CN103233035B - China tachyplesin constitutive yeast expression vector and preparation method thereof - Google Patents
China tachyplesin constitutive yeast expression vector and preparation method thereof Download PDFInfo
- Publication number
- CN103233035B CN103233035B CN201210051429.4A CN201210051429A CN103233035B CN 103233035 B CN103233035 B CN 103233035B CN 201210051429 A CN201210051429 A CN 201210051429A CN 103233035 B CN103233035 B CN 103233035B
- Authority
- CN
- China
- Prior art keywords
- tachyplesin
- expression vector
- gene
- tpi
- yeast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a China tachyplesin constitutive yeast expression vector and a preparation method thereof, and belongs to the technical field of biology. According to the invention, with micro-ecological theory and molecular biology technologies, a tachyplesin antimicrobial peptide tachyplesin I (TPI) gene is cloned into a constitutive expression vector pGAPZalphaA, such that tachyplesin antimicrobial peptide gene GAP promoter yeast expression vector is established. According to the invention, primers TPI-NNX1 and TPI-NNX2 are designed according to sequencing results of tachyplesins gene; general primers are synthesized according to a pGAPZalpha manual; double enzyme digestion is carried out upon TPI gene cloning plasmid pMD-18T-TPI and the yeast expression vector pGAPZalphaA; enzyme digestion target segments are recovered, and are connected by using T4DNA ligase; the connection product is used for converting Escherichia coli DH5alpha; positive transformants are screened, and plasmids are extracted; PCR and double enzyme digestion identification are carried out, and sequencing is carried out. With the method, tachyplesin antimicrobial peptide yeast high-efficiency expression genetically engineered bacteria with high expression efficiency and zero pollution can be screened.
Description
Technical field
The invention belongs to biological technical field.
Background technology
Antibacterial peptide (Antibacterial Peptides, ABP) is the endogeneous activity peptide molecule of being encoded by germline gene, is extensively present in multiple organism, be organism to external world pathogen invasion infect and produce a series of immunoreactive product.Because its molecular weight is little, be very easily diffused into infection site, do not deposit the problem producing resistance after a procedure, and without hazard residue after entering body, therefore, the research and apply of antibacterial peptide on livestock and poultry breeding industry will be the important measures realizing healthy aquaculture, eliminate antibiotic remains.King crab is a kind of extremely precious marine invertebrate, and " living fossil " that Ye Shi marine animal circle is existing, its economic worth and scientific research value are very high.King crab lacks acquired immune system, and in the process of opposing pathogen invasion, define multiple natural defending system, in these systems of defense, king crab element (Tachyplesin) has played main anti-etiologic agent.King crab element is the cationic polypeptide with anti-microbial activity that a class is present in limulus blood cell, and its discovery is called by medical circle the milestone that " microbiotic " is studied, and is the beautiful of arrival of rear microbiotic epoch.
1969, Koichi Ogata Late Cambrian is a kind of can utilize methyl alcohol as the yeast of sole carbon source and the energy
[].Methyl alcohol can very cheap synthesizing from Sweet natural gas, therefore causes people pichia spp to be developed to the interest of animal high protein feed immediately.20 century 70s, Phillips Petroleum Company have developed the substratum of pichia spp single cell protein (SCP) and continuous high-density cultivation method (<130 g/L dry cell weight).Enter the eighties, Salk Institute Biotechnology/Industrial Associate Inc.(SIBIA) pichia spp is developed as heterologous protein expression system, and construct the genetically engineered working method of carrier, bacterial strain and pichia spp.Continue to use during SCP produces the substratum and fermentation process that use, the regulation and control of associating AOX1 promotor, achieve the high level expression of foreign protein in pichia spp.1993, authorize Invitrogen Company to sell this system to the whole world, promoted development and the application of pichia yeast expression system.Up till now, the albumen of more than 200 kinds has successfully been have expressed with pichia yeast expression system, it is a kind of safe biology that pichia spp is also confirmed as by U.S. food and Drug Administration (Food and Drug Administration, FDA), has good biological safety.Exploitation in 1997
p.pastoriscomposing type glyceraldehyde-3-phosphate dehydrogenase gene (Glyceraldehydes – 3-phosphate dehydrogenase, GAP) promotor, this promotor is constitutive expression, so there is not the problem of induction, the substratum taking glucose as carbon source just can be expressed, thus be conducive to production and the application of product, and expression amount comparatively induction type is high.At present, this system is also seldom applied to the expression of antibacterial peptide, expects and the expression this system being introduced antibacterial peptide can become the optimal path of antibacterial peptide large-scale production.
