CN104789625A - Method for secretory expression of human alpha defensin 5 in saccharomyces cerevisiae - Google Patents

Abstract

A method for secreting and expressing human α-defensin 5 in Saccharomyces cerevisiae, comprising constructing a recombinant Saccharomyces cerevisiae expression vector containing a human α-defensin 5 gene using a secreted Saccharomyces cerevisiae expression vector, and introducing the constructed recombinant Saccharomyces cerevisiae expression vector into Saccharomyces cerevisiae In this method, recombinant Saccharomyces cerevisiae was obtained, and the recombinant Saccharomyces cerevisiae was cultured to express human α-defensin 5 gene. The present invention uses Saccharomyces cerevisiae with naturally occurring plasmids as an expression system. Through secreted expression, the target protein polypeptide directly exists in the supernatant of the fermentation broth, which not only ensures that the expressed target protein has the correct natural conformation; and the product exists in the supernatant In the process, there is no need to break the cells, which greatly simplifies the separation and purification process and reduces the production cost.

Description

Method for secreting and expressing human α-defensin 5 in Saccharomyces cerevisiae

technical field

The present invention relates to a method for expressing human α-defensin 5, in particular to a method for expressing human α-defensin 5 in a Saccharomyces cerevisiae expression system.

Background technique

Defensins are a type of antibacterial polypeptide active substances produced in organisms, which can fight against exogenous pathogens. They are the largest subfamily of antibacterial peptides and an important part of the innate immunity of organisms. They form the host with complement and interferon. Important primary immune defense system.

Similar to general preservatives, natural defensins can achieve broad-spectrum and high-efficiency antibacterial effects by causing cell membrane perforation through physical action, and are safe and leave no residue. Compared with ordinary antibiotics, defensins have certain advantages: 1. Defensins molecules are derived from living organisms, and can enter microbial cells well, leading to increased membrane permeability, thereby destroying their energy metabolism system, and finally achieving rapid Inhibit the activity, growth and reproduction of microorganisms. 2. The unique antibacterial mechanism of defensins makes it less likely for pathogenic microorganisms to produce drug-resistant mutations, making it safer and more reliable. 3. Defensins exhibit typical synergistic effects with antibiotics, such as regulating the body's immune response and inflammatory response, neutralizing endotoxin, and regulating tissue wound repair.

In recent years, the role of human α-defensin 5 (HD-5) secreted by Paneth cells (PC) in defending against microorganisms in the intestinal mucosa has received widespread attention; HD-5 has a wide antibacterial spectrum and does not affect intestinal microbiota The advantages of ecological balance and resistance to drug resistance have ushered in the dawn of the development of new anti-intestinal infection drugs. The location of DEFA5 is in the p21-pter region of chromosome 8, with two exons, and an intron separates the two exons. The size of the DEFA5 gene is 449bp, of which the first 40bp is the 5'-untranslated region (5'-UTR), 41-97bp is the signal peptide sequence of the gene, 227-322bp is the base sequence encoding HD-5 mature peptide, and The sequence between the signal peptide and the mature peptide is the pre-fragment, and 433-438 is the PolyA sequence. HD-5 precursor protein has 94 amino acids, including signal peptide sequence and proregion sequence and α-defensin 5 mature peptide. Human HD-5 mature peptide (mature human alpha-defensin-5, mHD-5) contains 32 amino acids, a cationic short peptide with a relative molecular mass of 3.58kD; six conservative cysteine residues constitute the 3 intramolecular disulfide bonds (Cys65-Cys93, Cys72-Cys92, Cys67-Cys82).

