CN102311489A - Plant heat-resistant gene BccDREB2A and application thereof - Google Patents
Plant heat-resistant gene BccDREB2A and application thereof Download PDFInfo
- Publication number
- CN102311489A CN102311489A CN2010102228300A CN201010222830A CN102311489A CN 102311489 A CN102311489 A CN 102311489A CN 2010102228300 A CN2010102228300 A CN 2010102228300A CN 201010222830 A CN201010222830 A CN 201010222830A CN 102311489 A CN102311489 A CN 102311489A
- Authority
- CN
- China
- Prior art keywords
- plant
- seq
- polynucleotide
- bccdreb2a
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention relates to a plant heat-resistant gene BccDREB2A and application thereof. A new plant heat-resistant gene is separated from brassica plants for the first time and can improve the heat-tolerant capacity of the plants obviously. The invention also provides proteins of gene codes and a preparation method thereof, a carrier and a host cell containing the gene and a method for preparing transgenic plants carrying the gene.
Description
Technical field
The invention belongs to biotechnology and phytology field; More specifically, the present invention relates to a kind of plant heat resistanceheat resistant gene BccDREB2A and an application thereof.
Background technology
Chinese cabbage group mainly comprises balling class Chinese cabbage (Brassica campestris L.ssp.pekinensis) and balling class Plantula Brassicae chinensis (Brassica campestris L.ssp.chinensis) not.Plantula Brassicae chinensis is called for short green vegetables, and rape is claimed in the north, and its flexibility is strong, and growth is fast, and output is high, and nutrition is good, and consumption occupies first of all kinds of vegetables, is a kind of popular vegetables of each province, China Yangtze valley common cultivated.Plantula Brassicae chinensis kind and various in style, vegetative period is short, wide adaptability, high yield, the saving of labor is prone to plant, but the anniversary production and supply.Product is fresh and tender, nutritious, by consumers in general are liked.Its YO accounts for the 30-40% of vegetables ultimate production, to replenishing vegetables dull seasons, realizing that anniversary stable market supply contribution is very big.Chinese cabbage and Plantula Brassicae chinensis characteristic all are happiness cold property, all can produce throughout the year, and the growth optimum temperuture is 15～20 ℃.In recent years, in order to adapt to the needs in market, intensive culture is the principal feature that Chinese cabbage group is produced.In order to guarantee Chinese cabbage group balanced production and supply throughout the year, Plantula Brassicae chinensis often need adopt different modes to produce throughout the year.Mainly produced Plantula Brassicae chinensis in winter in spring, beginning is taked various planting type plantation Plantula Brassicae chinensiss in hot summer and autumn, undoubtedly in its breeding time, especially tends to receive coercing of high temperature adverse circumstance in spring Mo, summer and early autumn in the past.High temperature season cultivation Plantula Brassicae chinensis can go on the market later at 20 days in batches; But obstacle by a high temperature often makes the elongation of Plantula Brassicae chinensis plant internode, poor growth, bitter, the obvious increase of fibre content etc.; Usually cause yielding poorly, poor quality; Market value raises up, and supply falls short of demand, can not satisfy resident's consumers demand.Chinese cabbage is not strong to the high temperature endurance of sweltering heat, and is strict to temperature requirement in rosette state and heading stage especially, and the too high lobus cardiacus of medial temperature just can not obvolvent, can not balling, even inadequate balling is also more open.Under the summer field natural condition, forming normal leaf-head is the prerequisite that heat-resistant Chinese cabbage is produced, and the balling property under the natural high-temperature condition of field is to identify the stable on heating standard of Chinese cabbage.
Chinese cabbage and Plantula Brassicae chinensis originate in China, and be external less to the breeding research of Chinese cabbage group, from the kind poor heat resistance that introduce Japan, Korea S and China Taiwan, do not suit in China's growth in summer and popularization.The kind of domestic institute seed selection is mainly the disease-resistant variety in autumn, and the heat-resisting gene pool of Chinese cabbage group is narrow, and heat-resisting breeds of Chinese cabbage seed selection only is confined to the screening between the Chinese cabbage material, and kind thermotolerance, the resistance selected are not ideal enough.In view of the foregoing; China breeding man adopts traditional breeding method extensively to carry out the seed selection work of heat-resisting Chinese cabbage group kind, introduces heat-resisting gene, enlarges the source resource approach; To a certain degree improve the Chinese cabbage group temperature capacity, on producing, brought into play effect.Yet, release at present be fit to the local climate condition be the stable on heating method of evaluation of main foundation, and its foundation is plant shows morphological structure under high temperature stress variation mainly.This method is difficult to create the suitable field environment of selective pressure in the area, temperate zone; Even select the thermotolerance individual plant; Will heat-resisting proterties be saved in the seed collecting of 1 year spring, need to adopt a series of comparatively numerous and diverse method and measure, the screening cycle is long; And the region restriction is arranged, can not heat resistant variety extensively be generalized to other areas.Therefore the incidence and development Changing Pattern to cabbage vegetable sprout term heat evil symptom carries out deep research; Set up easy handling; The result is stable, efficient is higher have extensive generalization seedling stage the heat impedance screening method and technology be that Chinese cabbage group heat resistanceheat resistant breeding work is needed the solution task badly.Belong to quantitative character with the closely-related proterties of Chinese cabbage heat resistanceheat resistant, it is very difficult that the genotype of its quantitative character is selected.To molecular breeding, this difficulty shows that not only the dna marker in assisted Selection capable of using is few, and QTL (Quantitative Traits Loci, quantitative trait locus) is at number with to use variation bigger.Therefore; Do not accomplish as yet in the work of Chinese cabbage gene order-checking; Under the functional genome research situation in the ascendant, the genetic breeding scholar need seek a kind of fast, responsive, efficiently, each proterties and DNA qualitative analysis are technological on the plant level; And the quantitative analysis tech of phenotype and changes in gene expression on the plant level, in order to Chinese cabbage group heat resistanceheat resistant breeding research.