Summary of the invention
The object of the invention is to adopt the theoretical and Protocols in Molecular Biology of Tiny ecosystem, by Tachypleus tridentatus antibacterial peptide Tachyplesins I(TP I) gene clone in constitutive expression carrier pGAPZ α A, build king crab element antibacterial peptide gene GAP promoter yeast expression vector.
First the present invention designs primer TP I-NNX1 and TP I-NNX2, containing following restriction enzyme site according to the sequencing result of tachyplesins gene:
Upstream primer TP I-NNX1:5 '-CCG
c|TCGAGaAAAGAAAATGGTGCTTCCGTGTTTG-3 '
Xho I
Downstream primer TP I-NCX2:5 '-GC
t|CTAGAtTAACGGCAACGACGGTAGCAG-3 '
Xba I
Then according to pGAPZ α service manual synthesis universal primer:
Upstream primer 5 ' pGAP:5 '-GACTGGTTCCAATTGACAAGC-3 '
Downstream primer 3 ' AOX1:5 '-GCAAATGGCATTCTGACATCC-3 '
Double digestion is carried out to the cloned plasmids pMD-18T-TP I of TP I gene and Yeast expression carrier pGAPZ α A, reclaims enzyme and cut object fragment, use T
4dNA ligase connects, and connects product conversion bacillus coli DH 5 alpha, and screening positive transformant, extracts plasmid, carries out PCR and double digestion qualification, and checks order.
The China tachyplesin constitutive yeast expression vector pGAPZ α A-TPI that the present invention is obtained by aforesaid method.
The present invention adopts Tiny ecosystem theory and Protocols in Molecular Biology, by Tachypleus tridentatus antibacterial peptide Tachyplesins I(TP I) gene clone is in constitutive expression carrier pGAPZ α A, build king crab element antibacterial peptide gene GAP promoter yeast expression vector, electricity is transformed in yeast host bacterium X-33, screening can high expression, no pollution king crab element antibacterial peptide yeast high expression genetic engineering bacterium.And detect for indicator carries out preliminary bacteriostatic activity with intestinal bacteria and streptococcus aureus.Carry out suitability for industrialized production for next step and probe into antibacterial peptide biological action external in vivo further and mechanism of action provides material.
Accompanying drawing explanation
fig. 1 ispGAPZ α A plasmid map;
Fig. 2 is recombinant plasmid pGAPZ α A-TP I collection of illustrative plates;
Fig. 3 is that the PCR of recombinant plasmid pGAPZ α A-TP I and enzyme cut qualification result;
Fig. 4 is that recombinant plasmid pGAPZ α A-TPI enzyme cuts qualification result;
Fig. 5 is pGAPZ α A-TP I recombinant plasmid sequencing result;
Fig. 6 is that X33-GAP-TP I recombination microzyme PCR identifies;
For carrying out pcr amplification detected result to yeast strain DNA primer TP I-NCX2 and 5 ' pGAP, theoretical amplification clip size is 376 bp, as shown in the figure, positive strain all has specific amplification (3 ~ 16 swimming lane) near object fragment, and 2 swimming lanes are that blank X-33 yeast strain DNA contrasts;
Fig. 7 is that X33-GAP-TPI recombination microzyme PCR identifies;
For carrying out pcr amplification detected result to yeast strain DNA primer TP I-NNX1 and 3 ' AOX1, theoretical amplification clip size is 230 bp, as shown in the figure, positive strain all has specific amplification (2 ~ 15 swimming lane) near object fragment, and 1 swimming lane is that blank X-33 yeast strain DNA contrasts;
Fig. 8 is that X33-GAP-TPI recombination microzyme PCR identifies;
For carrying out pcr amplification detected result to yeast strain DNA primer TP I-NNX1 and TP I-NNX2, theoretical amplification clip size is 66 bp, as shown in the figure, positive strain all has specific amplification (2 ~ 15 swimming lane) near object fragment, and 16 swimming lanes are that blank X-33 yeast strain DNA contrasts;
Fig. 9 is tunning Tricine-Glycerol-SDS-PAGE result;
Figure 10 is the Activity determination result of tunning.
Embodiment
The Chinese tachyplesin constitutive pichia yeast positive expression bacterial strain depositary institution title that the present invention relates to: China Committee for Culture Collection of Microorganisms's common micro-organisms center, depositary institution address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City; Preservation date: on November 16th, 2011, deposit number: CGMCC No.5462, Classification And Nomenclature: pichia pastoris phaff pichia pastoris.
