CN104017809A - Expression gene and method for modified human Insulin protein - Google Patents
Expression gene and method for modified human Insulin protein Download PDFInfo
- Publication number
- CN104017809A CN104017809A CN201410247746.2A CN201410247746A CN104017809A CN 104017809 A CN104017809 A CN 104017809A CN 201410247746 A CN201410247746 A CN 201410247746A CN 104017809 A CN104017809 A CN 104017809A
- Authority
- CN
- China
- Prior art keywords
- expressing
- peanut
- gene fragment
- protein
- insulin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention relates to an expression gene and method for a modified human Insulin protein. The expression method comprises the steps of expressing a gene fragment of an easily-expressed human Insulin protein in a peanut oil body protein system; optimizing the expression gene of the human Insulin protein according to a peanut preferred codon, and carrying out the following modification: changing nucleotide for expressing Asn21 in a gene fragment for expressing a chain A into nucleotide for expressing Gly21, and adding nucleotide for expressing two amino acid residues Arg31 and Arg32 at the terminal of a gene fragment for expressing a chain B. According to the invention, the human Insulin protein is expressed in a peanut seed by using the oil body protein system, oil body proteins account for more than 10% of the total proteins of the seed by utilizing the characteristic that the peanut seed is rich in oil, and the high-level accumulation of the Insulin protein is realized through the codon optimization of the expression gene of the human Insulin protein and the fusion expression of a peanut oil body protein.
Description
Technical field
The present invention relates to a kind of people Insulin protein expression gene and expression method of transformation, relate in particular to the transformation, codon optimized and utilize oil body protein expression system to express the method for people Insulin in peanut seed of Insulin sequence, belong to biological technical field.
Background technology
" diabetes " are the diseases of the easy overheap of glucose in a kind of blood, and it is high especially that more than 40 years old middle-aged people catches rate.Diabetic subject's number of China in 2010 occupies the hat in the whole world according to statistics, has reached 9,240 ten thousand.Insulin is the interior unique hypoglycemic hormone that falls of body, has effect and the status that can not be substituted in treating diabetes.There is nearly hundred million people's diabetic subject in China, so huge to the demand of Insulin.
Clinically with Insulin, mainly from animal pancreas, extract the earliest the risk that exists infecting both domestic animals and human cause of disease bacterium and Protein virus to pollute.Along with the research of DNA recombinant technology is goed deep into; success has been expressed restructuring Insulin at intestinal bacteria and yeast in as pichia spp; but; there is contaminated with endotoxins and cannot complete the system inherent defects such as protein modified in protokaryon intestinal bacteria and lower eukaryotes yeast expression restructuring Insulin; and express Insulin with botanical system, there is the mass-producing of being easy to safety and low-cost advantage, can make up the deficiency of protokaryon and Yeast system.
Plant bioreactor cost is low, do not exist cell cultures difficulty, the substratum of existence in transgenetic animal cell or microorganism fermentation expensive, when large-scale production, need strict culture condition avoid problem (Liu and Jia, 2003 such as pollution, cost increasing; Gomord et al, 2004); Safe, there are not risk (Commandeur et al, 2003 of the pollution of pathogenic bacteria; Cai et al, 2004); The product of producing generally contains higher biological activity and immunocompetence (Daniell et al, 2001); Genetic stability is high, by selfing and separation energy, obtains very soon transgenosis homozygote (Verwoerd et al, 1995; Liu et al, 2000); And plant transgenic technology is ripe.Utilizing plant-bioreactor to produce useful proteins, be " molecular farming (molecular farming) " (Commandeur et al, 2003), is a kind of very safe mode of production.At present existing various plants is as bio-reactor, as tobacco (McCormick et al, 1999; Ma et al1995), soybean (Giddings et al, 2000), Arabidopis thaliana (Potera, 1999), corn, rape (Arakawa et al, 1998; Witcher et al, 1998)., potato (Richter et al, 2000; Artsaenko et al, 1998), tomato (Chen et al, 2009) etc., its expression product is also diversified, as has the pharmaceutical protein, vaccine, antibody etc. (Yang et al, 2009) of important value.