Molecular biology research development in recent years is rapid, and especially the application of biochip technology on the crop molecular breeding also more and more widely.Biochip technology has been one of the most far-reaching great science and technology progress of influence since the mid-90 in 20th century, is that to melt microtronics, biology, physics, chemistry, computer science be the new technology that the height of one intersects.Gene chip be with a large amount of specific oligonucleotide fragments or gene fragment as probe, arrange regularly and be fixed on the upholder, form dna microarray.Sample DNA or RNA mix fluorescent tag molecule through technology such as pcr amplification, in-vitro transcription; Probe is hybridized with the sample molecule that mark is crossed again then; Through fluorescence detecting system chip is scanned at last; And be equipped with computer system the fluorescent signal on each probe is made comparison and detection, strong and weak through the hybridization signal of detected each probe molecule, and then obtain the information of sample molecule aspect quantity and sequence fast.At present, biochip technology has been widely used in many fields such as drug screening, agricultural, medical diagnosis on disease and treatment, the evaluation of Chinese medicine species, judicial expertise, Food Hygiene Surveillance, environment measuring, national defence.Report about biochip technology is used in plant is also few, mainly concentrates on aspects such as Arabidopis thaliana, strawberry, morning glory.On gene chip is used, the analysis of gene expression dose and detection be study at most at present, the most sophisticated field.Owing to can fix thousands of probe on the chip; Numerous genes are detected simultaneously become possibility; Not only can be relatively in the transcriptional level difference of a genome number of genes of different condition; And can contrast corresponding gene transcription level difference in the different genes group, fundamentally broken through the bottleneck that once can only pay close attention to 1 or several genes in the former research.Therefore, the method for utilizing chip technology to develop the relevant gene of plant heat resistanceheat resistant need be explored in this area, in the hope of obtaining some useful plant heat resistanceheat resistant genes involveds.
Summary of the invention
The object of the present invention is to provide a kind of plant heat resistanceheat resistant gene BccDREB2A.
Another object of the present invention is to provide the application of said gene.
In first aspect of the present invention, a kind of isolating plant heat resistanceheat resistant albumen is provided, this albumen is:
(a) albumen of SEQ ID NO:3 aminoacid sequence; Or
(b) SEQ ID NO:3 aminoacid sequence process is one or more (as 1-20; Preferably 1-10; More preferably 1-5; 1-3 best) replacement, disappearance or the interpolation of amino-acid residue form, and have with the aminoacid sequence identical function shown in the SEQ ID NO:3 by (a) deutero-albumen; Or
(c) with SEQ ID NO:3 aminoacid sequence at least 90% homogeny is arranged, and have with the aminoacid sequence identical function shown in the SEQ ID NO:3 by (a) deutero-albumen.
In a preference, described plant is a cress.
In another preference, described cress is selected from: Brassica plants; Mouse ear mustard.
In another preference, described Brassica plants is Chinese cabbage (Brassica campestris).
In another preference, described mouse ear mustard is Arabidopis thaliana (Arabidopsis thaliana (L.) Heynh.).
In another preference, described plant heat resistanceheat resistant dietary protein origin is in Brassica plants.Preferably, derive from Plantula Brassicae chinensis.
In another aspect of this invention, a kind of isolating polynucleotide are provided, these polynucleotide are selected from down group:
(i) the described proteic polynucleotide of coding; Or
(ii) with (i) in polynucleotide complementary polynucleotide.
In a preference, the nucleotide sequence of these polynucleotide is shown in SEQ ID NO:1 or SEQ ID NO:2.
In another aspect of this invention, a kind of carrier is provided, it contains described polynucleotide.
In another aspect of this invention, a kind of genetically engineered host cell is provided, it contains and is integrated with described polynucleotide in described carrier or the genome.
In another aspect of this invention, a kind of plant is provided, it comprises each described polynucleotide of front.
In another aspect of this invention, a kind of described proteic preparation method is provided, this method comprises:
(a) be fit to cultivate described host cell under the condition of expressing;
(b) from culture, isolate described albumen.
In another aspect of this invention, the purposes of described albumen or its encoding sox is provided, is used to improve the heat resistance of plant.
In another aspect of this invention, a kind of method that improves the heat resistance of plant is provided, this method comprises: improve proteic expression or the activity described in the plant.
In a preference, said method comprises: the described proteic polynucleotide of will encoding are transferred in the Plant Genome.
In another preference, described method comprises:
(1) Agrobacterium of carrying expression vector is provided, described expression vector contains described proteic encoding sequence;
(2) vegetable cell, tissue or organ are contacted with Agrobacterium in the step (1), thereby make said proteic encoding sequence change vegetable cell over to, and be incorporated on the karyomit(e) of vegetable cell.
In another preference, said method also comprises:
(3) select vegetable cell, tissue or the organ that changes said proteic encoding sequence over to;
(4) vegetable cell, tissue or neomorph in the step (3) are become plant.
In another aspect of this invention, a kind of transgenic plant that prepared by preceding method are provided.
In another aspect of this invention, a kind of molecular marked compound of heat resistance of plant identification is provided, described molecular marked compound is that primer is right, has the nucleotide sequence shown in SEQ ID NO:5 and the SEQ ID NO:6.
Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1 .RT-PCR detects the homogenic expression pattern of Plantula Brassicae chinensis BccDREB2A in heat resistanceheat resistant and the sensible heat green vegetables.46 ℃ of thermal treatment 1 hour is extracted total RNA, electrophoresis detection.ACTIN is contrast.26c representes that PCR has carried out 26 circulations; 20c representes that PCR has carried out 20 circulations.GDNA representes genomic dna.
Fig. 2. cross expression BccDREB2A and improved Arabidopis thaliana plant heat resistance.
A, the transgenic line that 3 mistakes are expressed BccDREB2A-has improved heat resistance, upper rightly is contrast NOS (having changed the empty carrier that does not carry the BccDREB2A gene over to).
B, other 3 transgenic lines of expression BccDREB2A.The plant of 7 days seedling ages of 22 ℃ of growths forwards 44 ℃ of growths 60 minutes to, and then goes back to 22 ℃ of growths, takes pictures after 7 days.
C, the sign that each zone institute strain of planting is among A and the B figure.
The domain analyses synoptic diagram of Fig. 3 .BccDREB2A albumen (SEQ ID NO:3).
Embodiment
The inventor utilizes chip technology to develop the relevant gene of plant heat resistanceheat resistant through long term studies, in Brassica plants, is separated to a kind of new plant heat resistanceheat resistant gene first, and it can make plant have better hot tolerance.The inventor is " BccDREB2A " with this unnamed gene.Based on this gene, can prepare heat resistance enhanced transgenic plant.
Among the present invention, for being applicable to that plant of the present invention has no particular limits, as long as it is fit to carry out the conversion operation of gene, like various farm crop, flower plant or forestry plant etc.Described plant is such as being (being not limited to): dicotyledons, monocotyledons or gymnosperm.More specifically, described plant includes, but is not limited to: wheat, barley, rye, paddy rice, corn, jowar, beet, apple, pears, Lee, peach, apricot, cherry, strawberry, rasp berry, blackberry, blueberry, beans, French beans, pea, soybean, rape, mustard, opium poppy, olean, Sunflower Receptacle, coconut, Viscotrol C plant, cocoa beans, peanut, cucurbit, cucumber, watermelon, cotton, flax, hemp, jute, citrus, lemon, natsudaidai, spinach, piemarker lettuce, asparagus, cabbage, Chinese cabbage, Plantula Brassicae chinensis, Radix Dauci Sativae, onion, potato, tomato, green pepper, avocado, cassia bark, camphor, tobacco leaf, nut, coffee, eggplant, sugarcane, tealeaves, pepper, Vine, oyster fiber crops grass, banana, tree elastomer tree and ornamental plant etc.