First the present invention designs primer TP I-NNX1 and TP I-NNX2, containing following restriction enzyme site according to the sequencing result of tachyplesins gene:
Upstream primer TP I-NNX1:5 '-CCG
c|TCGAGaAAAGAAAATGGTGCTTCCGTGTTTG-3 '
Xho I
Downstream primer TP I-NCX2:5 '-GC
t|CTAGAtTAACGGCAACGACGGTAGCAG-3 '
Xba I
Then according to pGAPZ α service manual synthesis universal primer:
Upstream primer 5 ' pGAP:5 '-GACTGGTTCCAATTGACAAGC-3 '
Downstream primer 3 ' AOX1:5 '-GCAAATGGCATTCTGACATCC-3 '
Double digestion is carried out to the cloned plasmids pMD-18T-TP I of TP I gene and Yeast expression carrier pGAPZ α A, reclaims enzyme and cut object fragment, use T
4dNA ligase connects, and connects product conversion bacillus coli DH 5 alpha, and screening positive transformant, extracts plasmid, carries out PCR and double digestion qualification, and checks order.
The China tachyplesin constitutive yeast expression vector pGAPZ α A-TPI that the present invention is obtained by aforesaid method.
Bacterial strain and plasmid
Main bacterial strain and plasmid are in table 1 and Fig. 1.
The main bacterial strain that table 1 uses and plasmid
Main agents
Restriction enzyme
xhoi,
xbai,
blni, T
4dNA ligase, Ex Taq enzyme, DNA Marker DL15 000, DNA Marker DL2 000, DNA gel reclaim test kit, plasmid DNA prepares test kit fast, yeast genome extracts test kit and is TaKaRa Products; Zeocin microbiotic is Invitrogen Products; Peptone, D-Glucose, YNB(are without total free aminoacids Yeast Nitrogen base), sorbyl alcohol, vitamin H, Histidine etc. are Shanghai biotechnology Reagent Company product.Tris, Tricine, SDS, ammonium persulphate, β-mercaptoethanol, TEMED are Sigma Products; Albumen Marker(116.0,66.2,45.0,35.0,25.0,18.4,14.4 kD) be Fermentas(MBI) Products; BM 201 type low molecular weight protein Marker(66 000,45 000,35 000,27 000,20 000,14 400,9 500,6 500,4 100 Da) be U.S. BBI Products; MH substratum (Mueller hinton agar) is Britain Oxoid Products.
Key instrument
The multi-functional cell electroporation instrument of ECM 830 type, BTX company of the U.S.; Allegra 6R refrigerated centrifuge, Beckman company of the U.S.; SW-CJ-1F clean work station, Suzhou Lan Lin treating plant company limited; TGL-16G shaking culture case, Harbin Donglian Electronic & Technology Development Co., Ltd.; Mini-PROTEAN Tetra MP4 type electrophoresis chamber, Powerpac Basic164-5050 type electrophoresis apparatus, Bio-Rad company; The multi-functional microplate reader of M200 type, German QIAGEN company; DYY-III type sds polyacrylamide gel electrophoresis Vertial electrophorestic tank, Liuyi Instruments Plant, Beijing; PYX-DHS type constant incubator, Shanghai City leap medical apparatus and instruments factory; HZQ type constant temperature air bath oscillator, Harbin Donglian Electronic & Technology Development Co., Ltd.; MDF-290A type-80 DEG C of very low temperature refrigerator-freezers, SANYO company; 4 DEG C of cold storage refrigerators ,-20 DEG C of freezing freezers, company of Haier
; CS-9 000 type thin layer chromatography scanner, Japanese Shimadzu; Counter Mat Flash type full-automatic bacteria falls Image analysis system, IUL company of Spain; Program temperature reduction box: Nalgene company of the U.S..
Preparation of reagents
(1) low salt LB medium: take Trypsin old (Tryptone) 1 g, yeast extract (Yeast extract) 0.5 g, NaCl 0.5 g, is dissolved in the deionized water of 80 mL, abundant stirring and dissolving.Drip 5N NaOH adjust ph to 7.4, add deionized water and substratum is settled to 100 mL, autoclaving is for subsequent use.Solid medium adds the agar powder of 1.5 g again.Containing Zeocin
+substratum final concentration be 100 μ g/mL, 4 DEG C of preservations, validity period one to two week.
(3) microbiotic Zeocin: be 100 mg/mL stock concentration during purchase, working concentration 100 μ g/mL ,-20 DEG C keep in Dark Place.
