CN102260632A - Engineering yeast strain, its preparation method and application - Google Patents
Engineering yeast strain, its preparation method and application Download PDFInfo
- Publication number
- CN102260632A CN102260632A CN2010102784640A CN201010278464A CN102260632A CN 102260632 A CN102260632 A CN 102260632A CN 2010102784640 A CN2010102784640 A CN 2010102784640A CN 201010278464 A CN201010278464 A CN 201010278464A CN 102260632 A CN102260632 A CN 102260632A
- Authority
- CN
- China
- Prior art keywords
- amp05
- yeast
- pokeweed
- gene
- antibiotic peptides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention, applying to the technical field of gene engineering, provides an engineering yeast strain, its preparation method and application. The engineering yeast strain provided by the invention comprises recombinant plasmids formed by gene recombination of yeast shuttle plasmid and pokeweed antimicrobial peptide Pa-AMP05, the gene sequence of the pokeweed antimicrobial peptide Pa-AMP05 is shown as SEQ ID No: 1. The engineering yeast strain in the embodiment of the invention uses yeast as the expression system of the pokeweed antimicrobial peptide Pa-AMP05, so that the safe and effective expression of genes is realized, and the engineering yeast strain can be widely used in industrialization production.
Description
Technical field
The invention belongs to gene engineering technology field, relate in particular to a kind of Yeast engineering bacteria, its preparation method and application.
Background technology
The micromolecule polypeptide that antibacterial peptide produces when being the invasion of the inherent defence of organism foreign pathogens, extensively be present in insect, plant, animal and the human body, except that having pathogenic agent effects such as wide spectrum antibacterium, fungi and virus, also have antitumor cell effect and immunoregulation effect, be with a wide range of applications in fields such as medical and health, agriculture production, foodstuffs industry.Antibacterial peptide mechanism of action uniqueness is difficult for producing resistant organism, is considered to traditional microbiotic substitute.Pokeweed antibiotic peptides Pa-AMP05 is a kind of novel antibacterial peptide, has great application prospect.
But antibacterial peptide content in vivo is low, separates purification difficult, is the difficult problem of restriction antibacterial peptide large-scale industrial production.And existing expression system itself also has deficiency: antibacterial peptide self has inhibition and killing action to pathogenic bacteria, and this just is difficult to the intestinal bacteria in the prokaryotic organism as expression system; Problems such as the use virus expression systems exists experimental procedure loaded down with trivial details, and condition is wayward; Antibacterial peptide does not have restraining effect to eukaryotic cell, but that the many cells eukaryotic expression system has a production cycle is long, the shortcoming that production cost is high.These all are difficult to realize large-scale industrial production.
Therefore, pokeweed antibiotic peptides Pa-AMP05 expression of gene system problem, becoming influences the big bottleneck that pokeweed antibiotic peptides Pa-AMP05 uses.
Summary of the invention
In view of this, the embodiment of the invention provides a kind of Yeast engineering bacteria, can not be safely to solve prior art Central America Phytolacca acinosa antibacterial peptide Pa-AMP05 gene, the technical problem that efficiently expresses.
The embodiment of the invention is achieved in that
A kind of Yeast engineering bacteria, this Yeast engineering bacteria comprise the recombinant plasmid that is made of yeast shuttle plasmid and pokeweed antibiotic peptides Pa-AMP05 gene recombination, and pokeweed antibiotic peptides Pa-AMP05 gene order is shown in SEQ ID NO:1.
And a kind of preparation method of Yeast engineering bacteria, concrete steps are as follows:
Amplification pokeweed antibiotic peptides Pa-AMP05 gene;
With pokeweed antibiotic peptides Pa-AMP05 gene and the reorganization of yeast shuttle plasmid, obtain recombinant plasmid;
Recombinant plasmid transformed to yeast cell, is recovered to cultivate, obtain containing the Yeast engineering bacteria of pokeweed antibiotic peptides Pa-AMP05 gene, pokeweed antibiotic peptides Pa-AMP05 gene order is shown in SEQ ID NO:1.
The embodiment of the invention further provides the application of above-mentioned Yeast engineering bacteria at food, sanitas, feed or field of medicaments.
The Yeast engineering bacteria of the embodiment of the invention uses yeast as pokeweed antibiotic peptides Pa-AMP05 expression of gene system, has realized genetic safety, has expressed efficiently, is applicable to suitability for industrialized production.
