. according to claim 1 in peanut the proteic method of expressing human huamnin, it is characterized in that: the order of connection of the oil body protein gene of peanut and promotor, recombinant protein encoding sox is for " peanut oil body protein promotor+peanut oil body protein gene+erepsin recognition site+people humanin protein gene+terminator " in the said plant expression vector.