As a kind of optimal way, described " plant " includes but not limited to: Cruciferae, Gramineae, the Rosaceae.Such as, described " plant " includes but not limited to: Chinese cabbage, Plantula Brassicae chinensis that the Cruciferae rape belongs to, and Cruciferae mouse ear mustard, paddy rice gramineous comprises tobacco, melon and fruit, vegetables, rape or the like in addition.More preferably, described " plant " is the plant that the Cruciferae rape belongs to or mouse ear mustard belongs to.
As used herein, " isolating " is meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification like polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating plant heat resistanceheat resistant albumen (polypeptide) ", " polypeptide of isolating raising plant heat resistance ", " isolating BccDREB2A albumen " or " isolating BccDREB2A polypeptide " are meant that BccDREB2A albumen does not contain natural relative other albumen, lipid, carbohydrate or other material basically.Those skilled in the art can use the purified technology of protein purifying BccDREB2A albumen of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.
As used herein, described " containing ", " having " or " comprising " comprised " comprising ", " mainly by ... constitute ", " basically by ... constitute " and " by ... constitute "; " mainly by ... constitute ", " basically by ... constitute " belong to the subordinate concept of " containing ", " having " or " comprising " with " by ... formation ".
Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferably recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell), to produce.The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises the proteic fragment of BccDREB2A, verivate and analogue.As used herein, term " fragment ", " verivate " are meant with " analogue " and keep identical biological function of BccDREB2A albumen of the present invention or active polypeptide basically.Polypeptide fragment of the present invention, verivate or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue); And so substituted amino-acid residue can be also can not encoded by genetic code; Or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical; Or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period; Polyoxyethylene glycol for example) merges formed polypeptide; Or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (like leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying or fusion rotein).These fragments of definition, verivate and analogue according to this paper belong to the known scope of those skilled in the art.
In the present invention, term " BccDREB2A albumen " refers to have the SEQ ID NO:3 polypeptide of sequence of the function that improves the plant heat resistance.This term also comprises having the plant of raising variant form heat resistance, SEQ IDNO:3 sequence.These variant forms comprise (but being not limited to): several (are generally 1-50; Preferably 1-30, more preferably 1-20,1-10 best; Also better for 1-8 or 1-5) amino acid whose disappearance, insertion and/or replacement; And add or lack one or several (being generally in 20, preferably is in 10, more preferably is in 5) amino acid at C-terminal and/or N-terminal.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add or lack one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises proteic active fragments of BccDREB2A and reactive derivative.
The variant form of polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with coded albumen of the DNA of the proteic DNA hybridization of BccDREB2A and polypeptide or the albumen that utilizes the proteic antiserum(antisera) of anti-BccDREB2A to obtain.The present invention also provides other polypeptide, as comprises BccDREB2A albumen or its segmental fusion rotein.Except the polypeptide of total length almost, the present invention has also comprised the proteic soluble fragments of BccDREB2A.Usually; This fragment have the BccDREB2A protein sequence at least about 20 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids; More preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
The present invention also provides the analogue of BccDREB2A albumen or polypeptide.These analogues and the proteic difference of natural B ccDREB2A can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps have both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain through various technology, as through radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(like D-amino acid), and has non-natural analogue that exist or synthetic amino acid (like β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to above-mentioned representational polypeptide of giving an example.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modify and also comprise glycosylation.Modified forms also comprises have the phosphorylated amino acid residue sequence of (like Tyrosine O-phosphate, Serine O-phosphate, phosphothreonine).Thereby also comprise and modified the polypeptide that has improved its anti-proteolyze performance or optimized solubility property.
In the present invention; " BccDREB2A albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:3, has 20 at the most, preferably at the most 10; More preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.
Table 1
| Amino-acid residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
The present invention also provides the polynucleotide sequence of code book invention BccDREB2A albumen or its conservative property variation polypeptide.
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in SEQ ID NO:1 or the SEQ IDNO:2 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:3, but with the differentiated nucleotide sequence of coding region sequence shown in SEQ ID NO:1 or the SEQID NO:2.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:3 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the verivate of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it possibly be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide according to the invention.In the present invention, " stringent condition " is meant: (1) than hybridization under LIS and the comparatively high temps and wash-out, like 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, like 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 80%, better more than at least 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:3.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (like PCR) of nucleic acid to confirm and/or the proteic polynucleotide of separation coding BccDREB2A.
BccDREB2A pyrenoids thuja acid full length sequence of the present invention or its fragment can use the method for pcr amplification method, recombination method or synthetic to obtain usually.For the pcr amplification method; Can be disclosed according to the present invention about nucleotide sequence; Especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually need carries out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.
In case obtained relevant sequence, just can come to obtain in large quantity relevant sequence with recombination method.This normally is cloned into carrier with it, changes cell again over to, from the host cell after the propagation, separates obtaining relevant sequence then through ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, through first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.
At present, can be fully obtain the dna sequence dna of code book invention albumen (or its fragment, or derivatives thereof) through chemosynthesis.Can this dna sequence dna be introduced in various existing dna moleculars as known in the art (or like carrier) and the cell then.In addition, also can will suddenly change and introduce in the protein sequence of the present invention through chemosynthesis.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or BccDREB2A albumen coded sequence, and produce the method for polypeptide according to the invention through recombinant technology.
Through the recombinant DNA technology of routine, polymerized nucleoside acid sequence of the present invention capable of using can be used to express or produce the BccDREB2A albumen of reorganization.In general following steps are arranged:
(1). with the proteic polynucleotide of coding BccDREB2A of the present invention (or varient), or with recombinant expression vector conversion that contains these polynucleotide or transduction proper host cell;
(2). in suitable medium, cultivate host cell;
(3). separation, protein purification from substratum or cell.
Among the present invention, BccDREB2A albumen polynucleotide sequence can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell is viral or other carriers.In a word, as long as can in host, duplicate and stablize, any plasmid and carrier can be used.A key character of expression vector is to contain replication orgin, promotor, marker gene and translation controlling elements usually.