In transgenic Rhizoma Solani tuber osi stem tuber, express in the world the fusion rotein of people Insulin, Insulin only accounts for 0.022% of soluble proteins in potato tuber.SemBioSys bio-engineering corporation utilizes oil body protein expression system in safflower, to express people Insulin, in the Semen Flos Carthami that every mu of safflower produces, can extract 165 grams of Insulin,
Oil body protein system is higher than the content of other expression systems Insulin, may be due to oil body protein high level expression a large amount of accumulation (Yi-hui and Shi-rong in seed, 2003), and utilize the fat-soluble feature of oil body protein to be easy to fusion rotein separation and purification, storage still can keep Stability Analysis of Structures (Frandsen et al for a long time, 2001), its application prospect is very extensive.Utilize at present oil body protein system successfully to obtain the multiple protein (Zhao et al, 2009) such as bioactive r-hirudin, Nattokinase, beta-glucan aldehydic acid enzyme, zytase, Urogastron.
Peanut (Arachis hypogaea) is as one of most important oil crops of China, both can extract oil and deep processing, can eat raw again, and peanut yield is high, if produce Insulin in peanut, according to every mu of 600 jin of peanuts, if accounting for 1% of seed protein, calculates Insulin, approximately 900 grams of the Insulin of every mu of peanut production are more than 5 times of safflower.People Insulin albumen has wide potential applicability in clinical practice, through retrieval, at present also not about utilizing oil body protein expression system to express the report of the method for people Insulin albumen in peanut seed.
Summary of the invention
The present invention is directed to the deficiencies in the prior art, a kind of people Insulin protein expression gene and expression method of transformation is provided, realize Insulin high-caliber expression accumulation in peanut seed.
Technical solution of the present invention is as follows:
A kind of people Insulin protein expression gene fragment that is easy to expression in peanut oil body protein system, the expressing gene of expressing people Insulin albumen is optimized according to the codon of peanut preference, and transform as follows: the Nucleotide of expressing Asn21 in the gene fragment of expression A chain is become to the Nucleotide of expressing Gly21, and the end of simultaneously expressing B chain gene fragment adds the Nucleotide of expressing Arg31, two amino-acid residues of Arg32.
Preferred according to the present invention, the nucleotide sequence of above-mentioned people Insulin protein expression gene fragment is as shown in SEQ ID NO.1.
Proinsulin (Insulin albumen) be one containing 21 amino acid whose A chains and 30 amino acid B chains and C connection peptides, totally 86 amino acid, by N hold to the order of connection of C end be B-Arg-Arg-C-Lys-Arg-A; The sequence of people Insulin is transformed into coding region to the codon of peanut preference, and the Asn21 of A chain is become to Gly21, B chain end adds Arg31, two amino-acid residues of Arg32 simultaneously, makes the structure of Insulin more stable, and action effect is more lasting.After transformation, can give the encoding sequence of the synthetic Insulin of biotech firm.
Utilize oil body protein system in peanut seed, to express a method for people Insulin albumen, step is as follows:
(1) the above-mentioned people Insulin protein expression gene fragment that is easy to express is carried out to synthetic in peanut seed, make the rear expressing gene fragment of transformation;
(2) take expressing gene fragment after the transformation that step (1) makes carries out pcr amplification as template, and amplimer is as follows:
Forward primer: GGATCCATGGATTACAAGGATGATGA;
Reverse primer: TCTAGATTACCCGCAATAATTCTCGA;
PCR product through checking order correct, after restriction enzyme BamH I and restriction enzyme Xba I double digestion, and is connected with the carrier of restriction enzyme Xba I double digestion through restriction enzyme BamH I equally, makes plant expression vector;
(3) plant expression vector that step (2) makes utilizes Agrobacterium infestation method to transform peanut, obtains transfer-gen plant, through educate numerous after, the homozygotic peanut seed of results s-generation transgenic peanuts, purified, make people Insulin albumen.
Preferred according to the present invention, in described step (2), PCR reaction system is as follows:
Template 1 μ l, 2 * LA Taq mix10 μ l, forward primer (10 μ M) 0.5 μ l, reverse primer (10 μ M) 0.5 μ l, ddH
2o8.0 μ l.
PCR response procedures is as follows:
94 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ are extended 30s, 30 circulations; 72 ℃ are extended 10min again.
Preferred according to the present invention, the order-checking in described step (2) is for to be connected to T carrier by PCR product, correct through artificial order-checking, obtains.
Preferred according to the present invention, the carrier of described step (2) is pCAMBIA2301-AhOleosin carrier, and the peanut oil body protein promotor by insertion sequence on carrier pCAMBIA2301 as shown in SEQ ID NO.2 and peanut oil body protein gene and the sequence terminator as shown in SEQ ID NO.3 obtains.