After further activity testing, human HD-5 not only can efficiently kill various bacteria, but also has strong antiviral biological activity. Data analysis shows that human HD-5 is likely to have the strongest antibacterial activity among human α-defensins. Enveloped viruses and the like have obvious inhibitory/killing effects. Human HD-5 also exhibits functions such as stimulating small intestine secretion, inhibiting NK cell activity, and promoting inflammatory cell chemotaxis, and has comparatively strong anti-human papillomavirus (HPV)-infected human cervical cancer cell (HeLa) research. Good biological activity, so human HD-5 is considered to be a candidate new drug molecule for the prevention and treatment of viral venereal diseases and enterogenous and genital tract bacterial infections, and has good prospects for clinical development and application. However, human α-defensin 5 is generally obtained by extracting from specific tissues or by chemically synthesizing polypeptides. Therefore, how to efficiently express human α-defensin 5 has become the direction of efforts.

Yeast, as an engineering recipient, has developed rapidly in recent years. Compared with Escherichia coli, yeast has a more complete gene expression regulation mechanism, post-translational processing modification ability and secretion ability, and does not produce endotoxin. It is a good eukaryotic gene recipient. body bacteria. Yeast has the advantages of relatively simple gene manipulation, correct exogenous protein processing and modification, high expression level, easy purification, and suitable for mass fermentation. And the product is specifically designed according to the prokaryotic protein, the target DNA has no homology with the eukaryotic gene regulatory gene, so there is no non-specific influence of the gene, and the expression of the gene can be strictly regulated, and the expression of the gene can be artificially regulated to achieve high efficiency. The induction of gene expression is also beyond the reach of other systems. Pichia pastoris is one of the commonly used host bacteria for recombinant protein expression. The recombinant plasmid used to transform Pichia pastoris is a shuttle plasmid, which contains the replication origin of Escherichia coli, but this type of plasmid cannot replicate and exist stably in Pichia pastoris, and can only be obtained after the recombinant expression vector is integrated into the Pichia pastoris gene. Stable existence. Therefore, factors such as the transfer of exogenous genes, the activity of endogenous proteases, the type and state of the host bacteria can all affect the expression efficiency of exogenous proteins in Pichia pastoris.

Contents of the invention

The technical problem to be solved by the present invention is to provide a method for secreting and expressing human α-defensin 5 that can efficiently express human α-defensin 5 gene in Saccharomyces cerevisiae.

In order to solve the above technical problems, the technical solution adopted in the present invention is: a method for secreting and expressing human α-defensin 5 in Saccharomyces cerevisiae. The recombinant Saccharomyces cerevisiae expression vector is introduced into Saccharomyces cerevisiae to obtain the recombinant Saccharomyces cerevisiae, and the recombinant Saccharomyces cerevisiae is cultivated to express the human alpha defensin 5 gene.

The secretory Saccharomyces cerevisiae expression vector is pVT102U-α plasmid. The constructed expression vector of recombinant Saccharomyces cerevisiae was pVT102-α-HD5.

In the present invention, the method for introducing the constructed recombinant Saccharomyces cerevisiae expression vector into Saccharomyces cerevisiae is the electric shock transformation method, and of course other common methods in the biological field can also be used.

The present invention uses Saccharomyces cerevisiae with naturally existing plasmids as an expression system to carry out related experiments. Compared with Pichia pastoris, Saccharomyces cerevisiae has similar molecular and genetic manipulation advantages, but the foreign gene is not integrated into the host DNA, has no essential impact on the host cell, and the cell itself does not affect the expression efficiency of the foreign protein. Moreover, the present invention is secreted expression, and the target protein polypeptide is directly present in the supernatant of the fermentation broth. On the one hand, this expression method can ensure that the expressed target protein has the correct natural conformation; on the other hand, the product exists in the supernatant, There is no need to break the cells, which greatly simplifies the separation and purification process and reduces the production cost. Furthermore, Saccharomyces cerevisiae is a safe strain, and its expression products can easily meet the safety requirements required for various applications, and can be widely used in the fields of food, medicine, animal nutrition, beauty and health care, and the like.

Description of drawings

Fig. 1 is a diagram showing the amplification result of bridging PCR detected by agarose gel electrophoresis.

Among them, 1: 20bp DNA Ladder Marker; 2, 3: The final product of bridge PCR amplification.