Method well-known to those having ordinary skill in the art can be used to make up and contains BccDREB2A encoding histone dna sequence dna and suitable transcribing/the translate expression vector of wave.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.Expression vector also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition; Expression vector preferably comprises one or more selected markers; To be provided for selecting the phenotypic character of transformed host cells; Cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness like eukaryotic cell, or be used for colibacillary kantlex or amicillin resistance.
Comprise the carrier of above-mentioned suitable dna sequence dna and suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can marking protein.
Host cell can be a prokaryotic cell prokaryocyte, like bacterial cell; Or eukaryotic cell such as low, like yeast cell; Or higher eucaryotic cells, like vegetable cell.Representative example has: intestinal bacteria, streptomyces, Agrobacterium; Fungal cell such as yeast; Vegetable cell etc.
When polynucleotide of the present invention are expressed in higher eucaryotic cells, be enhanced if will make to transcribe when in carrier, inserting enhancer sequence.Enhanser is the cis acting factor of DNA, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.
Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Another kind method is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.Transform plant and also can use methods such as Agrobacterium-mediated Transformation or particle gun conversion, for example leaf dish method, paddy rice rataria conversion method etc.Can use ordinary method regeneration plant for plant transformed cell, tissue or organ, thus the plant that acquired character changes.
The transformant that obtains can be cultivated with ordinary method, expresses the polypeptide of coded by said gene of the present invention.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (like temperature transition or chemically induced), cell is cultivated for some time again.
The extracellular can expressed or be secreted into to recombinant polypeptide in the above methods in cell or on cytolemma.If desired, can utilize its physics, the separating through various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, ultraly handle, ultra centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) is technological with other various LCs and the combination of these methods.
The BccDREB2A albumen of reorganization is of use in many ways.For example be used to screen antibody, polypeptide or other part that promotes or resist the BccDREB2A protein function.Can be used for seeking the valuable peptide molecule that can suppress or stimulate the BccDREB2A protein function with the reorganization BccDREB2A protein screening peptide library of expressing.
Polynucleotide of the present invention a part or all can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), be used for analyzing the differential expression analysis of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with the special primer of BccDREB2A albumen and also can detect the proteic transcription product of BccDREB2A.
The invention still further relates to the method for a kind of improvement plant (improving the heat resistance of plant), this method comprises BccDREB2A expression of gene or protein-active in the said plant of raising.
The method that increases BccDREB2A genetic expression is that this area is known.For example, can make plant cross expression BccDREB2A through changing the expression constructs of carrying the BccDREB2A encoding sox over to; Thereby maybe can strengthen the BccDREB2A expression of gene through driving with strong promoter; Perhaps strengthen this BccDREB2A expression of gene through enhanser (like paddy rice waxy gene first intron, Actin gene first intron etc.).The strong promoter that is applicable to the inventive method includes but not limited to: the Ubi promotor of 35S promoter, paddy rice, corn etc.
As a kind of optimal way of the present invention, the method for the plant of acquisition BccDREB2A albumen high expression level is following:
(1) Agrobacterium of carrying expression vector is provided, described expression vector contains the proteic dna encoding sequence of BccDREB2A;
(2) vegetable cell or tissue or organ are contacted with Agrobacterium in the step (1), thereby make this BccDREB2A protein D NA encoding sequence change vegetable cell over to, and be incorporated on the karyomit(e) of vegetable cell;
(3) select vegetable cell or the tissue that changes said BccDREB2A protein D NA encoding sequence over to; With
(4) vegetable cell or tissue regeneration in the step (3) are become plant.
Wherein, can adopt any suitable conventional means, comprise that reagent, temperature, pressure condition wait to implement this method.
The present invention also comprises the agonist of BccDREB2A albumen or its encoding sox.Because the active or expression of the agonist adjustable BccDREB2A of BccDREB2A, therefore, the agonist of described BccDREB2A also can improve the heat resistance of plant through the influence to BccDREB2A, thereby reaches the purpose of character improvement.
The agonist of described BccDREB2A is meant that the activity of any BccDREB2A of raising, the stability of keeping BccDREB2A, promotion BccDREB2A express, prolong the material of transcribing and translating of BccDREB2A effective acting time or promotion BccDREB2A; These materials all can be used for the present invention, as the useful material of heat resistance for the raising plant.
In an instance of the present invention, a kind of BccDREB2A gene is provided, its genome sequence is shown in SEQ ID NO:1, and the CDS sequence is encoded one and is contained 323 amino acid whose protein (SEQ ID NO:3) shown in SEQ ID NO:2.Described BccDREB2A gene can provide new approach for the degeneration-resistant border improvement of plant, thereby has great application prospect.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example; Usually according to people such as normal condition such as Sambrook; Molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press; 2002) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
Only if definition separately, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any with the institute similar content of putting down in writing or the equalization method and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.
I. materials and methods
Material
Chinese cabbage 99Bre (that is: the hot Chinese cabbage of B) seed, heat resistanceheat resistant Plantula Brassicae chinensis HR seed, temperature-sensitive Plantula Brassicae chinensis HS seed is available from Shanghai Agricultural Science and Technology Seeds Co., Ltd..Col is the Arabidopis thaliana wild-type, grows institute available from Chinese Academy of Sciences's heredity.
The total RNA of plant tissue extracts
Reagent: TaKaRa RNAiso Reagent extraction agent box.
Step:
A) material is fully ground in liquid nitrogen, in the amount adding sample with 100mg material/ml extraction buffer, abundant mixing, room temperature left standstill 10 minutes.
B) 13000rpm is centrifugal 5 minutes, and supernatant is changed in the new centrifuge tube, adds 200 μ l chloroforms, abundant mixing, and room temperature leaves standstill and made its layering in 10 minutes.
C) 13000rpm is centrifugal 5 minutes, carefully draws supernatant in new centrifuge tube.
D) add the equal-volume Virahol, room temperature left standstill 10 minutes behind the mixing.
E) 13000rpm is centrifugal 5 minutes, washes once with 1ml 75% (v/v) ethanol after abandoning supernatant.
F) 7800rpm is centrifugal 5 minutes, abandons low-speed centrifugal behind the supernatant, inhales with the rifle head and removes residual liquid, and room temperature is dried, and treats that the just dry back of RNA adds the water of an amount of no RNase, and 65 ℃ fully were stored in-70 ℃ after the dissolving in 10 minutes.
Sxemiquantitative RT-PCR
The RT-PCR primer is following:
BccDREB2A：
Forward: 5 ' ATGGCGGTTTATGATCATAGCG 3 ' (SEQ ID NO:4);
Oppositely: 5 ' TCACTTCTCCAGATCCAAGAAAACTC 3 ' (SEQ ID NO:5).