Preferred according to the present invention, in described step (3), the step of purifying is as follows:
By peanut seed homogenate, squeezing; After centrifugal, remove precipitation, reclaim the oil phase on upper strata, cleaning is rear, centrifugal, then gets the oil phase on upper strata, adds erepsin to carry out enzymic digestion reaction, and then the centrifugal oil phase that removes upper strata, reclaims water, extracts and obtains people Insulin albumen.
Beneficial effect
1, the present invention adopts oil body protein system in peanut seed, to express people Insulin albumen, utilize the feature that peanut seed oleaginousness is abundant, make oil body protein account for the more than 10% of seed protein, the gene codon optimization of people Insulin protein expression and peanut oil body protein amalgamation and expression have been realized the high level accumulation of Insulin albumen;
2, because peanut seed is convenient to storage, convenient transportation, and also the stability of recombinant protein in seed is high, can in seed, keep active for a long time, thereby solved, people Insulin albumen stores, the problem of transportation;
3, peanut strong adaptability, cultivated area is wide, and the Insulin separation and purification of amalgamation and expression is simple to operation, and cost is low, has increased the added value of agricultural-food, for the development of molecular farming and bio-pharmaceuticals provides technical support; Compare with reaction of animals device with microorganism, plant expression system all has more potential advantage at aspects such as immunogenicity, security, source and costs.
Accompanying drawing explanation
The structure schematic diagram of the carrier pCAMBIA2301-Aholeosin-Insulin that Fig. 1, the present invention build;
Fig. 2, Western detect the expression of results photo of Insulin albumen in transgenic peanuts seed;
Wherein: 1,2: turn the peanut through the Insulin of Optimizing Reconstruction protein expression gene, WT: wild-type, 3,4: turn the peanut without the Insulin protein expression gene of Optimizing Reconstruction;
Fig. 3, transgenic peanuts Western detect the column analysis chart of Insulin albumen;
Wherein: 1,2: turn the peanut through the Insulin of Optimizing Reconstruction protein expression gene, WT: wild-type, 3,4: turn the peanut without the Insulin protein expression gene of Optimizing Reconstruction.
Embodiment
Below in conjunction with embodiment, technical scheme of the present invention is described further, but institute of the present invention protection domain is not limited to this.
Embodiment 1, people Insulin sequence are transformed and synthesize
According to encoding sequence (the gene accession number: BT006808.1) of people Insulin in NCBI, encoding sequence is transformed into peanut preference codon, the Asn21 of Insulin A chain is become to Gly21 simultaneously, B chain end adds Arg31 simultaneously, two amino-acid residues of Arg32, people Insulin protein expression nucleotide sequencing after Optimizing Reconstruction, as shown in SEQ ID No.1, is synthesized people Insulin protein expression gene fragment by biotech firm.
Embodiment 2, structure pCAMBIA2301-Aholeosin-Insulin plant expression vector
As shown in Figure 1, wherein the amplification of Insulin sequence and acquisition are as follows for building process:
With forward primer primer1:GGATCCATGGATTACAAGGATGATGA, with reverse primer primer2:TCTAGATTACCCGCAATAATTCTCGA, people Insulin protein expression gene fragment by synthetic sequence as shown in SEQ ID NO.1 is template, carry out PCR reaction, PCR reaction system is: template 1 μ l, 2 * LA Taq mix10 μ l, forward primer (10 μ M) 0.5 μ l, reverse primer (10 μ M) 0.5 μ l, ddH
2o8.0 μ l.
The program of PCR reaction is: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ are extended 30s, 30 circulations; 72 ℃ are extended 10min again.
PCR product is through the agarose gel electrophoresis of 1.5wt%, and glue reclaims 300bp left and right band, is connected to (pEASY T3, purchased from Transgen Biotech company) on T carrier, and linked system is:
Reclaim product 4 μ l, T carrier 1 μ l, 25 ℃ connect 15min, connect product and transform competent escherichia coli cell.
The preparation of bacillus coli DH 5 alpha competent cell:
(1) get-70 ℃ of freezing E.coli DH5 α bacterial classifications, use method of scoring inoculated bacteria in LB substratum, 37 ℃ of overnight incubation.
(2) get bacterium colony that a ring is fresh in 3ml LB test tube is housed, at 37 ℃ of about 16h of shaking culture.
(3) get the above-mentioned bacterium liquid of 1ml and be transferred to (inoculum size is determined by bacterial concentration, generally in 1% left and right) in 30ml LB Erlenmeyer flask is housed, thermal agitation is cultured to OD
600value 0.2-0.4.