(4) YPD(Yeast extract Peptone Dextrose Medium): weighing 10g Yeast extract and 20 g Peptone is dissolved in 900 mL water and (adds 20 g Agar when preparing solid medium again), autoclaving, 100 mL 10 × D are added, 4 DEG C of preservations after being cooled to room temperature.
(5) 500 × B(Biotin): in 100 mL water, dissolve 20 mg Biotin and filtration sterilization, preserve at 4 DEG C.
(6) 10 × D(Dextrose): be dissolved in by 20 g D-glucose in 100 mL deionized waters, autoclaving, preserves under room temperature.
(7) MH substratum (Mueller-Hinton agar): take this product 42.0 g, heating for dissolving in 1 000 mL distilled water, 121 DEG C of autoclaving 15 min.
Primer synthesizes
According to
tachyplesinsthe sequencing result design primer TP I-NNX1 and TP I-NNX2 of gene, containing following restriction enzyme site.
Upstream primer TP I-NNX1:5 '-CCG
c|TCGAGaAAAGAAAATGGTGCTTCCGTGTTTG-3 '
Xho I
Downstream primer TP I-NCX2:5 '-GC
t|CTAGAtTAACGGCAACGACGGTAGCAG-3 '
Xba I
According to pGAPZ α service manual synthesis universal primer:
Upstream primer 5 ' pGAP:5 '-GACTGGTTCCAATTGACAAGC-3 '
Downstream primer 3 ' AOX1:5 '-GCAAATGGCATTCTGACATCC-3 '
Primer is synthesized by Shanghai Sheng Gong biotechnology service company.TP I-NNX1 and TP I-NNX2 theoretical amplification clip size are 66 bp, TP I-NNX1 and 3 ' AOX1 theoretical amplification clip size be 230 bp, TP I-NCX2 and 5 ' pGAP theoretical amplification clip size is 376 bp.
Method
The Construction and identification of expression vector pGAPZ α-TP I
Double digestion is carried out to the cloned plasmids pMD-18T-TP I of TP I gene and Yeast expression carrier pGAPZ α A, reclaims enzyme and cut object fragment, use T
4dNA ligase connects, and connects product conversion bacillus coli DH 5 alpha, and screening positive transformant, extracts plasmid, carries out PCR and double digestion qualification, and checks order.The recombinant plasmid pGAPZ α A-TP I collection of illustrative plates built is as Fig. 2.
Carrier double digestion
PMD-18T-TP I plasmid and Yeast expression carrier pGAPZ α A are used
xhoi and
xbai double digestion, is undertaken by process specifications, and 37 DEG C of enzymes cut 3 h, and reaction system is as shown in table 2 below.
Table 2 double digestion reaction system
Get 10 μ L and carry out 2.5 % agarose gel electrophoresis, gel imaging system is taken pictures.
The recovery of digestion products
Digestion products is cut after 2 % agarose gel electrophoresis glue to reclaim, concrete operations are reclaimed test kit working instructions by DNA gel and are carried out.
The connection of carrier and object fragment
In centrifuge tube, add following component, 4 DEG C of connections are spent the night.Linked system is as follows:
Table 3 ligation system
Connect the conversion of product
Above-mentioned 10 μ L connect product, transform TOP10 competent cell.Get 100 μ L transformed competence colibacillus cells and be applied to Zeocin
+on less salt LB flat board, overnight incubation in 37 DEG C of incubators.Choose single colony inoculation in containing Zeocin
+less salt LB liquid nutrient medium in, 37 DEG C of gas bath shaking table overnight incubation.
Plasmid extraction
Extract with DNA plasmid extraction kit, operation by specification carries out.
The qualification of expression vector pGAPZ α A-TP I
(1) the PCR qualification of recombinant plasmid
Reaction system is as follows:
Table 4 PCR reaction system
PCR reaction conditions: 94 DEG C of denaturation 5 min, 1 circulation; 94 DEG C of denaturation 40s, 51 DEG C of annealing 40s, 72 DEG C extend 40s, react 30 circulations; 72 DEG C extend 10min, 4 DEG C of 5min.Get 10 μ L and carry out 1% agarose gel electrophoresis, gel imaging system is taken pictures.
(2) enzyme of recombinant plasmid cuts qualification
Recombinant plasmid pGAPZ α-TP I uses
xhoi and
xbaafter I double digestion, theoretical fragment size is that 3 066 bp and 66 bp, recombinant plasmid pGAPZ α-TP I uses
xhoi and
bamhafter I double digestion, theoretical fragment size is 2 666 bp and 466 bp, is undertaken by process specifications, the same 1.2.1.1 of reaction system, and 37 DEG C of enzymes cut 3 hours, and get 10 μ L and carry out 2.5 % agarose gel electrophoresis, gel imaging system is taken pictures.