ACTIN：
Forward: 5 ' TGGCATCAYACTTTCTACAA 3 ' (SEQ ID NO:6);
Oppositely: 5 ' CCACCACTDAGCACAATGTT 3 ' (SEQ ID NO:7).
Reagent is following:
AMV ThermoScript II (TAKARA);
RNase suppressor factor (TAKARA);
DNase?I(RNase?free)(TAKARA)。
Step is following:
A) extract total RNA of the Plantula Brassicae chinensis blade of different heat treatment respectively, handle phenol chloroform extracting after 30 minutes with DNase I (RNase free), deposition dries up the water dissolution of no RNase.
B) survey OD260 and electrophoresis quantitatively after, get the total RNA of 1 μ g, the by specification operation, 42 ℃ of reactions 1 hour, 94 ℃ 5 minutes so that the ThermoScript II inactivation.
C) one times of dilution is respectively got 1 μ l behind the reverse transcription product and is PCR.PCR reaction conditions: 94 ℃ of 3min; 94 ℃ of 30sec, 55 ℃ of 30sec, 72 ℃ of 30sec, 25-28 circulation; 72 ℃ of 5min.For correction is used for the template amount of RT-PCR reaction, carry out parallel PCR reaction as internal reference with the primer of Actin.
The extraction of the total DNA of CTAB method plant tissue
Reagent is following:
2 * CTAB damping fluid (100ml): 10ml 1M Tris pH 8.0; 4ml 0.5M EDTApH8.0; 8.19g NaCl; 2g CTAB; 1g PVP K30 is settled to 100ml.
1 * CTAB damping fluid (100ml): 5ml 1M Tris pH 8.0; 2ml 0.5M EDTApH8.0; 1g CTAB is settled to 100ml.
High salt TE (100ml): 1ml1M Tris pH 8.0; 200 μ l 0.5M EDTA pH8.0; 5.844g NaCl is settled to 100ml.
10% (w/v) CTAB (50ml): 5g CTAB; 2.045g NaCl is settled to 50ml.
Step is following:
A) get in the 5g vegetable material liquid nitrogen and change in the 40ml centrifuge tube behind the abrasive flour.
B) add 2 * CTAB damping fluid (1: 1) of 65 ℃ of preheatings of 15ml, up and down behind the mixing in 65 ℃ of incubation 10min, constantly turn upside down several times therebetween.
C) chloroform of 1 times of volume of adding: primary isoamyl alcohol (24: 1), the centrifugal 5min of 11000rpm behind the mixing.
D) draw in supernatant to the new centrifuge tube, mend 1/10 volume 10%CTAB, add the chloroform of 1 times of volume then: primary isoamyl alcohol, centrifugal 5min behind the mixing.
E) get supernatant, repeat d) step 2-3 time, change supernatant over to new centrifuge tube after centrifugal for the last time, (1 * CTAB), the mixing of gentleness is in room temperature held 30min to add precipitation buffering liquid greater than 2 times of volumes.
F) centrifugal and collecting precipitation is resuspended in deposition among 65 ℃ the high salt TE of 5ml, and can add some Rnase, 37 ℃ of incubation 30min this moment.
G) behind the centrifugal 10min of 11000rpm supernatant is transferred in the new 1.5ml centrifuge tube.
H) add 2 times of volume absolute ethyl alcohols,, centrifugal behind the mixing in-20 ℃ of placement 30min, abandon supernatant, with drying after 70% washing with alcohol, be dissolved among the 100 μ l TE.
35S::BccDREB2A genomic dna vector construction
Following from the primer of genome amplification BccDREB2A genomic dna:
Forward: 5 ' ATGGCGGTTTATGATCATAGCG 3 ' (SEQ ID NO:8);
Oppositely: 5 ' TCACTTCTCCAGATCCAAGAAAACTC 3 ' (SEQ ID NO:9).
Step is following:
A) from the Plantula Brassicae chinensis genome DNA, separate the BccDREB2A genomic fragment with the method for PCR.
B) go out this segment with Kpn I single endonuclease digestion; Be cloned into pCAMBIA1300 carrier (pCAMBIA 1300 initial carriers are available from CAMBIA company) and go up (the PCR fragment is connected in the middle of 35S and the Nos); Because of being single endonuclease digestion, what have two kinds of directions (forward is with reverse) is connected sequence verification.
C) utilize the freeze thawing method for transformation that pCAMBIA1300-DREB2A forward genophore is imported among the Agrobacterium GV3101 (available from Invitrogen), and PCR identify.
The preparation and the conversion of freeze-thaw method Agrobacterium competent cell
A) cultivate the single bacterium colony of picking GV3101 48 hours the fresh flat board from 28 ℃, forward in the 20ml LB liquid nutrient medium (rif 50mg/l, GM 5050mg/l), in 28 ℃ of 250rpm shaking culture spend the night (can not be too dense).(following whole operations are all carried out under aseptic condition).
B) ice bath is after 20 minutes, in the centrifuge tube (every pipe 4ml) with bacterium liquid packing 5ml, and ice bath 10 minutes.
C) 4000rpm (5-10 ℃) is centrifugal 10 minutes, abandons bacterium liquid.
D) the 20mM CaCl2 of the abundant precooling of every pipe adding 1ml is with resuspended thalline.Ice bath 10 minutes.
E) 4000rpm (5-10 ℃) is centrifugal 10 minutes, abandons supernatant.
F) every pipe adds 300 μ l 20mM CaCl2 (look cell concentration and decide), is in charge of after the merging in the centrifuge tube of 1.5ml.
G) every pipe adds 1 μ l plasmid or all connection products, and ice bath 5 minutes was put into liquid nitrogen 4-5 minute again.
H) put 5 minutes for 37 ℃, every pipe adds 400 μ l LB cultivation made bacteria resuscitation in 2 hours based on 28 ℃ of incubations, and expressed corresponding antibiotics resistance gene.
I) respectively get 200 μ l volume coated plates, room temperature is placed a little while, in 28 ℃ of cultivations.
Flower-dipping method arabidopsis thaliana transformation and screening
Reagent is following:
Transform damping fluid (1L): macroelement (50 *): 10ml; Trace element (1000 *): 0.5ml; CaCl2 (100 *): 5ml; Molysite (200 *): 2.5ml; Organic (100 *): 10ml; Sucrose: 50g; 6-BA (1mg/ml): 10 μ l; Silwet L-77:400 μ l (vacuum filtration is then used 200 μ l); Transfer to pH5.8 with KOH, constant volume 1L.