(4) by bacterium liquid ice bath 10min, pour in the centrifuge tube of meeting cold 50ml on ice.4 ℃, the centrifugal 5min of 4000rpm, abandons supernatant, collects thalline.
(5) use the CaCl of 50mmol/L precooling
2middle about 10ml, suspension cell gently, ice bath 10min, 4 ℃, 4000rpm, centrifugal 5min, abandons supernatant and collects thalline.
(6) thalline is suspended in to the cold CaCl of 50mmol/L of 1-2ml
2in.Put on ice as the competent cell that transforms use.
(7) with the rifle head of precooling, get 100 μ l and divide in the EP pipe that installs to precooling, add the glycerine of isopyknic 30% (volume percent), put into liquid nitrogen flash freezer ,-70 ℃ of preservations.
Colibacillary conversion: the connection product of above-mentioned 5 μ l is added in 100 μ l DH5 α competent cells and mixed.Place 30min on ice, 42 ℃ of heat shock 90s, ice bath 5min, adds 800 μ l liquid LB (NaCl10g/L, peptone 10g/L, yeast powder 5g/L), 37 ℃ of 100rpm shaking culture 1h, are evenly coated with rag (NaCl10g/L on the solid LB of the penbritin that contains 100 μ g/ml substratum by bacterium liquid, peptone 10g/L, yeast powder 5g/L, agar powder 15g/L), 37 ℃ of overnight incubation.Picking list bacterium colony is in 1mL liquid LB, and 37 ℃ are shaken bacterium 4-6h, with primer1 and primer2, carries out PCR detection, and positive colony is carried out to sequence verification (seeing sequence table SEQ ID No.1) with universal primer, obtains cloning vector T-insulin plasmid.
People Insulin protein gene is connected to pCAMBIA2301-AhOleosin expression vector:
The plant expression vector that peanut oil body protein promotor and peanut oil body protein gene (sequence is as shown in SEQ ID No.2) and tRUBP terminator (sequence is as shown in SEQ ID NO.3) is connected to pCAMBIA2301 (Cambia company is on sale), is built into pCAMBIA2301-AhOleosin.PCAMBIA2301-AhOleosin and T-insulin plasmid are used to Xba I and BamH I double digestion simultaneously, reclaim carrier and Insulin protein expression gene fragment, T4 ligase enzyme connects two fragments: 10 * T4DNA ligase buffer2 μ l, Insulin protein expression gene fragment 6 μ l, pCAMBIA2301-AhOleosin2 μ l, T4DNA ligase1 μ l, H
2o9 μ l, 16 ℃ of connections are spent the night.
Connect product and press the method conversion bacillus coli DH 5 alpha in embodiment 1, same picking list bacterium colony PCR checking, the success of sequence verification expression vector establishment.
The Agrobacterium-mediated Transformation of expression vector:
The competent cell of preparing Agrobacterium LBA4404:
(1) agrobacterium tumefaciens lba4404 of-80 ℃ of preservations is drawn to plate, cultivate two days for 28 ℃;
(2) picking mono-clonal, is inoculated in 5ml YEP liquid nutrient medium, and 28 ℃, 220rpm shaking culture is spent the night;
(3) get in 1ml dilution 50ml YEP (NaCl5g/L, peptone 10g/L, yeast powder 10g/L) substratum, 28 ℃ of 250rpm concussions are cultured to OD600 value 0.6;
(4) culture is placed in to 20min on ice, and jog frequently, guarantee that content is cooling fully;
(5) bacterium liquid is transferred in the 50ml centrifuge tube of precooling, 4 ℃, the centrifugal 10min of 5000rpm, abandons supernatant liquor;
(6) thalline is resuspended with the NaCl of the 0.15M of 10ml precooling; 4 ℃, the centrifugal 10min of 5000rpm;
(7) abandon supernatant, with the 20mM CaCl of 1ml precooling
2(glycerine containing 15%) (glycerine of 250 μ l60% adds 750 μ lCaCl
2) resuspended; Divide (200 μ l/ pipe) in the eppendorf pipe that installs to precooling;
Recombinant plasmid transformed Agrobacterium: add 1 μ l recombinant plasmid, ice bath 30min in 200 μ l competent cells; Liquid nitrogen freezing 1min; Cell 2-3min is melted in 37 ℃ of water-baths; Add 1ml YEP, 28 ℃ of light shaking 2-4h, low-speed centrifugal 1min, with 0.1ml YEP, suspend and precipitate, cell suspending liquid is coated containing 50 μ g/ml kantlex to the YEP of 50 μ g/ml Rifampins (NaCl5g/L, peptone 10g/L, yeast powder 10g/L, agar powder 15g/L) cultivate 2-3 days for dull and stereotyped upper 28 ℃, picking list bacterium colony, 1mlYEP shakes bacterium, primer1 and primer2PCR checking for bacterium liquid, positive strain-80 ℃ preservation.