Description of drawings
Fig. 1 is the structural representation of the recombinant plasmid of the embodiment of the invention;
Fig. 2 is the expression cassette synoptic diagram of the recombinant plasmid of the embodiment of the invention;
Fig. 3 is the Yeast engineering bacteria PCR gel electrophoresis figure as a result of the embodiment of the invention;
Fig. 4 is that the pokeweed antibiotic peptides Pa-AMP05 of the embodiment of the invention carries out SDS-PAGE qualification result figure;
Fig. 5 is embodiment of the invention pokeweed antibiotic peptides Pa-AMP05 bacteriostatic test figure as a result.
Embodiment
In order to make purpose of the present invention, technical scheme and advantage clearer,, the present invention is further elaborated below in conjunction with drawings and Examples.Should be appreciated that specific embodiment described herein only in order to explanation the present invention, and be not used in qualification the present invention.
A kind of Yeast engineering bacteria, this Yeast engineering bacteria comprise the recombinant plasmid that is made of yeast shuttle plasmid and pokeweed antibiotic peptides Pa-AMP05 gene recombination, and pokeweed antibiotic peptides Pa-AMP05 gene order is shown in SEQ ID NO:1.
In the Yeast engineering bacteria of the embodiment of the invention, recombinant plasmid is formed by yeast shuttle plasmid and the antibacterial peptide Pa-AMP05 gene recombination of trade route, America, and this recombinant plasmid is free among the yeast cell matter outside the yeast cell genome.The yeast shuttle plasmid is a pokeweed antibiotic peptides Pa-AMP05 expression carrier.With the Yeast engineering bacteria enlarged culturing, its genome obtains expressing, and the recombinant plasmid in the Yeast engineering bacteria of the embodiment of the invention also obtains expressing simultaneously.
Yeast in the embodiment of the invention comprises each primary yeast, for example pichia spp, yeast saccharomyces cerevisiae, and yeast saccharomyces cerevisiae preferably, wherein yeast saccharomyces cerevisiae includes but not limited to distillery yeast, debaryomyces hansenii, candiyeast etc., preferably Saccharomyces Cerevisiae in S 78.Yeast saccharomyces cerevisiae contains elements such as the quality protein, food fibre, vitamin B complexes and the organic chromium that meet the body demand, zinc, selenium, iron, calcium, itself promptly is the health-nutrition source of a kind of pure natural, pollution-free, biological attitude.Yeast saccharomyces cerevisiae is the expression system of food grade, and its expression product safety non-toxic makes can not be doped with harmful substances in the expression product of Yeast engineering bacteria of the embodiment of the invention.Yeast genetic background is clear simultaneously, is applicable to suitability for industrialized production.
The embodiment of the invention does not have concrete restriction to the yeast shuttle plasmid, can be various yeast shuttle plasmids, as long as can be as expression vector in yeast cell, comprise the yeast shuttle plasmid that contains inducible promoter, also comprise the yeast shuttle plasmid that contains non-inducible promoter, these yeast shuttle plasmids can both make pokeweed antibiotic peptides Pa-AMP05 gene can access expression in yeast saccharomyces cerevisiae as pokeweed antibiotic peptides Pa-AMP05 expression carrier.Inducible promoter in genetic expression, needs to add the expression of inductor ability promotor gene, and the promotor of non-induction type does not promptly need to add inductor in genetic expression, and gene also can access expression.For example yeast shuttle plasmid pYES2 is an inductor with the semi-lactosi; Yeast shuttle plasmid pYES6/CT also is inductor and yeast shuttle plasmid pYX212 etc. with the semi-lactosi.Non-inducible promoter is yeast shuttle plasmid pVT102U/ α preferably.Yeast shuttle plasmid pVT102U/ α contains non-inducible promoter, makes above-mentioned recombinant plasmid in the expression process, does not need to add any inductor, has avoided sneaking in the expression product inductor impurity, and methyl alcohol has for example guaranteed the safety of expression product.This yeast shuttle plasmid pVT102U/ α is a secreted expression carrier, and the effect of the signal peptide by alpha factor can be secreted into expression product outside the yeast cell, has also simplified expression product and has separated the process of purifying, and saves cost.
In addition, see also Fig. 2, when Fig. 2 shows with yeast shuttle plasmid pVT102U/ α as pokeweed antibiotic peptides Pa-AMP05 expression carrier, the expression cassette that recombinant plasmid had:
ADH1-α-MFL-antibacterial peptide Pa-AMP05-TT
Wherein ADH1 is a promotor, and α-MFL is the base sequence of alpha factor signal peptide, and TT is a terminator, and antibacterial peptide Pa-AMP05 is meant the base sequence of pokeweed antibiotic peptides Pa-AMP05, specifically sees SEQ ID NO:1.The N end regions of the antimicrobial peptide protein Pa-AMP05 of pokeweed antibiotic peptides Pa-AMP05 genetic expression and the signal peptide of alpha factor merge, and signal peptide is guiding whole fusion rotein to be secreted in the outer substratum of yeast cell; The signal peptide of alpha factor has the restriction enzyme site of precursor processive enzyme Kex2, and fusion rotein is at the effect incision swap signal peptide of the excretory Kex2 of yeast own and directly obtain having native conformation and bioactive target antibacterial peptide Pa-AMP05 albumen.