Screening culture medium is dull and stereotyped: 3% (w/v) sucrose MS0 solid medium (pH5.8) adds kantlex (Kan) to 50mg/l (being used for the screening of Nossen background Arabidopis thaliana).
Step is following:
A) when high about 5 centimetres of stem behind the Arabidopis thaliana bolting, can transform, then will after plant was pinched 4 days, carry out if plant setting percentage to be transformed is low.
B) before the conversion, flower of having pollinated and angle are really got rid of.And the soil suction is spent the night.
C) will be the Agrobacterium of overnight cultures be diluted at 1: 100 in the big flask culture base, 280C cultivated after 24 hours, centrifugal 20 minutes of 4 ℃ of 5000rpm abandon supernatant, the Agrobacterium deposition are suspended in the conversion damping fluid of two volumes of original bacteria liquid, make OD600 about 0.8.
D) over-ground part of Arabidopis thaliana immersed in the bacterium liquid 30 seconds fully, and taking-up keeps flat, and covered preservative film and newspaper, darkly spent the night down, moved into the normal vertically cultivation of phytotron next day.Receive seed 2 weeks of after drying.
E) seed is laid on after aseptic sterilization in the Ms0 solid plate that contains 50mg/l Kan, moves on to group training chamber two days later through 4 ℃ of vernalization, blocks that resistance seedling and moves on to continued growth in the soil.
F) get blade extraction genomic dna and obtain positive seedling through the PCR detection, screening obtains genetically modified pure lines through two generations again, is used for further analysis.
The vacuum filtration method transforms Chinese cabbage and screening
(1) conversion of Chinese cabbage
A) (Chinese cabbage through vernalization can bloom at seedling phase bolting Chinese cabbage seeds to be placed on the filter paper that soaks water 4 ℃ of vernalization 2 months; Be convenient to transform); The Chinese cabbage seedling that has extended hypocotyl then moves in the soil, treats its bolting and open first can transform when colored.To soil moistening be spent the night before transforming.
B) preparation of conversion fluid that contains Agrobacterium is with the Arabidopis thaliana method for transformation.
C) the over-ground part inversion of Chinese cabbage is also immersed in the bacterium liquid fully; Be placed in the moisture eliminator of band vacuum pump, vacuum is taken out the blade transparence of 5 minutes twice (2 minutes at interval) to Chinese cabbage, and the venting back is taken out plant and kept flat; Cover preservative film and newspaper; Spend the night under dark, transplant Chinese cabbage in the big basin next day, normal cultured.Bloom aspire to the artificial pollination of flower bud phase, bagging.Receive seed 2 weeks of after drying.
D) on aseptic filter paper, blot water through aseptic disinfectant Chinese cabbage seeds, change in the triangular flask that contains Kan 50mg/l substratum with tweezers.4 ℃ of vernalization 2 to 3 days moves into thermostatic chamber and cultivates.
E) transformant of Chinese cabbage will wait until that true leaf grows and could differentiate out: green true leaf, root normal development.But not the Chinese cabbage true leaf of transformant is a white, unrooted.After son to be transformed grows 3-4 sheet true leaf, can move in the soil behind the refining seedling through 3 days.
(2) conversion of Plantula Brassicae chinensis
Likewise, also adopt the vacuum filtration method to transform Plantula Brassicae chinensis, method for transformation and conversion condition are identical with the conversion of Chinese cabbage.
II, embodiment
The acquisition of embodiment 1. genes
Plant materials genetic expression has the space-time specificity, promptly under different time, steric requirements, different functions genetic expression is arranged.The inventor is through extracting mRNA and representing the chip of Plantula Brassicae chinensis all functions gene to hybridize with containing from the heat treated Plantula Brassicae chinensis plant of difference, predict under the Different Heat Treatment Conditions expression of functional gene in the Plantula Brassicae chinensis sample.The method of conventional sense genetic expression needs large scale sequencing; It is lower once only to detect a small amount of genetic expression and detection sensitivity; Adopt that biochip technology is not only can be high responsive quantitatively, the qualitative detection gene expression dose, and can study thousands of expression of gene situation in the same sample simultaneously.Utilize biochip technology not only can shorten the screening cycle, and obtain the test-results good stability, the screening purpose is strong, has the value of general promotion and application.
In addition; AFLP (Amplified Fragment Length Polymorphism; AFLP) technology is a kind of novel molecular mark of selective amplification restriction fragment, research fields such as this method has been widely used in that genetic map construction, genetic diversity and the species sibship of vegetable crop are analyzed, the fingerprint map construction of the location of important gene, expression of gene study on regulation, vegetable crop kind and hybrid purity evaluation, molecular marker assisted selection.
In order to satisfy heat resistanceheat resistant summer and autumn Plantula Brassicae chinensis cultivation needs; The inventor screens Chinese cabbage heat resistanceheat resistant gene through biochip technology; In conjunction with the cDNA-AFLP technology, screen a Chinese cabbage group heat resistanceheat resistant gene, and obtained to express the transgenic line of this gene.
The gene " BccDREB2A " that the present invention obtains derives from Plantula Brassicae chinensis, and its genome sequence is shown in SEQ IDNO:1, and its CDS sequence is shown in SEQ ID NO:2; The albumen " BccDREB2A " (SEQ ID NO:3) of a 323aa of coding.
Embodiment 2, RT-PCR detect the expression of candidate's heat resistanceheat resistant gene after thermal treatment
In order to detect the expression pattern of heat resistanceheat resistant gene under heat-treat condition, the inventor measures the DREB2A gene expression dose in HR and HS kind Plantula Brassicae chinensis with RT-PCR.
RT-PCR result shows that DREB2A gene expression level after thermal treatment improves, and expression is higher than sensible heat kind (HS) in the heat resistanceheat resistant kind (HR), like Fig. 1.These results are consistent with the gene chip result.
Embodiment 3, heat resistanceheat resistant gene transgenic plant phenotype
In order to identify the heat resistanceheat resistant gene function, the inventor has made up the 35S::BccDREB2A of expression plant vector excessively that 35S starts, and is transformed into Arabidopis thaliana, obtains transfer-gen plant OE line1, OE line2 and OEline3.
Transfer-gen plant 35S::BccDREB2A is equal strong expression after thermal treatment.The inventor uses a heat treatment system to verify these transfer-gen plant phenotypes.Handled 1 hour at 44 ℃ with 7 days seedling age seedling, 45 ℃ of processing were handled 2.5 hours in 3 hours and 46 ℃.Compare with wild-type, transfer-gen plant 35S::BccDREB2A more can stand thermal pressure, sees Fig. 2.