The acquisition of the genetic transformation of embodiment 3, peanut and transgenic peanuts seed:
(1) genetic transformation of peanut plumular axis
The preparation of explant: ripe pod being removed to pericarp, be successively dipped in concentration and be 1min in 75% alcohol, is 0.1%HgCl in mass concentration
2in solution, soak 15min, carry out surface sterilization, then use rinsed with sterile water 3 times.Kind of a skin is peeled off, put into MS
0substratum is cultivated under light.Cultivate and get plumular axis as explant in about 4 days.
MS
0substratum is prepared as follows:
Get mother liquor I 50mL, mother liquor II, III, each 5mL of IV; Get again 2,4-D (2,4 dichlorophenoxyacetic acid) 5mL, NAA (naphthylacetic acid) 1mL puts into beaker together, sterilized water constant volume is to 1L.Solid medium adds 9g agar again.
Mother liquor I component is as shown in table 1:
Table 1
NH 4NO 3 | KNO 3 | CaCl 2·2H 2O | MgSO 4·7H 2O | KH 2PO 4 |
3.3g/L | 3.8g/L | 8.8g/L | 7.4g/L | 3.4g/L |
Mother liquor II component is as shown in table 2:
Table 2
KI | H 3BO 3 | MnSO 4·4H 2O | ZnSO 4·7H 2O | N?a 2MoO 4·2H 2O | CoCl 2·6H 2O | CuSO 4·5H 2O |
0.166g/L | 1.24g/L | 4.46g/L | 1.72g/L | 0.05g/L | 0.005g/L | 0.005g/L |
Mother liquor III component is as shown in table 3:
Table 3
FeSO 4·7H 2O | Na 2-EDTA·2H 2O |
5.56g/L | 7.46g/L |
Mother liquor IV component is as shown in table 4:
Table 4
Infecting of peanut plumular axis explant:
Plumular axis is put into the Agrobacterium LBA4404 bacterium liquid (OD after fresh conversion
6000.5~0.8) in, soak 20min, during constantly rock.Take out and dry on filter paper, then moving on in common substratum, under dark condition, cultivating altogether 2 days.
Nutrient media components is as follows altogether:
MS adds the NAA of 0.7mg/L, the 6-BA of 8.0mg/L (6-benzyl aminopurine).
The regeneration of transformed plant: secretly cultivating after 2 days, is the plumular axis 10min that 1% cephalo aqueous solution soaking has infected by mass percent, with aseptic water washing 3-4 time, takes out and dries on filter paper, then moves on in division culture medium, under light, cultivates.Approximately 2-5 is after week, and Multiple Buds grows to 1-2cm and cuts and proceed to elongation medium, under light, cultivates.When budlet grows into certain length, forwarded on root media, short its taken root.After root system development is good, seedling is washed to root immigration and fill in the flowerpot of sterile soil, lid mulch film 3-5 days.Hot-house culture, grows to and to a certain degree moves on in large basin, Routine Management.
Division culture medium component is as follows:
MS minimum medium adds NAA0.7mg/L, 6-BA8.0mg/L.Separately add the cefotaxime sodium (Cef) of 250mg/L and the Kan of 75mg/L.
Elongation medium component is as follows:
MS minimum medium adds GA
3(Plant hormones regulators,gibberellins) 2.0mg/L, 6-BA8.0mg/L.Add the Cef of 250mg/L and the Kan of 75mg/L.
Root media component is as follows:
MS minimum medium adds sucrose 20g, IBA (indolebutyric acid) 0.7mg/L, NAA0.7mg/L, GA
32.0mg/L, pH5.4.
(2) acquisition of transgenic peanuts seed
Transgenic peanuts plant is extracted DNA:
(1) in advance 65 ℃ of preheatings of CTAB extracting solution (CTAB2%, PVP404%, Tris-Cl (pH8.0) 100mM, EDTA (pH8.0) 20mM, NaCl, beta-mercaptoethanol (V/V) 2%).