(3) goal gene order-checking and sequential analysis in recombinant plasmid
Positive recombinant plasmid send TaKaRa company to check order.Sequential analysis adopts the softwares such as DNAstar, GenBank Blast to carry out sequence homology analysis.
Recombination yeast transforms and screening
Adopt yeast electrotransformation, concrete operations are as follows:
The preparation of competent yeast cells
Picking one pichia pastoris X-33 list bacterium colony from YPD flat board, be inoculated in 10 mL YPD liquid nutrient mediums, 30 DEG C, 250 r/min shaking culture are spent the night; Get 1 mL to be inoculated in 200 mL YPD substratum, 30 DEG C, 250 r/min, shaking culture is to OD
600be 1.1 ~ 1.5; 3 000 r/min collected by centrifugation thalline, with the sorbyl alcohol of deionized water and 1 M respectively from washing twice; Add the resuspended thalline of sorbyl alcohol of 1 M of 1 mL precooling, this is competent yeast cells, transforms for next step.
Recombinant plasmid linearizing
Reference
pichia pastorisexpression Kit handbook carries out, and it is as shown in table 5 that enzyme cuts system.
Table 5 endonuclease reaction system
37 DEG C of water-bath enzymes cut through night, get 1 μ L and carry out 1% agarose gel electrophoresis, detect linearizing whether completely; Add the 3M NaAc(pH 5.2 of the dehydrated alcohol of 2 times of volumes, 1/10 volume) solution, mixing;-20 DEG C of precipitates overnight; In 4 DEG C, centrifugal 10 min of 12 000 r/min; Abandon supernatant, add the centrifugal 10 min washing precipitations of 70% ethanol 12 000 r/min of 500 μ L precoolings, abandon supernatant, air-dry in super clean bench; 10 μ L TE(pH8.0) dissolving DNA ,-20 DEG C of preservations, for subsequent use.
Electricity transforms
The using method of electricity conversion instrument is with reference to the electroporated instrument specification sheets of ECM 830 type, under condition of ice bath, the linearizing recombinant plasmid of 10 μ L is joined in 100 μ L X-33 competent yeast cells, bottom the electric shock cup after mixing mixture being added 2 mm gently, put into electric shock tank electroporated.The parameter setting of the multi-functional cell electroporation instrument of ECM 830 is: voltage 1 500 V, resistance 200 Ω, electric capacity 25 μ f, electric shock time 10 ms; Add the sorbyl alcohol of 1 mL 1 M ice precooling after transforming in electric shock cup, mixing, takes out 200 μ L and is applied to YPD Zeocin
+(100 μ g/mL) dull and stereotyped 30 DEG C cultivates 2 d to growing bacterium colony.
Restructuring yeast strains PCR identifies
From flat board picking list bacterium colony in test tube (containing Zeocin
+yPD substratum) in shake 2 days; Getting bacterium liquid 1 mL adds in Eppendof pipe, centrifugal 4 min of 9 000 r/min room temperature, collects thalline; Extract test kit with TaKaRa company yeast genome and extract genomic dna, specification sheets is shown in concrete operations, 50 μ L TE(pH8.0) dissolving DNA ,-20 DEG C of preservations, for subsequent use.PCR identification reaction system and the same 1.2.1.6 of reaction conditions, get 10 μ L and carry out 2 % agarose gel electrophoresis, gel imaging system is taken pictures.Identify correct positive restructuring yeast strains called after X33-GAP-TP I.
The preservation of recombination yeast bacterial classification
(1) vacuum lyophilization preservation method
10% fresh skimmed milk is protective material ,-80 DEG C of pre-freeze 1 h, starts Freeze Drying Equipment, after temperature drops to-40 DEG C, adds sample, starts vacuum pump, until vacuum values be down to stablize constant after, close the sample mouth of pipe, close Freeze Drying Equipment, take out sample-80 DEG C of Refrigerator stores.
(2) Liquid nitrogen method
Cell suspension is prepared as protective material with glycerine or DMSO (DMSO); be distributed into sterile ampoule bottle; often pipe 0.2 mL; service routine cooling box pre-freeze under control temperature fall off rate is the condition of 1 DEG C/min, to-40 DEG C, is then put into liquified nitrogen biology hold tank (-150 DEG C) immediately and is preserved.