Transgenic Chinese cabbage and Plantula Brassicae chinensis plant phenotype after embodiment 4, the thermal treatment
The inventor uses a heat treatment system to verify transgenic Chinese cabbage and transgenic Plantula Brassicae chinensis plant phenotype.The transfer-gen plant seed is seeded in the plastic culture alms bowl after vernalization, under 25 ℃ of optimal temperatures, grows seedlings.When 4-5 sheet true leaf launches, to choose the consistent seedling of growth conditions and place and carry out pyroprocessing in the growth, temperature is set at 32 ℃, handles 10 days, recovers 25 ℃ of growths 2 days then, and the calculating heat injury index is also analyzed data.Confirm with leaf-shrinkage warp degree, leaf chlorosis degree, the slow degree of plant strain growth, the plant representative symptom that dead degree etc. does harm to as heat of wilting.
Leaf-shrinkage warp: slight A, moderate A+, serious A++;
Leaf chlorosis degree: slight B, moderate B+, serious B++;
Plant strain growth is slow: slight C, moderate C+, serious C++;
Plant is wilted dead: slight D, moderate D+, serious D++.
Test-results shows, transgenic Chinese cabbage plant heat evil symptom is all in slight scope, i.e. ABCD, and adjoining tree (wild-type Chinese cabbage, the hot Chinese cabbage of B) heat evil symptom is seriously, i.e. A++B++C++D++.
Test-results shows, transgenic Plantula Brassicae chinensis plant heat evil symptom is all in slight scope, i.e. ABCD, and adjoining tree (wild-type Plantula Brassicae chinensis, temperature-sensitive Plantula Brassicae chinensis HS) heat evil symptom is seriously, i.e. A++B++C++D++.
It is thus clear that, to compare with wild-type Chinese cabbage or Plantula Brassicae chinensis, transgenic Chinese cabbage or Plantula Brassicae chinensis plant more can be stood thermal pressure.
Embodiment 5, the proteic domain analyses of BccDREB2A, its variant and function
The inventor has analyzed the structural domain of BccDREB2A albumen (SEQ ID NO:3), and is as shown in Figure 3.The result finds that wherein the 78-141 position is conservative AP2 domain (DNA-binding domains), and this structural domain is the key site of albumen performance heat resistanceheat resistant effect.
Based on above analysis, the inventor has set up the proteic varient sequence of a plurality of BccDREB2A, and is following successively:
Based on BccDREB2A albumen (SEQ ID NO:3) sequence, wherein the 15th amino acids is I by the L variation, obtains the BccDREB2A-M1 variant.
Based on BccDREB2A albumen (SEQ ID NO:3) sequence, wherein the 307th amino acids is V by the A variation, obtains the BccDREB2A-M2 variant.
Based on BccDREB2A albumen (SEQ ID NO:3) sequence, wherein the 234th amino acids is A by the V variation, obtains the BccDREB2A-M3 variant, and the 38th amino acids is I by the L variation.
Based on BccDREB2A albumen (SEQ ID NO:3) sequence, wherein 1-3 amino acids disappearance obtains the BccDREB2A-M4 variant.
Based on BccDREB2A albumen (SEQ ID NO:3) sequence, wherein 312-318 amino acids disappearance obtains the BccDREB2A-M5 variant.
Based on BccDREB2A albumen (SEQ ID NO:3) sequence, wherein C-terminal adds 4 amino acid ATAA, obtains the BccDREB2A-M6 variant.
At first the CDS sequence clone of the BccDREB2A gene shown in the SEQ ID NO:2 is gone in the Kpn I site of pCAMBIA1300 carrier, obtain to contain the recombinant vectors of this CDS.According to the protein variant sequence of above design, utilize conventional site-directed mutagenesis technique then, respectively the amino acid whose base in the corresponding site of coding in the recombinant vectors is carried out base mutation or base deletion or base and add, obtain to contain the recombinant vectors of corresponding variant.
The recombinant vectors of above structure is changed in the Agrobacterium, and arabidopsis thaliana transformation, Arabidopis thaliana transfer-gen plant M1-Line1, M1-Line2 obtained respectively; M2-Line1, M2-Line2; M3-Line1, M3-Line2; M4-Line1, M4-Line2; M5-Line1, M5-Line2; M6-Line1, M6-Line2.
Adopt heat treatment system to verify these transgenic arabidopsis plant phenotypes.Handled 1 hour at 44 ℃ with 7 days seedling age seedling, 45 ℃ of processing were handled 2.5 hours in 3 hours and 46 ℃.Compare with wild-type, these transfer-gen plants more can be stood thermal pressure significantly.
To sum up, BccDREB2A or its variant are effective heat resistanceheat resistant genes, are used to be modified into the heat resistance in seedling stage.
All documents in that the present invention mentions are all quoted as a reference in this application, are just quoted such as a reference separately as each piece document.Should be understood that in addition after having read above-mentioned teachings of the present invention, those skilled in the art can do various changes or modification to the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Claims (11)
1. isolating plant heat resistanceheat resistant albumen is characterized in that this albumen is:
(a) albumen of SEQ ID NO:3 aminoacid sequence; Or
(b) SEQ ID NO:3 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have with the aminoacid sequence identical function shown in the SEQ ID NO:3 by (a) deutero-albumen; Or
(c) with SEQ ID NO:3 aminoacid sequence at least 90% homogeny is arranged, and have with the aminoacid sequence identical function shown in the SEQ ID NO:3 by (a) deutero-albumen.
2. isolating polynucleotide is characterized in that, these polynucleotide are selected from down group:
(i) the described proteic polynucleotide of coding claim 1; Or
(ii) with (i) in polynucleotide complementary polynucleotide.
3. polynucleotide as claimed in claim 2 is characterized in that, the nucleotide sequence of these polynucleotide is shown in SEQ ID NO:1 or SEQ ID NO:2.
4. a carrier is characterized in that, it contains the described polynucleotide of claim 2.
5. a genetically engineered host cell is characterized in that, it contains and is integrated with the described polynucleotide of claim 2 in described carrier of claim 4 or the genome.
6. described proteic preparation method of claim 1 is characterized in that this method comprises:
(a) be fit to cultivate the described host cell of claim 5 under the condition of expressing;
(b) from culture, isolate the described albumen of claim 1.
7. the purposes of the described albumen of claim 1 or its encoding sox is characterized in that, is used to improve the heat resistance of plant.
8. a method that improves the heat resistance of plant is characterized in that, this method comprises: improve described proteic expression of claim 1 or activity in the plant.
9. method as claimed in claim 8 is characterized in that, said method comprises: the described proteic polynucleotide of the claim 1 of will encoding are transferred in the Plant Genome.