(2) got plant sample is fully ground to fine powdered with liquid nitrogen, with the little spoon of Liquid nitrogen precooler, proceed to rapidly the 1.5ml eppendorf pipe of precooling, add immediately 600 μ l CTAB extracting solutions and at once concuss mix rear horse back and be put at least 1h of 65 ℃ of water-baths.
(3) add isopyknic phenol/chloroform/primary isoamyl alcohol solution (volume ratio 25:24:1), after fully gentleness mixes, standing 10min, the centrifugal 15min of 12000rpm.
(4) get supernatant and forward new pipe to, add isopyknic chloroform/primary isoamyl alcohol solution (volume ratio 24:1), after fully gentleness mixes, the centrifugal 15min of 12000rpm.
(5) add the Virahol of 0.8 times of volume precooling, mix standing 3~5min under normal temperature, with self-control glass hook or rifle head, cotton-shaped DNA is chosen to (also can centrifugally obtaining).
(6) abandon supernatant, 70% alcohol washing 2-3 time for precipitation, then wash 1-2 time with dehydrated alcohol, and remove all liquid, drain or dry up DNA, with appropriate sterilized water, dissolve and spend the night.After electrophoresis, survey concentration, standby.
Primer1 and primer2PCR checking for the DNA extracting, PCR product, through the agarose gel electrophoresis of 1.5wt%, is observed under ultraviolet lamp, sun plant is collected seed, after plantation, extract DNA and carry out PCR detection and Southern hybridization, checking transfer-gen plant, results s-generation transgenic peanuts seed.
Embodiment 4, Western Blot detect the expression of Insulin albumen in transgenic peanuts seed
From transgenic peanuts seed, extract oil body protein:
1. get seed 0.1g and put into mortar, BufferA (the 10mM PBS that adds 0.6mL, 2mM dithiothreitol (DTT), 0.6M sucrose), fully grind to form after homogenate, proceed in 2mL centrifuge tube, on liquid level coated with equal-volume BufferB (10mMPBS, 0.4M sucrose), 10000g4 ℃ of centrifugal 30min.
2. the careful upper strata oil body Eddy diffusion of collecting is in the BufferC of 0.6mL (5mM PBS, 0.1M sucrose), on liquid level coated with equal-volume BufferD (10mM PBS, 0.25 sucrose, 2M NaCl), 10000g4 ℃ of centrifugal 30min.
3. the careful upper strata oil body Eddy diffusion of collecting is in 0.6mL9M urea soln, the room temperature 60rpm 10min that vibrates, and liquid level is coated with the PBS of isopyknic 10mM, 10000g4 ℃ of centrifugal 30min.
4. the careful upper strata oil body of collecting, is suspended in a small amount of BufferA, in 4 ℃, saves backup.
Western hybridization:
1, the sample loading obtaining is utilized BCA method measure protein concentration, isocyatic oil body protein carries out the SDS-PAGE gel electrophoresis of 15wt%;
2, after electrophoresis finishes, remove spacer gel, with scissors cut that the filter paper 6-8 identical with separation gel size opens, 1 of pvdf membrane;
3, pvdf membrane soaks 30s in methyl alcohol, filter paper, pvdf membrane, gel and sponge are at transfering buffering liquid (25mM Tris-Cl, 192mM glycine, 20%V/V methyl alcohol, PH8.3) in, soak after 5min, by the der group of negative plate, sponge, three filter paper, gel, pvdf membrane, three filter paper, sponge, positive plate, dress up " sandwich " structure; Then, transferring film 30min (glue is at negative pole, and film is at positive pole) under the electric current of 100mA; Unload membrane-transferring device;
4, the blank site on the TBST solution sealing pvdf membrane containing 5% skim-milk, 1h for pvdf membrane;
5, TBST (Tris Base3.028g, NaCl29.25g, Tween-200.05%) washes film 3 times, each 10min;
6, primary antibodie reaction solution and pvdf membrane incubation 2h;
7, TBST solution is washed pvdf membrane 3 times, each 10min;
8, two anti-reaction solutions and pvdf membrane incubation 1h;
9, TBST solution is washed pvdf membrane three times, each 15min;
10, equal-volume A liquid B liquid (raw work test kit) mixes, and pvdf membrane is hatched 5min in mixed solution, moulding sheet 20min developing fixing.Result as shown in Figures 2 and 3.
The result of Fig. 2 and Fig. 3 can find out, after the Regular Insulin sequence of optimizing is expressed in peanut, expression amount, apparently higher than the Regular Insulin sequence without optimizing, show that through software analysis its expression amount is than 4 times of the insulin gene mean heights without optimization.