The shake flask fermentation of recombination microzyme X33-GAP-TP I
From the YPD Zeocin transformed
+picking list bacterium colony on flat board, is inoculated into 10 mL YPD Zeocin
+in (100 μ g/ μ L) substratum, 28 ~ 30 DEG C, 250 r/min, shaking culture is to OD
600be 2; Draw 0.1 mL bacterium liquid in 50 mL YPD substratum, continue cultivation 4 about d.Get supernatant, analyze TP I expression by Tricine-Glycerol-SDS-PAGE and bacteriostatic experiment, screening efficient expression strain.
The electrophoresis detection of tunning
The process of tunning
Collect centrifugal 10 min of fermented liquid 12 000 r/min, get supernatant-20 DEG C for subsequent use.
The Tricine-Glycerol-SDS-PAGE of tunning detects
(1) preparation of gel
The configuration of Tricine-Glycerol-SDS-PAGE gel is undertaken by table 6 system.
Table 6 Tricine-Glycerol-SDS-PAGE glue is filled a prescription
2) preparation of electrophoretic buffer
Anode buffer liquid: 0.2 mol/L Tris, pH 8.9;
Cathode buffer: 0.1 mol/L Tris, 0.1 mol/L Tricine, 0.1% SDS, pH 8.25.
(3) preparation of sample
Get tunning, centrifugal 5 min separating thallus and the supernatants of 8 000 r/min, get fermented supernatant fluid and thalline 200 μ L respectively, add 2 × loading buffer of equivalent, centrifugal 5 min of boiling water boiling 8 min, 8 000 r/min after mixing, get 10 μ L supernatant loadings.
(4) electrophoresis
Deposition condition: concentrated glue, constant voltage 8 V/cm, constant current 12 mA/ plate; Squeegee and separation gel, constant voltage 15 V/cm, constant current 18-20 mA/ plate, if current/voltage sharply changes show that electrophoresis state is abnormal.
(5) dyeing and decolouring
The staining fluid that gel is placed in 0.25 % coomassie brilliant blue R250 sways 2 h, then uses the ethanol decolorization of 50% clear to band.
(6) thin layer scanning and integral and calculating are carried out to SDS-PAGE gel.
Fermented liquid Antibacterial Activity
Get the intestinal bacteria on MH agar plate, the single bacterium colony of streptococcus aureus respectively, after Zengjing Granule, adjust bacterial concentration A
600about 0.5 is equivalent to 1 × 10
8cFU/mL, dilutes with the MH agar 1:10 dissolving, be cooled to 45 DEG C in advance, and directly make dull and stereotyped of this bacteria suspension, every plate thickness is about about 5 mm.With the punching of aseptic metal punch tool (diameter is 6 mm) after culture medium solidifying, hole between centers is not less than 24 mm, agar in removing hole.Add the expression supernatant that 50 μ L are to be detected in every hole, be placed in 37 DEG C of incubators cultivate 16 ~ 24 h after (incubation time is different because bacterial species is different), measure antibacterial circle diameter with the full-automatic bacteria Image analysis system that falls, express the bacteriostatic activity of supernatant with secondary indication.Often group experiment repetition 3 times, averages as net result.
The qualification of recombinant plasmid pGAPZ α A-TP I
Carry out PCR qualification to recombinant plasmid pGAPZ α A-TP I primer TP I-NNX1 and TP I-NNX2, theoretical amplification clip size is 66 bp, and result, as shown in Fig. 3 swimming lane 2, occurs specific amplification fragment near object band.Recombinant plasmid pGAP-TP I is used
xhoi and
xbai double digestion is identified, theoretical fragment size is 3 066 bp and 66 bp, and result, as shown in Fig. 3 swimming lane 3, occurs specific fragment near object band.
Recombinant plasmid pGAPZ α A-TP I is used
xhoi and
bamhi double digestion is identified, theoretical fragment size is that 2 666 bp and 466 bp, pGAPZ α A empty vector control should be 2 663 bp and 417 bp, and result, as shown in Fig. 4 swimming lane 2 ~ 6, occurs specific fragment near object band.
Sequencing results
PGAPZ α A-TP I plasmid sequencing result as shown in Figure 5, sequencing result carries out sequence homology analysis through DNAstar, GenBank Blast software and shows, TP I gene base is not undergone mutation, and whole expression vector reading frame is correct, with desired design congruence.