10. method as claimed in claim 9 is characterized in that, comprising:
(1) Agrobacterium of carrying expression vector is provided, described expression vector contains the described proteic encoding sequence of claim 1;
(2) vegetable cell, tissue or organ are contacted with Agrobacterium in the step (1), thereby make said proteic encoding sequence change vegetable cell over to, and be incorporated on the karyomit(e) of vegetable cell.
11. the molecular marked compound of the heat resistance of a plant identification is characterized in that, described molecular marked compound is that primer is right, has the nucleotide sequence shown in SEQ ID NO:5 and the SEQ ID NO:6.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102228300A CN102311489B (en) | 2010-07-08 | 2010-07-08 | Plant heat-resistant gene BccDREB2A and application thereof |
| PCT/NL2011/050498 WO2012005590A1 (en) | 2010-07-08 | 2011-07-07 | A plant heat-resistance gene bccdreb2a and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102228300A CN102311489B (en) | 2010-07-08 | 2010-07-08 | Plant heat-resistant gene BccDREB2A and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102311489A true CN102311489A (en) | 2012-01-11 |
| CN102311489B CN102311489B (en) | 2013-12-25 |
Family
ID=44561234
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102228300A Expired - Fee Related CN102311489B (en) | 2010-07-08 | 2010-07-08 | Plant heat-resistant gene BccDREB2A and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN102311489B (en) |
| WO (1) | WO2012005590A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109156300A (en) * | 2018-11-07 | 2019-01-08 | 青岛市农业科学研究院 | A kind of breeding of resistance to bolting radish is reserved seed for planting method |
| CN114480432A (en) * | 2022-03-31 | 2022-05-13 | 四川农业大学 | Celery heat-resistant gene AgHSFA6a-1 and application thereof |
| CN114591972A (en) * | 2022-03-31 | 2022-06-07 | 四川农业大学 | Celery heat-resistant gene AgDREBA6c and application thereof |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114391518B (en) * | 2021-12-29 | 2022-11-25 | 广东省农业科学院蚕业与农产品加工研究所 | Silkworm egg hatching method based on warm water immersion |
| CN116814647B (en) * | 2023-05-24 | 2024-03-22 | 安徽农业大学 | Gene CUC2 for improving seed yield of non-heading Chinese cabbage, vector, host cell and application thereof |
-
2010
- 2010-07-08 CN CN2010102228300A patent/CN102311489B/en not_active Expired - Fee Related
-
2011
- 2011-07-07 WO PCT/NL2011/050498 patent/WO2012005590A1/en active Application Filing
Non-Patent Citations (4)
| Title |
|---|
| GAO,F. AND ZHANG,J.: "DREB2A from Thellungiella salsuginea", 《NCBI-GENBANK》 * |
| YOH SAKUMA等: "Dual function of an Arabidopsis transcription factor DREB2A in water-stress-responsive and heat-stress-responsive gene expression", 《PNAS》 * |
| YOH SAKUMA等: "Functional Analysis of an Arabidopsis Transcription Factor, DREB2A, Involved in Drought-Responsive Gene Expression", 《THE PLANT CELL》 * |
| 胡守景等: "植物应答干旱胁迫的基因表达调控", 《中国农业科技导报》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109156300A (en) * | 2018-11-07 | 2019-01-08 | 青岛市农业科学研究院 | A kind of breeding of resistance to bolting radish is reserved seed for planting method |
| CN109156300B (en) * | 2018-11-07 | 2021-02-12 | 青岛市农业科学研究院 | Seed reserving method for breeding bolting-resistant radish |
| CN114480432A (en) * | 2022-03-31 | 2022-05-13 | 四川农业大学 | Celery heat-resistant gene AgHSFA6a-1 and application thereof |
| CN114591972A (en) * | 2022-03-31 | 2022-06-07 | 四川农业大学 | Celery heat-resistant gene AgDREBA6c and application thereof |
| CN114480432B (en) * | 2022-03-31 | 2022-08-30 | 四川农业大学 | Celery heat-resistant gene AgHSFA6a-1 and application thereof |
| CN114591972B (en) * | 2022-03-31 | 2022-08-30 | 四川农业大学 | Celery heat-resistant gene AgDREBA6c and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2012005590A1 (en) | 2012-01-12 |
| CN102311489B (en) | 2013-12-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102311490B (en) | Plant heat-resistant gene JAZ5a and application thereof | |
| CN102311491B (en) | Plant heat-resistant gene HSF1 and application thereof | |
| CN103732615B (en) | Jaz5A is used to improve the purposes of drought resistance in plants | |
| CN110643618B (en) | Jatropha curcas MYB transcription factor JCMYB16 gene and application thereof in improving drought resistance of plants | |
| CN112080515B (en) | UP gene and application thereof in plant improvement | |
| CN102311489B (en) | Plant heat-resistant gene BccDREB2A and application thereof | |
| CN107475210A (en) | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application | |
| CN104561084B (en) | Chinese cabbage is promoted to shift to an earlier date transcription factor SPL9 2 and its application of balling | |
| CN103387609A (en) | Gene capable of improving anti-stress capability of plants and application thereof | |
| CN105524152A (en) | Rice high-temperature-resistance gene and application thereof in crop high-temperature-resistance breeding | |
| CN103172716B (en) | Heat-resistant plant gene and application thereof | |
| CN104278053B (en) | A kind of method for improving drought tolerance in plants ability | |
| CN101535472B (en) | Grain incomplete filling gene (GIF1) and uses thereof | |
| CN103183731A (en) | Dendrobe DnMYB type transcription factor, coding gene, carrier and engineering bacteria and application thereof | |
| CN102732553B (en) | Improve the gene engineering method and material of plant products | |
| CN106554399A (en) | Soybean GmABC albumen and its encoding gene and application | |
| CN104561040B (en) | Genes For Plant Tolerance hot radical is because of HTT3 and its application | |
| CN101575366B (en) | Rice plant type gene and application thereof | |
| CN114196660B (en) | Application of rape FC2 ferrous chelate enzyme gene in improving rape yield | |
| CN102417911A (en) | Method for over-expressing brassica napus BnLAS gene for improving plant drought resistance | |
| CN104497114B (en) | Plant heat-resistant genes HTT2 and applications thereof | |
| CN105777881B (en) | It is a kind of promote crucifer heat resistance gene and its application | |
| CN116891864A (en) | Sweet potato drought-resistant related gene ItbRASD1 and application thereof | |
| CN103937831B (en) | The method for improving phytomass and yield | |
| CN116925200A (en) | Protein with stress resistance, coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20131225 Termination date: 20160708 |