Embodiment 5, extensive separated and reclaim people Insulin albumen from transgenic peanuts seed
People Insulin albumen sepn also reclaims, by the homogenate of transgenic peanuts seed, squeezing; After centrifugal, remove precipitation (seed hair etc.), reclaim the oil phase on upper strata, clean rear, the centrifugal oil phase of getting again upper strata; Add erepsin to carry out enzymic digestion reaction, the centrifugal oil phase that removes upper strata, reclaims water, extracts and obtains people Insulin albumen.
Claims (8)
1. one kind is easy to the people Insulin protein expression gene fragment of expressing in peanut oil body protein system, the expressing gene of expressing people Insulin albumen is optimized according to the codon of peanut preference, and transform as follows: the Nucleotide of expressing Asn21 in the gene fragment of expression A chain is become to the Nucleotide of expressing Gly21, and the end of simultaneously expressing B chain gene fragment adds the Nucleotide of expressing Arg31, two amino-acid residues of Arg32.
2. people Insulin protein expression gene fragment as claimed in claim 1, is characterized in that, the nucleotide sequence of above-mentioned people Insulin protein expression gene fragment is as shown in SEQ ID NO.1.
3. utilize oil body protein system in peanut seed, to express a method for people Insulin albumen, it is characterized in that, step is as follows:
(1) the above-mentioned people Insulin protein expression gene fragment that is easy to express is carried out to synthetic in peanut seed, make the rear expressing gene fragment of transformation;
(2) take expressing gene fragment after the transformation that step (1) makes carries out pcr amplification as template, and amplimer is as follows:
Forward primer: GGATCCATGGATTACAAGGATGATGA;
Reverse primer: TCTAGATTACCCGCAATAATTCTCGA;
PCR product through checking order correct, after restriction enzyme BamH I and restriction enzyme Xba I double digestion, and is connected with the carrier of restriction enzyme Xba I double digestion through restriction enzyme BamH I equally, makes plant expression vector;
(3) plant expression vector that step (2) makes utilizes Agrobacterium infestation method to transform peanut, obtains transfer-gen plant, through educate numerous after, the homozygotic peanut seed of results s-generation transgenic peanuts, purified, make people Insulin albumen.
4. method as claimed in claim 3, is characterized in that, in described step (2), PCR reaction system is as follows:
Template 1 μ l, 2 * LA Taq mix10 μ l, 10 μ M forward primer 0.5 μ l, 10 μ M reverse primer 0.5 μ l, ddH
2o8.0 μ l.
PCR response procedures is as follows:
94 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ are extended 30s, 30 circulations; 72 ℃ are extended 10min again.
5. method as claimed in claim 3, is characterized in that, the order-checking in described step (2) is for to be connected to T carrier by PCR product, correct through artificial order-checking, obtains.
6. method as claimed in claim 3, it is characterized in that, the carrier of described step (2) is pCAMBIA2301-AhOleosin carrier, and the peanut oil body protein promotor by insertion sequence on carrier pCAMBIA2301 as shown in SEQ ID NO.2 and peanut oil body protein gene and the sequence terminator as shown in SEQ ID NO.3 obtains.
7. method as claimed in claim 3, is characterized in that, in described step (3), Agrobacterium is LBA4404.