The embodiment of the invention also provides a kind of preparation method of Yeast engineering bacteria, may further comprise the steps:
A) amplification pokeweed antibiotic peptides Pa-AMP05 gene;
B) with pokeweed antibiotic peptides Pa-AMP05 gene and the reorganization of yeast shuttle plasmid, obtain recombinant plasmid;
C) with recombinant plasmid transformed to yeast cell, recover to cultivate, obtain containing the Yeast engineering bacteria of pokeweed antibiotic peptides Pa-AMP05 gene, pokeweed antibiotic peptides Pa-AMP05 gene order is shown in SEQ ID NO:1.
The resulting Yeast engineering bacteria of the preparation method of the embodiment of the invention need be carried out enlarged culturing, separate purification then, promptly can obtain pokeweed antibiotic peptides Pa-AMP05, the aminoacid sequence of the pokeweed antibiotic peptides Pa-AMP05 that pokeweed antibiotic peptides Pa-AMP05 gene is expressed sees SEQ ID NO:4.
Particularly, the preparation method of the embodiment of the invention is as follows:
Amplification pokeweed antibiotic peptides Pa-AMP05 gene in step S01.
The employed pokeweed antibiotic peptides Pa-AMP05 of embodiment of the invention gene source is in the pokeweed antibiotic peptides seed CDNA library (patent No.: 200810065860.8).
The upstream primer and the downstream primer of design pokeweed antibiotic peptides Pa-AMP05 gene, the upstream primer sequence is shown in SEQ ID NO:2, and the downstream primer sequence is shown in SEQ ID NO:3.In the upstream primer sequence, introduce the restriction enzyme site of restriction enzyme XbaI, introduce the restriction enzyme site of restriction enzyme HindIII in the downstream primer sequence.Specific as follows:
Upstream primer: 5 '-CT
AGAGATCTGCTGGTTGTATT-3 ', underscore are the restriction enzyme site of restriction enzyme XbaI;
Downstream primer: 5 '-CCGGG
TTCGAATTATCTA-3 ', underscore are the restriction enzyme site of restriction enzyme HindIII,
With the pPICZ/Pa-AMP05 plasmid is template, carries out pcr amplification reaction, and the condition of PCR is: circulation of 94 ℃ of 5min; 94 ℃ of 30sec, 55 ℃ of 30sec, 30 circulations of 72 ℃ of 1min; Circulation of 72 ℃ of 10min, the PCR reaction system is
pPICZ/Pa-AMP05 1μl
Upstream primer (5uM) 1 μ l
Downstream primer (5uM) 1 μ l
rTaq 12.5μl
Water 9.5 μ l
Wherein, the pPICZ/Pa-AMP05 plasmid is the plasmid after pPICZ plasmid and the America antibacterial peptide Pa-AMP05 gene recombination, and this recombination method is conventional recombination method, does not do elaboration at this.
In step S02 to the sequence verification of pcr amplification product.
Further, after pokeweed antibiotic peptides Pa-AMP05 gene amplification, need measure, utilize dna sequencing kit to check order the gene fragment after the amplification.The process of order-checking is: reaction totally is 10 μ l:T carriers (PMD18-T Simple Vector), 0.5 μ l, Solution I (being the Solution I in the T support agent box) 5 μ l, pcr gene product 4.5 μ l.Above reactant connects 15 hours under 4 ℃ of conditions, above-mentioned pcr gene product is connected into the T carrier that the T carrier obtains containing pokeweed antibiotic peptides Pa-AMP05 gene.Change over to then in the intestinal bacteria E.coli TOP10 competence, utilize the characteristic of the anti-penbritin (Amp) that the T carrier self has to screen, the positive single colony clone of picking carries out bacterium colony PCR checking, and is identical among PCR reaction system and amplification condition and the step S01.
The correct positive colony of above-mentioned bacterium colony PCR preliminary identification is carried out cell cultures, and the extracting plasmid carries out dna sequencing, and it is as follows that order-checking obtains pokeweed antibiotic peptides Pa-AMP05 gene order:
GCTGGTTGTATTAAAAATGGTGGTAGATGTGTTGCTTCTGGTGGTCCACCATATTGTTGTTCTAATTATTGTTATAGACAAGTTGGTTGGGCTCATAGATATTGTAAAAATAGATAA。As can be known, amplification pokeweed antibiotic peptides Pa-AMP05 gene is successful among the step S01 after the resulting sequence that will check order and the SEQ ID NO:1 contrast.