The PCR qualification of restructuring yeast strains X33-GAP-TP I
The mutation efficiency of yeast is higher, therefore Zeocin
+the bacterial strain screened also needs further checking.The expression vector that this institute selects belongs to integrative plasmid, can not copy voluntarily in yeast, but is incorporated in yeast chromosomal by homologous recombination, 2-3 d is cultivated after transforming, extract DNA, utilize PCR identify conversion bacterial strain and screen, result is as shown in Fig. 6, Fig. 7 and Fig. 8.
The secreting, expressing of recombinant bacterial strain X33-GAP-TP I
By the upper cleer and peaceful thalline of the shake flask fermentation liquid of fermentation 4 d, carry out Tricine-Glycerol-SDS-PAGE electrophoresis simultaneously.Result as shown in Figure 9, from running gel, the supernatant of some bacterial strain fermentation liquors is having a band (2,4,7 swimming lanes of Fig. 9) much smaller than 14.4 kD places, about conform to Theoretical Calculation protein band size, then there is not protein band (1,3,6 swimming lanes of Fig. 9) in corresponding thalline sample, illustrates that TP I gene obtains expression.In Fig. 9, swimming lane 5 is Fermentas(MBI) albumen Marker(116.0,66.2,45.0,35.0,25.0,18.4,14.4 kD).
The activity identification of tunning
Get the fermentation 4 d shake flask fermentation liquid supernatant of band of expression, with punch method on MH agar plate, with streptococcus aureus (ATCC 25923) and intestinal bacteria (ATCC 25922) for tested bacterium, detection bacteriostatic activity, result as shown in Figure 10.In figure, A is the bacteriostatic activity detected result of fermented liquid supernatant to the tested bacterium of two strains, and 100 μ L fermented liquid supernatant are 24 mm to the antibacterial circle diameter of streptococcus aureus, be 16 mm, show stronger bacteriostatic activity to colibacillary antibacterial circle diameter.In figure, B is the Tricine-Glycerol-SDS-PAGE electrophoresis result of this strain bacterium shake flask fermentation 4 d fermented liquid supernatant, the molecular weight of its expression product is substantially identical with calculated value 2.2 kD as seen from the figure, and in figure, swimming lane 2 is BBI(BM 201) low range protein matter molecular weight standard (66 000,45 000,35 000,27 000,20 000,14 400,9 500,6 500,4 100 Da).
<110> Jilin University
<120> China tachyplesin constitutive yeast expression vector and preparation method thereof
<140> 201210051429.4
<141> 2012.03.01
<210> 1
<400> 1
CCGCTCGAGAAAAGAAAATGGTGCTTCCGTGTTTG
<210> 2
<400> 1
GCTCTAGATTAACGGCAACGACGGTAGCAG
<210> 3
<400> 1
GACTGGTTCCAATTGACAAGC
<210> 4
<400> 1
GCAAATGGCATTCTGACATCC
Claims (2)
1. a preparation method for China tachyplesin constitutive yeast expression vector, is characterized in that: according to the sequencing result design primer TP I-NNX1 and TP I-NNX2 of tachyplesins gene, containing following restriction enzyme site:
Upstream primer TP I-NNX1:5 '-CCG
c|TCGAGaAAAGAAAATGGTGCTTCCGTGTTTG-3 '
Xho I
Downstream primer TP I-NCX2:5 '-GC
t|CTAGAtTAACGGCAACGACGGTAGCAG-3 '
Xba I
According to pGAPZ α service manual synthesis universal primer:
Upstream primer 5 ' pGAP:5 '-GACTGGTTCCAATTGACAAGC-3 '
Downstream primer 3 ' AOX1:5 '-GCAAATGGCATTCTGACATCC-3 '
Double digestion is carried out to the cloned plasmids pMD-18T-TP I of TP I gene and Yeast expression carrier pGAPZ α A, reclaims enzyme and cut object fragment, use T
4dNA ligase connects, and connects product conversion bacillus coli DH 5 alpha, and screening positive transformant, extracts plasmid, carries out PCR and double digestion qualification, and checks order.