Fig. 2 is a plasmid map of the secretory Saccharomyces cerevisiae expression vector pVT102U-α.

Fig. 3 is an electrophoresis detection diagram of the recombinant plasmid pVT102U-α-HD5 screened by colony PCR.

Among them, 1: Trans2K plus DNA Marker; 2, 3: PCR products of recombinant plasmid positive clone colonies.

Figure 4 is a diagram of the antibacterial effect of HD-5 on Staphylococcus aureus.

Wherein, 1 and 2 represent 100 μL of 0.02 mg/mL ampicillin (Amp); 3 and 4 represent 100 μL of the fermentation broth supernatant of recombinant yeast S78/pVT102U-α-HD5.

Figure 5 is a diagram of the antibacterial effect of HD-5 on Escherichia coli.

Wherein, 1 and 2 represent 100 μL of 0.02 mg/mL ampicillin (Amp); 3 and 4 represent 100 μL of the fermentation broth supernatant of recombinant yeast S78/pVT102U-α-HD5.

Detailed ways

Embodiment 1, the cloning of defensin gene and the construction of expression vector

1. Find the protein sequence of HD5 on NCBI, and design its codable DNA sequence with reference to the codon preference of Saccharomyces cerevisiae.

2. Design bridging primers, and introduce enzyme cutting sites and corresponding protective bases at the 5' and 3' ends of the sequence.

Bridging internal primers:

Upstream primer HD5-F1:

5'-TAAGAGATGTTATTGTAGAACTGGTAGATGTGCTACTAGAGAATCATTGTCTGGTGTCT-3', see SEQ ID NO: 1,

Downstream primer HD5-R1:

5'-TTATCTACAACACAATCTATACAATCTACCACTAATTTCACAGACACCAGACAATGATT-3', see SEQ ID NO: 2;

Bridging outer primers:

Upstream primer HD5-F2: 5'-CG TCTAGA TAAGAGATGTTA-3' (XbaI), see SEQ ID NO: 3,

Downstream primer HD5-R2: 5'-CCG AAGCTT TATCTACAACA-3' (HindIII), see SEQ ID NO:4.

3. Acquisition of defensin genes

The PCR reaction system was constructed according to the instructions of Pfu DNA Polymerase from Thermo Company. The first round of PCR reaction system is: 2.5μL of Pfu Buffer (10×), 2.0μL of MgSO ₄ (25mM), 2.0μL of dNTPs (2.5uM), 1.0μL of HD5-F1 (10pmol/μL), 1.0μL HD5-R1 (10 pmol/μL), 16 μL of ddH ₂ O and 0.5 μL of Pfu DNA Polymerase (2.5 U/μL). The reaction process was: 95°C pre-denaturation for 1 min; 94°C denaturation for 30 sec, 68°C annealing for 30 sec, 68°C extension for 30 sec, 25 cycles; 68°C final extension for 5 min. The second round of PCR reaction system is: 0.5 μL of Pfu Buffer (10×), 0.5 μL of dNTPs (2.5uM), 1.0 μL of HD5-F2 (10 pmol/μL), 1.0 μL of HD5-R2 (10 pmol/μL) , 20 μL first-round PCR product and 2.0 μL ddH2O. The reaction process was as follows: 95°C pre-denaturation for 1 min; 94°C denaturation for 30 sec, 52°C annealing for 40 sec, 72°C extension for 40 sec, 35 cycles; and 72°C final extension for 7 min. The obtained HD5 defensin gene fragment nucleotide sequence is: CGTCTAGATAAGAGA (this is the XbaI endonuclease site and signal peptidase site protein sequence) TGTTATTGTAGAACTGGTAGATGTGCTACTAGAGAATCATTGTCTGGTGTCTGTGAAATTAGTGGTAGATTGTATAGATTGTGTTGTAGATA AAGCTT CGG (this is the HindIII endonuclease site) (SEQ ID NO: 5), the corresponding amino acid sequence of the protein is CYCRTGRCATRESLSGVCEISGRLYRLCCR (SEQ ID NO: 6); the PCR product was observed by 3% agarose gel electrophoresis, and an amplified band of about 100bp was seen (Fig. 1), indicating that the amplified Obtain the target product.