In step S03, pokeweed antibiotic peptides Pa-AMP05 gene and yeast shuttle plasmid are recombinated.
To carry out double digestion through correct plasmid and the yeast shuttle plasmid of sequence verification with restriction enzyme XbaI and HindIII among the above-mentioned steps S02.The double digestion reaction system is as follows:
In addition, without the order-checking of step S02, carry out the double digestion of step S03 after the step S01, reaction system is:
Product behind the double digestion is reclaimed, pokeweed antibiotic peptides Pa-AMP05 gene is mixed above-mentioned double digestion product by the mol ratio of 5～10:1 with the yeast shuttle plasmid, and the T4DNA ligase enzyme that adds 1 μ l and 10 of 2 μ l * be connected damping fluid, ligation is 15 hours in 16 ℃ of water-baths, makes up the recombinant plasmid of pokeweed antibiotic peptides Pa-AMP05 gene and yeast shuttle plasmid.
In step S04, recombinant plasmid is changed in the yeast cell, obtain containing the Yeast engineering bacteria of pokeweed antibiotic peptides Pa-AMP05 gene.
Get 80 μ l yeast cell competence and 5～10 μ l recombinant plasmids mix, be transferred in the 0.2cm electricity turn trough of ice precooling, mixed solution is placed 5min on ice; Carry out 1500V, the 5ms electric shock adds 1ml and recovers nutrient solution, recovers to cultivate in 30 ℃ of incubators, and incubation time is generally more than 1 hour without limits, is preferably 2 hours, obtains containing the Yeast engineering bacteria of pokeweed antibiotic peptides Pa-AMP05 gene.
Beneficial effect of the present invention:
The Yeast engineering bacteria of the embodiment of the invention, by using yeast shuttle plasmid pVT102U/ α, yeast shuttle plasmid pVT102U/ α contains non-inducible promoter, make above-mentioned recombinant plasmid in the expression process, do not need to add any inductor, avoided sneaking in the expression product inductor impurity, for example methyl alcohol has guaranteed the security of expression product;
Make the recombinant plasmid of present embodiment contain following expression cassette simultaneously:
ADH1-α-MFL-antibacterial peptide Pa-AMP05-TT,
Wherein ADH1 is a promotor, and α-MFL is the base sequence of alpha factor signal peptide, and TT is a terminator, and antibacterial peptide Pa-AMP05 is meant the base sequence of pokeweed antibiotic peptides Pa-AMP05, specifically sees SEQ ID NO:1.The N end regions of the antimicrobial peptide protein Pa-AMP05 of pokeweed antibiotic peptides Pa-AMP05 genetic expression and the signal peptide of alpha factor merge, and signal peptide is guiding whole fusion rotein to be secreted in the outer substratum of yeast cell; The signal peptide of alpha factor has the restriction enzyme site of precursor processive enzyme Kex2, fusion rotein is at the effect incision swap signal peptide of the excretory Kex2 of yeast own and directly obtain having native conformation and bioactive target antibacterial peptide Pa-AMP05 albumen, in addition, because the effect of the signal peptide of alpha factor, the expression product guiding of antimicrobial peptide protein Pa-AMP05 is secreted outside brewing yeast cell, this has also simplified the separation purification process of expression product greatly, reduce cost, also kept the activity of pokeweed antibiotic peptides Pa-AMP05 simultaneously;
Yeast saccharomyces cerevisiae is the expression system of food grade, its expression product safety non-toxic, the embodiment of the invention with yeast saccharomyces cerevisiae as pokeweed antibiotic peptides Pa-AMP05 expression of gene system, guaranteed the expression product safety non-toxic, deleterious expression product can not mix, yeast is as unicellular eukaryotic expression system simultaneously, and genetic background is clear, is applicable to suitability for industrialized production.Owing to use Saccharomyces Cerevisiae in S 78, employed culture medium cost is cheap in follow-up enlarged culturing, component is simple to make Yeast engineering bacteria, and separation, purge process that this has simplified expression product have greatly reduced cost.
The preparation method of the embodiment of the invention, simple to operate, easy, be applicable to suitability for industrialized production.