8. method as claimed in claim 3, is characterized in that, in described step (3), the step of purifying is as follows: by peanut seed homogenate, squeezing; After centrifugal, remove precipitation, reclaim the oil phase on upper strata, cleaning is rear, centrifugal, then gets the oil phase on upper strata, adds erepsin to carry out enzymic digestion reaction, and then the centrifugal oil phase that removes upper strata, reclaims water, extracts and obtains people Insulin albumen.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410247746.2A CN104017809A (en) | 2014-06-05 | 2014-06-05 | Expression gene and method for modified human Insulin protein |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410247746.2A CN104017809A (en) | 2014-06-05 | 2014-06-05 | Expression gene and method for modified human Insulin protein |
Publications (1)
Publication Number | Publication Date |
---|---|
CN104017809A true CN104017809A (en) | 2014-09-03 |
Family
ID=51434809
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410247746.2A Pending CN104017809A (en) | 2014-06-05 | 2014-06-05 | Expression gene and method for modified human Insulin protein |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104017809A (en) |
Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1043719A (en) * | 1988-12-23 | 1990-07-11 | 诺沃-诺迪斯克有限公司 | The preparation method of human insulin analogue |
CN1072723A (en) * | 1991-11-26 | 1993-06-02 | 伊莱利利公司 | Tri-arginine insulins |
CN101037692A (en) * | 2006-12-28 | 2007-09-19 | 吉林农业大学 | Method for expressing human insulin by using plant seed oil body |
CN101586117A (en) * | 2009-03-20 | 2009-11-25 | 中山大学 | Application of peanut oil Aholeosin gene promoter for driving exogenous gene to specifically express in transgenic plant seed |
CN102268451A (en) * | 2010-06-01 | 2011-12-07 | 安胜军 | Human insulin gene-containing expression vector and construction method and application thereof |
CN102321665A (en) * | 2011-09-29 | 2012-01-18 | 山东省农业科学院高新技术研究中心 | Method for expressing human humanin protein in peanut seed |
-
2014
- 2014-06-05 CN CN201410247746.2A patent/CN104017809A/en active Pending
Patent Citations (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1043719A (en) * | 1988-12-23 | 1990-07-11 | 诺沃-诺迪斯克有限公司 | The preparation method of human insulin analogue |
CN1072723A (en) * | 1991-11-26 | 1993-06-02 | 伊莱利利公司 | Tri-arginine insulins |
CN101037692A (en) * | 2006-12-28 | 2007-09-19 | 吉林农业大学 | Method for expressing human insulin by using plant seed oil body |
CN101586117A (en) * | 2009-03-20 | 2009-11-25 | 中山大学 | Application of peanut oil Aholeosin gene promoter for driving exogenous gene to specifically express in transgenic plant seed |
CN102268451A (en) * | 2010-06-01 | 2011-12-07 | 安胜军 | Human insulin gene-containing expression vector and construction method and application thereof |
CN102321665A (en) * | 2011-09-29 | 2012-01-18 | 山东省农业科学院高新技术研究中心 | Method for expressing human humanin protein in peanut seed |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106635809B (en) | A kind of method and its application using stalk fibre hydrolyzate culture microalgae | |
CN104046636A (en) | Codon vegetalization-transformed PMI gene and applications thereof | |
CN101857875B (en) | Method for carrying out gene transformation on manioca by using Agrobacterium tumefaciens mediated transformation | |
CN106399114B (en) | A kind of method and application improving DNC wireless ethanol tolerance ability | |
CN104894162B (en) | Gene transformation duckweed and the method expressed | |
CN101875936A (en) | Promoter specifically-expressed in rice embryo and application thereof | |
CN106047738A (en) | Recombinant pichia pastoris, construction method and application of recombinant pichia pastoris | |
CN102433354B (en) | A kind of screening technique that xylose isomerase gene is used for Semen arachidis hypogaeae genetic transformation | |
CN105002196B (en) | A kind of swine fever recombinant vaccine | |
CN104404043A (en) | Promoter of gene Me094 related to bacterial-blight resistance of Oryza meyeriana | |
CN101875940B (en) | Salt-tolerant sinorhizobium meliloti NSM18 and special gene cluster thereof | |
CN1054160C (en) | Method for cultiating tomato with function of anti virus of mosaic of cucumber by gene engineering | |
CN103966110B (en) | A kind of penicillium oxalicum Host Strains for improving filamentous fungus protein expression | |
CN105950644B (en) | The albumen and application of asparagus enzyme, namely chalcone isomerase gene and its coding | |
CN103045640B (en) | Plant expression vector for SGF14a gene of Tanba black soybean and application of plant expression vector | |
CN104017809A (en) | Expression gene and method for modified human Insulin protein | |
CN106086055B (en) | The strain of DNC wireless algae and its construction method that a kind of pair of alcohol resistance significantly improves | |
CN109370922A (en) | A pair of wild rice smut for successfully realizing the normal hay artificially breeding of wild rice stem and its application | |
CN102268451B (en) | Human insulin gene-containing expression vector and construction method and application thereof | |
CN108707574B (en) | One plant of yielding lipase engineering bacteria, its construction method and application | |
CN106676131A (en) | Method for generating alfalfa genome edited homozygous plant | |
CN103146748A (en) | Agrobacterium mediated rose bud transgenosis infecting method | |
CN103045543B (en) | A kind of transmissible gastro-enteritis virus strain | |
CN107641155A (en) | A kind of method of the recombinant Human Serum Albumin Expression in plant | |
CN100999730B (en) | Process of producing scorpion anti-nerve excited peptide using transferring gene plant |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140903 |