4. Construction of recombinant expression vector

The HD5 defensin gene fragment obtained in process 3 was recovered by gel recovery method, and the recovered product was subjected to double enzyme digestion treatment with XbaI and HindIII, extracted and purified with phenolform, added isopropanol and treated at low temperature to obtain a precipitate, and the precipitate was dried and used Dissolve in ddH2O; use the same method to perform double enzyme digestion on the pVT102U-α plasmid (Figure 2), the secretory Saccharomyces cerevisiae expression vector, and recover a fragment of about 6.9 kb from the gel. Mix 3 μL of the double-digested HD5 gene fragment and 5 μL of the double-digested pVT102U-α plasmid, then add 1 μL of T4 DNA ligase Buffer (10×) and 1 μL of T4 DNA ligase. After ligation at 16°C for 12 hours, the ligation product was transformed into DH5α competent, and cultured on LB plates containing ampicillin at 37°C for 12 hours; the pVT102U-α plasmid was preserved by the Cell Biology Laboratory of Hunan Agricultural University.

5. Identification of positive colonies

From the plate containing single colonies obtained in process 4, pick several single colonies and dissolve them in 20 μL ddH2O, and use this as a template for colony PCR reaction. The reaction system is: 5.0 μL of template bacteria solution, 2.5 μL of Taq Buffer (10×), 2.0 μL of dNTPs (2.5uM), 1.0 μL of HD5-F2 (10 pmol/μL), 1.0 μL of HD5-R2 (10 pmol /μL), 13μL of ddH2O and 0.5μL of Taq enzyme (2.5U/μL). The reaction process was: 95°C pre-denaturation for 5 min; 94°C denaturation for 1 min, 58°C annealing for 40 sec, 72°C extension for 40 sec, 35 cycles; and 72°C final extension for 5 min. After the reaction, the PCR product was observed by 1% agarose gel electrophoresis ( FIG. 3 ), and it can be seen that the monoclonal colony contains the target gene fragment.

Inoculate the single colony solution containing the target gene fragment into the LB liquid medium containing ampicillin for 12 hours, save a copy of the strain, and send the remaining extracted plasmid to the biological company for sequencing. The plasmid with the correct sequencing result is named pVT102-α- HD5.

Embodiment 2, transformation of recombinant Saccharomyces cerevisiae S78 expression vector

1. The alkaline lysis method was used to extract a large number of pVT102-α-HD5 plasmids of recombinant Saccharomyces cerevisiae S78 expression vector.

2. Electric shock conversion

1) Host bacteria: S78

YPD medium: yeast extract 10g, peptone 20g, glucose 20g, agar 15g, pH 7.0.

YSD medium: yeast nitrogen base 6.7g, glucose 20g, leucine 200mg, adenine 100mg, inositol 200mg, agar 15g, pH 7.0.

1M Sorbitol: 182.17g sorbitol dissolved in 1L ddH2O.

2) Electrotransformation of Saccharomyces cerevisiae

①The bacteria were inoculated on the YPD medium plate and cultured at 30°C for 2-3 days.

②Pick a single colony and inoculate it into a Erlenmeyer flask containing liquid YPD medium, and culture at 30°C with shaking at 150r/min for 16h. Place it at 4°C for 15 minutes.

③Take 1.4mL of the bacterial solution to the EP tube, centrifuge at 6000r/min at 4°C for 5min, discard the supernatant, and collect the bacterial cells.

④Resuspend the bacteria in 800μL pre-cooled deionized water. Centrifuge at 6000r/min for 5min at 4°C, discard the supernatant, and collect the cells.