Below in conjunction with embodiment the embodiment of the invention is described in detail:
Embodiment one
A kind of Yeast engineering bacteria, this yeast is a Saccharomyces Cerevisiae in S 78, this Yeast engineering bacteria comprises the recombinant plasmid of yeast shuttle plasmid pVT102U/ α and pokeweed antibiotic peptides Pa-AMP05 gene recombination formation, pokeweed antibiotic peptides Pa-AMP05 gene order is shown in SEQ ID NO:1, and the preserving number of this saccharomyces cerevisiae engineered yeast is CGMCC 3681.
See also Fig. 1, Fig. 1 shows the structure iron of recombinant plasmid in the embodiment of the invention engineering bacteria, this recombinant plasmid is a carrier with yeast shuttle plasmid pVT102U/ α, the pokeweed antibiotic peptides Pa-AMP05 gene of having recombinated, the expression cassette of this recombinant plasmid is ADH1-α-MFL-Pa-AMP05-TT, and wherein ADH1 is a promotor, and α-MFL is the base sequence of alpha factor signal peptide, TT is a terminator, and antibacterial peptide Pa-AMP05 is meant the base sequence of pokeweed antibiotic peptides Pa-AMP05.
Embodiment two
The preparation method of embodiment of the invention Yeast engineering bacteria, concrete steps are as follows:
Step S201 amplification pokeweed antibiotic peptides Pa-AMP05 gene.
The upstream primer and the downstream primer of design pokeweed antibiotic peptides Pa-AMP05 gene, the upstream primer sequence is shown in SEQ ID NO:2, and the downstream primer sequence is shown in SEQ ID NO:3.In the upstream primer sequence, introduce the restriction enzyme site of restriction enzyme XbaI, introduce the restriction enzyme site of restriction enzyme HindIII in the downstream primer sequence.Specific as follows:
Upstream primer: 5 '-CTAG
AGATCTGCTGGTTGTATT-3 ', underscore are the restriction enzyme site of restriction enzyme XbaI;
Downstream primer: 5 '-CCGGG
TTCGAATTATCTA-3 ', underscore are the restriction enzyme site of restriction enzyme HindIII,
With the pPICZ/Pa-AMP05 plasmid is template, carries out pcr amplification reaction, and the condition of PCR is: circulation of 94 ℃ of 5min; 94 ℃ of 30see, 55 ℃ of 30see, 30 circulations of 72 ℃ of 1min; Circulation of 72 ℃ of 10min, PCR reaction system are 25 μ l systems:
pPICZ/Pa-AMP05 1μl
Upstream primer (5uM) 1 μ l
Downstream primer (5uM) 1 μ l
rTaq 12.5μl
Water 9.5 μ l
Step S202 is to the sequence verification of pcr amplification product.
The process of order-checking is: reaction totally is 10 μ l:T carriers (PMD18-T Simple Vector), 0.5 μ l, Solution I 5 μ l, pcr gene product 4.5 μ l.Above reactant connects 17 hours under 5 ℃ of conditions, above-mentioned pcr gene product is connected into the T carrier that the T carrier obtains containing pokeweed antibiotic peptides Pa-AMP05 gene.Change over to then in the intestinal bacteria E.coliTOP10 competence, utilize the characteristic of the anti-penbritin (Amp) that the T carrier self has to screen, the positive single colony clone of picking carries out bacterium colony PCR checking, and is identical among PCR reaction system and amplification condition and the step S201.
The correct positive colony of above-mentioned bacterium colony PCR preliminary identification is carried out cell cultures, and the extracting plasmid carries out dna sequencing, and it is as follows that order-checking obtains pokeweed antibiotic peptides Pa-AMP05 gene order:
GCTGGTTGTATTAAAAATGGTGGTAGATGTGTTGCTTCTGGTGGTCCACCATATTGTTGTTCTAATTATTGTTATAGACAAGTTGGTTGGGCTCATAGATATTGTAAAAATAGATAA。As can be known, amplification pokeweed antibiotic peptides Pa-AMP05 gene is successful among the step S201 after the resulting sequence that will check order and the SEQ ID NO:1 contrast.The expressed aminoacid sequence of pokeweed antibiotic peptides Pa-AMP05 gene is shown in SEQ ID NO:4.
In step S203, pokeweed antibiotic peptides Pa-AMP05 gene and yeast shuttle plasmid are recombinated.
To carry out double digestion through correct T carrier that contains pokeweed antibiotic peptides Pa-AMP05 gene and the yeast shuttle plasmid pVT102U/ α of sequence verification with restriction enzyme XbaI and HindIII among the above-mentioned steps S202.The double digestion reaction system is as follows:
Product behind the double digestion is reclaimed, in pokeweed antibiotic peptides Pa-AMP05 gene and yeast shuttle plasmid pVT102U/ α mol ratio is that the ratio of 6:1 is mixed above-mentioned double digestion product, and the T4DNA ligase enzyme that adds 1 μ l and 10 of 2 μ l * be connected damping fluid, ligation is 14 hours in 17 ℃ of water-baths, makes up the recombinant plasmid of pokeweed antibiotic peptides Pa-AMP05 gene and yeast shuttle plasmid pVT102U/ α.