2. the China tachyplesin constitutive yeast expression vector pGAPZ α A-TPI obtained by the method for claim 1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210051429.4A CN103233035B (en) | 2012-03-01 | 2012-03-01 | China tachyplesin constitutive yeast expression vector and preparation method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210051429.4A CN103233035B (en) | 2012-03-01 | 2012-03-01 | China tachyplesin constitutive yeast expression vector and preparation method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103233035A CN103233035A (en) | 2013-08-07 |
CN103233035B true CN103233035B (en) | 2015-01-14 |
Family
ID=48881101
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201210051429.4A Active CN103233035B (en) | 2012-03-01 | 2012-03-01 | China tachyplesin constitutive yeast expression vector and preparation method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103233035B (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110628917B (en) * | 2019-09-27 | 2022-06-14 | 北部湾大学 | Chinese horseshoe crab SSR primer group and application thereof |
CN116640225A (en) * | 2022-10-08 | 2023-08-25 | 科赫生物科技(北京)有限公司 | Limulus blood coagulation factor combination, reaction system, kit and application thereof |
CN116640710A (en) * | 2022-10-08 | 2023-08-25 | 科赫生物科技(北京)有限公司 | Strain for producing horseshoe crab coagulation factor FG beta', preparation method and application |
-
2012
- 2012-03-01 CN CN201210051429.4A patent/CN103233035B/en active Active
Non-Patent Citations (3)
Title |
---|
抗菌肽的研究进展;祝骥等;《生命科学》;20080831;第20卷(第4期);第606页第1.2节,第608页第3.2节 * |
蝉抗菌肽基因密码子优化及其毕赤酵母表达载体构建;刘德辉等;《中国畜牧兽医》;20091231;第36卷(第10期);第1.1-1.3、1.5节 * |
郑伟等.中国鲎(tachypleus tridentatus)基因工程抗菌肽的制备及其抗菌活性.《中国兽医学报》.2007,第27卷(第2期), * |
Also Published As
Publication number | Publication date |
---|---|
CN103233035A (en) | 2013-08-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN110157654B (en) | Bacillus natto recombinant strain and construction method and application thereof | |
CN103045636A (en) | Method for efficiently expressing antibacterial peptide NZ2114 in recombinant pichia pastoris | |
CN113512550B (en) | Tea tree CsHAC1 gene and protein and application thereof | |
CN106967660A (en) | A kind of genetic engineering bacterium for producing Resuscitation-promoting Factor and its application | |
CN103233035B (en) | China tachyplesin constitutive yeast expression vector and preparation method thereof | |
CN104788568A (en) | Pichia pastoris genetic engineering hybrid antibacterial peptide CC29 and preparing method thereof | |
CN101845454B (en) | Method for expressing pseudoplectania nigrella mature peptide in recombinant pichia pastoris | |
CN112574980B (en) | Recombinant alginate lyase with thermal stability and high enzyme activity and application thereof | |
CN102604899B (en) | Genetic engineering bacteria containing L-alanine racemase genes and application of genetic engineering bacteria | |
CN107937296A (en) | One kind has acetic acid furfural vanillic aldehyde tolerance recombinant Saccharomyces cerevisiae and preparation method, application | |
CN110846294B (en) | Recombinant pectinase, gene thereof, recombinant vector, preparation method and application | |
CN102020712A (en) | Human-like collagen for vaccine stabilizing agent and production method thereof | |
CN100347287C (en) | Recombinated multi shape ttansenula yeast, its structural method and application | |
CN109134662A (en) | A kind of visualization antibacterial peptide fusion protein and preparation method thereof and its application | |
CN102559730A (en) | Method for increasing expression of CP4-EPSPS in Hansenula polymorpha | |
CN110029081B (en) | Engineering bacterium for over-expressing carbon catabolite repression effect transcription inhibitor gene and construction method thereof | |
CN112028981B (en) | Recombinant white high-foot spider toxin polypeptide and preparation method thereof | |
CN102080079B (en) | Preparation method and application of novel antimicrobial peptide Misgurin mutant | |
CN103966110A (en) | Penicillium oxalicum host strain for enhancing expression of filamentous fungi protein | |
CN109628366B (en) | Method for improving acid stress resistance of lactic acid bacteria | |
CN102898512A (en) | Recombinant plectasin as well as preparation method and application of recombinant plectasin | |
CN102827860A (en) | Construction method for double-gene mutation escherichia coli used for secretory expression of recombinant protein | |
CN105753958A (en) | Novel moronecidin mutant, and preparation method and application thereof | |
CN110527690A (en) | A kind of heat resistant type tannase and its application | |
CN110423784A (en) | A kind of method for transformation for bacillus amyloliquefaciens |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
TR01 | Transfer of patent right |
Effective date of registration: 20221129 Address after: Room 409, Building 1, No. 3388 Baocheng Road, China South Korea (Changchun) International Cooperation Demonstration Zone, Changchun, 130000 Jilin Province Patentee after: Jilin Jiaqi Medical Technology Co.,Ltd. Address before: 130062 No. 5333, Xi'an Road, Changchun, Jilin Patentee before: Jilin University |
|
TR01 | Transfer of patent right |