⑤Resuspend the bacteria in 500μL pre-cooled deionized water. Centrifuge at 6000r/min for 5min at 4°C, discard the supernatant, and collect the cells.

⑥Resuspend the bacteria in 200 μL of pre-cooled 1mol/L sorbitol. Centrifuge at 6000r/min for 5min at 4°C, discard the supernatant, and collect the cells.

⑦ Resuspend the bacteria in 100 μL of pre-cooled 1mol/L sorbitol. Add 1ng DNA, and bathe in ice for 30min.

⑧ Put the total ice-bath bacteria solution into the electric shock cup, and conduct electric shock at 1700V for 5ms.

⑨Mix with 800 μL YPD medium and 200 μL 1mol/L sorbitol, wash out the bacterial cells in the electric shock cup, and resume culture for 5 hours without shaking.

⑩Centrifuge the cultured bacteria solution at 6000r/min for 5min, remove 800μL supernatant, mix the remaining supernatant with the bacteria, and then spread it on a YSD solid plate, culture it upside down at 30°C for 3-4 days, and grow in YSD culture The base transformant is a positive transformant.

Example 3, Expression Detection and Isolation and Purification of HD5 in Saccharomyces cerevisiae

1. Pick a plaque with a diameter of 0.5cm on the YSD plate and expand it in 10mL YSD solution for 12h, then transfer it to 50mLYSD solution at a ratio of 1:25, culture at 30°C, 200r/min, for 12h; finally, at a ratio of 1:25 Transfer the proportion of the mixture into 1L YPD solution, 30°C, 200r/min, and expand the culture for 3-4 days. The bacterial cells were removed, and the supernatant of the fermentation broth was collected for expression detection and isolation and purification.

2. Detection of defensin expression and biological activity by agarose diffusion method

After the supernatant of the fermentation broth in process 1 was centrifuged to remove the precipitate, it was temporarily stored in a -80°C refrigerator for later use. Pick a single colony of Staphylococcus aureus and Escherichia coli and inoculate it in a liquid medium for 12 hours at 37°C, add solid medium cooled to about 50°C, shake well, and spread the plate. After the medium is solidified, use a sterile puncher to punch holes on the plate, add 100 μL of the spare fermentation broth supernatant to the wells dropwise, and use 100 μL of 0.02 mg/mL Amp antibiotic as a positive control, see Figure 4 and Figure 4 for details. 5. It can be seen that the supernatant of the fermentation broth has antibacterial activity, and it has an effect on both Gram-negative bacteria (Escherichia coli) and Gram-positive bacteria (Staphylococcus aureus), indicating that HD-5 with biological activity has been It was successfully expressed and secreted into the fermentation broth.

Claims (4)

1. the method for a human α-defensin 5 secreting, expressing in yeast saccharomyces cerevisiae, it is characterized in that, the method utilizes secretor type saccharomyces cerevisiae expression to build the recombinant Saccharomyces cerevisiae expression vector containing human α-defensin 5 gene, the recombinant Saccharomyces cerevisiae expression vector built is imported in yeast saccharomyces cerevisiae, obtain recombinant Saccharomyces cerevisiae, cultivate recombinant Saccharomyces cerevisiae and human α-defensin 5 gene is expressed.

2. the method for human α-defensin 5 secreting, expressing in yeast saccharomyces cerevisiae as claimed in claim 1, it is characterized in that, described secretor type saccharomyces cerevisiae expression is pVT102U-α plasmid.

3. the method for human α-defensin 5 secreting, expressing in yeast saccharomyces cerevisiae as claimed in claim 2, it is characterized in that, described recombinant Saccharomyces cerevisiae expression vector is pVT102-α-HD5.

4. the method for human α-defensin 5 secreting, expressing in yeast saccharomyces cerevisiae according to any one of claim 1-3, is characterized in that, the described method imported in yeast saccharomyces cerevisiae by the recombinant Saccharomyces cerevisiae expression vector of structure is electroporated method.