In step S104, recombinant plasmid is changed in the Saccharomyces Cerevisiae in S 78, obtain containing the Yeast engineering bacteria of pokeweed antibiotic peptides Pa-AMP05 gene.
Get 80 μ l Saccharomyces Cerevisiae in S 78 competent cells and 6 μ l recombinant plasmids mix, be transferred in the 0.2cm electricity turn trough of ice precooling, mixed solution is placed 5min on ice; Carry out 1500V, the 5ms electric shock adds 1ml and recovers nutrient solution, cultivates the Yeast engineering bacteria that 2h obtains containing pokeweed antibiotic peptides Pa-AMP05 gene, i.e. Yeast engineering bacteria S78/Pa-AMP05 in 30 ℃ of incubators.
The above-mentioned evaluation that contains the Yeast engineering bacteria of pokeweed antibiotic peptides Pa-AMP05 gene
After preparing above-mentioned Yeast engineering bacteria S78/Pa-AMP05, will recover nutrient solution and coat in the screening culture medium (SCR), 30 ℃ are cultured to single bacterium colony and occur.The picking positive colony carries out liquid culture, extracts plasmid, and the plasmid that is extracted is carried out double digestion with XbaI and HindIII restriction enzyme and PCR identifies, and is identical among the condition of PCR and the step S101.
See also Fig. 3, Fig. 3 shows PCR result in this step.Wherein, 1,2,3,4 gel electrophoresis figures that are respectively the saccharomyces cerevisiae engineered yeast that contains pokeweed antibiotic peptides Pa-AMP05 gene; 5 gel electrophoresis figures for the T carrier that contains pokeweed antibiotic peptides Pa-AMP05 gene that obtains among the present embodiment step S102, the T carrier that contains pokeweed antibiotic peptides Pa-AMP05 gene is as positive control; M is the 2000bp molecular weight standard of pokeweed antibiotic peptides Pa-AMP05 gene.As can be seen from Figure 3, the preparation method of the embodiment of the invention completes successfully the yeast saccharomyces cerevisiae expression vector establishment of antibacterial peptide Pa-AMP05 gene, and antibacterial peptide Pa-AMP05 gene is successfully recombinated among the shuttle plasmid pVT102U/ α.
The saccharomyces cerevisiae engineered yeast S78/Pa-AMP05 that screens the positive embodiment of the invention that obtains in the screening culture medium is inoculated in the YPD substratum (1% yeast extract, 2% peptone, 2% glucose), 30 ℃, after 200rpm cultivates 36～48h, the centrifuging and taking supernatant liquor.Through the CM-cellulose23 column chromatography purification, balance liquid is 0.05mol/L HAc, and gradient eluent is 0.05～1mol/L HAc, and flow velocity is 0.45ml/min.The purification of samples collected after lyophilize, is carried out SDS-PAGE and identifies that see also Fig. 4, Fig. 4 shows the molecular weight of the pokeweed antibiotic peptides Pa-AMP05 expression of gene product pokeweed antibiotic peptides Pa-AMP05 of the embodiment of the invention.Wherein, A: negative control: empty carrier yeast expression product; B: positive control: porcine interleukin 10; C: antibacterial peptide Pa-AMP-05, through measuring, the molecular weight of the pokeweed antibiotic peptides Pa-AMP05 of the embodiment of the invention is 4.1KD.
Above-mentioned cryodesiccated pokeweed antibiotic peptides Pa-AMP05 albumen is dissolved with PBS, press gradient dilution.Prepare 0.563g/L protein standard liquid (20 ℃ of freezing preservations).Reaction system is as follows:
Coomassie brilliant blue protein determination system
With the above solution mixing of respectively managing, leave standstill 10min, in the 595nm place, the 1cm optical path, a pipe OD value is surveyed in the distilled water zeroing.The concentration of by formula calculating antimicrobial peptide protein is respectively 100ug/mL, 200ug/mL, 800ug/mL.
Employing standard agar dilution, the pokeweed antibiotic peptides Pa-AMP05 diluent of getting series concentration mixes with double concentration MH agar equal-volume, and it is dull and stereotyped rapidly to shake up the back, about 20ml/ plate.Simultaneously, with the positive contrast of penbritin, be blank with the empty carrier yeast fermentation broth.Test strain is made the bacteria suspension that concentration is equivalent to 0.5 Maxwell standard opacity tube.After the dilution in 1: 10, get 1 μ l and be inoculated in agar plate surface (every some bacterium number is about 10
4Cfu).Hatch 16～20h, observations in the good rearmounted 37 ℃ of incubators of inoculation.See also Fig. 5, Fig. 5 shows pokeweed antibiotic peptides Pa-AMP05 fungistatic effect.Wherein, A: positive contrast, 100 μ g/ml penbritins; B: be blank, empty carrier yeast fermentation broth, C: be pokeweed antibiotic peptides Pa-AMP05 bacteriostatic experiment bacterial growth situation.Among the figure 1: be intestinal bacteria; 2: be streptococcus aureus.
Pokeweed antibiotic peptides Pa-AMP05 is 5ug/mL to colibacillary MIC value;
Pokeweed antibiotic peptides Pa-AMP05 to staphylococcus aureus the MIC value be 2ug/mL.
Embodiment of the invention saccharomyces cerevisiae engineered yeast preservation information is as follows,
Depositary institution's title:
China Committee for Culture Collection of Microorganisms common micro-organisms center;
The depositary institution address:
No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City;
Preservation date:
On March 20th, 2010;
Deposit number:
CGMCC No.3681
Latin classification name:
Saccharomyces cerivisae。
The above only is preferred embodiment of the present invention, not in order to restriction the present invention, all any modifications of being done within the spirit and principles in the present invention, is equal to and replaces and improvement etc., all should be included within protection scope of the present invention.
Sequence table
Claims (8)
1. Yeast engineering bacteria, it is characterized in that: described Yeast engineering bacteria comprises the recombinant plasmid that is made of yeast shuttle plasmid and pokeweed antibiotic peptides Pa-AMP05 gene recombination, and described pokeweed antibiotic peptides Pa-AMP05 gene order is shown in SEQ ID NO:1.
2. Yeast engineering bacteria as claimed in claim 1 is characterized in that, the promotor of described yeast shuttle plasmid is non-inducible promoter.
3. Yeast engineering bacteria as claimed in claim 1 is characterized in that, the promotor of described yeast shuttle plasmid is an inducible promoter.
4. Yeast engineering bacteria as claimed in claim 2, it is characterized in that, described yeast shuttle plasmid is yeast shuttle plasmid pVT102U/ α, the expression cassette of described recombinant plasmid is ADH1-α-MFL-antibacterial peptide Pa-AMP05-TT, wherein ADH1 is a promotor, α-MFL is the base sequence of alpha factor signal peptide, and TT is a terminator.
5. Yeast engineering bacteria as claimed in claim 1 is characterized in that, described yeast is a Saccharomyces Cerevisiae in S 78.
6. the preparation method of a Yeast engineering bacteria comprises the steps:
Amplification pokeweed antibiotic peptides Pa-AMP05 gene;
With pokeweed antibiotic peptides Pa-AMP05 gene and the reorganization of yeast shuttle plasmid, obtain recombinant plasmid;
Recombinant plasmid transformed to yeast cell, is recovered to cultivate, obtain containing the Yeast engineering bacteria of pokeweed antibiotic peptides Pa-AMP05 gene, described pokeweed antibiotic peptides Pa-AMP05 gene order is shown in SEQ ID NO:1.
7. the preparation method of Yeast engineering bacteria as claimed in claim 6, it is characterized in that, in the step of described amplification pokeweed antibiotic peptides Pa-AMP05 gene, the upstream primer sequence of use is shown in SEQ ID NO:2, and the downstream primer sequence of use is shown in SEQ ID NO:3.
8. as each described Yeast engineering bacteria application in food, sanitas, feed or medicine of claim 1-5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102784640A CN102260632A (en) | 2009-09-18 | 2010-09-11 | Engineering yeast strain, its preparation method and application |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910190445 | 2009-09-18 | ||
| CN200910190445.X | 2009-09-18 | ||
| CN2010102784640A CN102260632A (en) | 2009-09-18 | 2010-09-11 | Engineering yeast strain, its preparation method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102260632A true CN102260632A (en) | 2011-11-30 |
Family
ID=45007475
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102784640A Pending CN102260632A (en) | 2009-09-18 | 2010-09-11 | Engineering yeast strain, its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102260632A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102174623A (en) * | 2011-01-18 | 2011-09-07 | 深圳市圣西马生物技术有限公司 | Fermentation method and application of yeast engineering bacteria |
| CN105018361A (en) * | 2015-07-13 | 2015-11-04 | 江南大学 | Method for high-density fermentation cultivation of brewer's yeast |
| CN106754443A (en) * | 2016-12-29 | 2017-05-31 | 福建师范大学 | A kind of Yeast engineering bacteria for producing specific antibacterial peptide and its fermentation application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101289501A (en) * | 2008-03-17 | 2008-10-22 | 深圳市圣西马生物技术有限公司 | Pokeweed antibiotic peptides, precursor peptides thereof, polynucleotide and applications |
-
2010
- 2010-09-11 CN CN2010102784640A patent/CN102260632A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101289501A (en) * | 2008-03-17 | 2008-10-22 | 深圳市圣西马生物技术有限公司 | Pokeweed antibiotic peptides, precursor peptides thereof, polynucleotide and applications |
Non-Patent Citations (2)
| Title |
|---|
| 《Science of China》 19960331 张友尚等 Secretory expression of alpha single-chain insulin precursor in yeast and its conversion into human insulin 全文 1-8 第39卷, 第3期 * |
| 《生物化学与生物物理进展》 20030630 陈艳等 植物多肽抗生素研究进展 全文 1-8 第6卷, 第30期 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102174623A (en) * | 2011-01-18 | 2011-09-07 | 深圳市圣西马生物技术有限公司 | Fermentation method and application of yeast engineering bacteria |
| CN102174623B (en) * | 2011-01-18 | 2013-11-13 | 深圳市圣西马生物技术有限公司 | Fermentation method and application of yeast engineering bacteria |
| CN105018361A (en) * | 2015-07-13 | 2015-11-04 | 江南大学 | Method for high-density fermentation cultivation of brewer's yeast |
| CN105018361B (en) * | 2015-07-13 | 2018-10-16 | 江南大学 | A kind of method of saccharomyces cerevisiae high density fermentation culture |
| CN106754443A (en) * | 2016-12-29 | 2017-05-31 | 福建师范大学 | A kind of Yeast engineering bacteria for producing specific antibacterial peptide and its fermentation application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102199196B (en) | Gene engineering antibacterial peptide and preparation method and application thereof | |
| CN102952835A (en) | Method for producing cecropin by fermentation of bacillus subtilis | |
| CN104694559A (en) | DNA segment for efficient expression of egg white lysozyme by employing recombinant pichia pastoris and expression method thereof | |
| CN102584977A (en) | Porcine defensin pBD2 polypeptide and application thereof in inhibiting porcine pathogenic bacteria | |
| CN101233234A (en) | Production of secondary metabolites using capillary membranes | |
| CN103333225A (en) | Antibacterial peptide, preparation method and applications thereof | |
| CN109266675A (en) | A kind of Bacillus subtilis genes engineering bacteria producing lipopeptid and its construction method and application | |
| CN102260632A (en) | Engineering yeast strain, its preparation method and application | |
| CN101864372A (en) | Preparation method of antibacterial peptide gene engineering strain | |
| CN104356222B (en) | Mutant of one boar derived antimicrobial peptide PR 39 and its preparation method and application | |
| CN101392231A (en) | Recombinant bacillus coli and method for producing PHB by using biomass material and the same | |
| CN105039189A (en) | Genetically engineered bacterium capable of producing Gallus gallus lysozyme and its construction and application | |
| CN113354718B (en) | Pirfenidone precursor, expression cassette and preparation method thereof | |
| CN104447976B (en) | One boar derived antimicrobial peptide cecropin P1 mutant and its preparation method and application | |
| CN110468143A (en) | The preparation method and application of antibacterial peptide NZX | |
| CN109266676A (en) | A kind of method of electroporated Siam bacillus | |
| CN103233035B (en) | China tachyplesin constitutive yeast expression vector and preparation method thereof | |
| CN102080079B (en) | Preparation method and application of novel antimicrobial peptide Misgurin mutant | |
| CN102242092A (en) | Isolation and identification for bombyx mori intestinal tract probiotics, and cloning and expression of enzyme gene produced by bombyx mori probiotics | |
| CN104789625A (en) | Method for secretory expression of human alpha defensin 5 in saccharomyces cerevisiae | |
| CN105671069B (en) | A kind of bee peptide expression vector and its construction method and application | |
| CN104448006B (en) | A kind of heterozygous antibacterial peptide CE-PR and application thereof | |
| CN103333912A (en) | Method for implementing constitutive expression of plectasin derivative MP1102 in Pichia pastoris | |
| CN103923853A (en) | Paenibacillus sp. and method for preparing k-carrageenanase by using same | |
| CN103045629A (en) | Lactase glucose depression knockout vector pMD19/HPT |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20111130 |
|
| RJ01 | Rejection of invention patent application after publication |