CN102020712A - Human-like collagen for vaccine stabilizing agent and production method thereof - Google Patents

Abstract

The invention relates to a human-like collagen for a vaccine stabilizing agent and a production method thereof, and belongs to the technical field of the vaccine stabilizing agents. The human-like collagen is obtained by fermenting yeast engineering bacteria which are named pichia pastoris X-33/col CGMCC NO.4187. The production method comprises the following steps of: artificially synthesizing human-like collagen genes; building and screening the yeast engineering bacteria containing the human-like collagen genes; inducing and culturing the engineering bacteria by shaking a flask; and detecting the target human-like collagen by using SDS-PAGE (Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis). The human-like collagen has the advantages that the human-like collagen produced by utilizing the yeast genetic engineering bacteria not only has favorable biological characteristics, but also has the good properties of no virus hidden danger, low rejection reaction and the like compared with the product derived from animals, so the purified human-like collagen can be applied to the vaccine stabilizing agent in stead of the collagen derived from the animals.

Description

A kind of Human-like Collagen and production method thereof that can be used for the vaccine stablizer

Technical field

The invention belongs to vaccine stablizer technical field, particularly relate to a kind of Human-like Collagen and production method thereof that can be used for the vaccine stablizer, utilize genetic engineering technique to transform yeast and produce Human-like Collagen.

Background technology

Collagen protein claims collagen again, is the spirality fiber shape protein that is twisted into by three peptide chains, and this proteinoid is the maximum protein of people's in-vivo content.The amino acid of collagen protein is formed following feature: 1., glycine (glycine) is about 25～30%, every two other amino-acid residues (X Y) promptly has a glycine, its peptide chain can with (sweet-X-Y) n represents.2., proline(Pro) (Proline) about 12% in the collagen, oxyproline (hydroxyproline, Hyp) about 10%, hydroxyproline content is few in the general animal protein, L-Ala (alanine) has 11% in addition, hydroxylysine (hydroxylysine) about 0.5%.3., lack tryptophane in the collagen, so it nutritionally is an incomplete protein.

Because collagen protein has characteristics such as nonantigenic, biodegradable, easy absorption, nontoxic and physiologically acceptable, therefore enjoy favor in the medical material field, be widely used in operating sutures, styptic sponge, artificial skin, artificial blood vessel, artificial cornea, pharmaceutical carrier, aspects such as vaccine stablizer.

A lot of vaccines are very responsive to the condition of the preparation and the process of preservation, especially attenuated live vaccine.In order to protect the integrity of biotic component, in the vaccine production process, add stablizer usually to guarantee the immunization effect.All the time, can comprise sugar, alkali metal phosphate, glutaminate, ox or human serum albumin, casein hydrolysate etc., topmost gelatin in addition as the material of vaccine stablizer.Gelatin (Gelatin) is the hydrolysate of collagen, is a kind of fat free high protein, does not contain cholesterol, be the stable good selection of protection vaccine, but it mainly extracts acquisition from animal skin.

Because there is viral hidden danger in the collagen protein of animal-origin and easily causes the human body rejection, therefore adopting Protocols in Molecular Biology to prepare recombinant human collagen albumen has the incomparable advantage of various traditional extraction process.At present, the host who utilizes genetic engineering technique to express collagen protein of report has microorganism (intestinal bacteria and yeast), insect, mammalian cell etc. both at home and abroad.Because intestinal bacteria are easily cultivated, breeding is fast, and the example of existing a lot of transgenosis medicine successful expression has now become the carrier that people's preferred genes is expressed.Yet for Human-like Collagen, there is fatal defective in intestinal bacteria, and promptly escherichia expression system can't carry out modifying behind the protein translation, so can't form the collagen protein of higher structure.Insect and mammalian cell all are in laboratory level at present, though the recombined collagen that both express more approaches human collagen albumen on structure function, and its cost height, the production cycle has all been hindered their development again than defectives such as length.Yeast is an eukaryote; the enzyme that possesses molecular chaperone protein and glycosylation, hydroxylation, ethanoylization; can after synthetic, carry out certain modification to some albumen with higher structure; and the culture condition of yeast cell; cost is also much lower than mammalian cell, is fit to very much suitability for industrialized production.

Summary of the invention

The object of the present invention is to provide a kind of Human-like Collagen and production method thereof that can be used for the vaccine stablizer, the Yeast engineering bacterium strain that a strain is new, it can utilize the synthetic human-like collagen gene to express the Human-like Collagen of small molecular weight.

This Yeast engineering bacteria called after pichia spp (Pichia sP.), numbering CGMCC No.4187.In the common micro-organisms center preservation of China Committee for Culture Collection of Microorganisms of specified depositary institution of State Intellectual Property Office, deposit number is CGMCC No.4187 to this bacterial classification, the preservation time: on September 20th, 2010.

For achieving the above object, the technical solution adopted in the present invention is:

1. synthetic human-like collagen gene col, its base sequence is as follows

GAAGCTGGTTTGCCTGGTGCTAAGGGTCTGACTGGTTCTCCTGGTTCTCCCGGACCCGATGGTAAGACTGGACC

CCCAGGACCAGCTGGTCAAGATGGACGTCCTGGACCTCCAGGCCCTCCAGGGGCCCGAGGCCAAGCAGGTGTTA

TGGGGTTTCCTGGACCAAAGGGAGCAGCCGGCGAGCCAGGTAAAGCCGGCGAAAGGGGTGTCCCAGGACCACCA

GGTGCTGTGGGACCAGCCGGCAAAGACGGTGAGGCAGGTGCTCAGGGTCCACCAGGACCTGCTGGTCCTGCTGG

AGAAAGATAA

Its length nucleic acid is 306bp.

2. the production method of described Human-like Collagen is as follows:

(1) construction process of described Yeast engineering bacteria

1. according to known its gene order of collagen, amino acid sequence synthetic, carry out the modification of yeast codon preference then, finally obtain synthetic human-like collagen gene col.

2. again synthetic human-like collagen gene col is cloned into Yeast expression carrier pPICZ α, called after pPICZ α/col;

3. utilize electric shock transformation method that recombinant plasmid pPICZ alpha/col is converted into yeast cell X-33.

4. utilize the correct yeast transformant of method screening of PCR and order-checking at last.

(2) described Yeast engineering bacteria shake a bottle inducing culture:

1. the composition of solid medium (YEPD) and every liter of content thereof are: peptone 20 grams, yeast powder 10 grams, glucose 20 grams, agar powder 15 grams.

2. solid culture condition: Yeast engineering bacteria is inoculated in the culture dish of above-mentioned solid medium, cultivated 3-5 days in 20 ℃-50 ℃.

3. the composition of seed culture medium and every liter of content thereof are: peptone 20 grams, yeast powder 10 grams, yeast choline YNB13.4 gram, 10 milliliters of glycerine, 0.1 mole of potassium phosphate buffer, 0.4 milligram of vitamin H.

4. seed liquor culture condition: get an amount of thalline with the aseptic inoculation ring from above-mentioned culture dish, be inoculated in the sterilized above-mentioned seed culture medium, 20 ℃-50 ℃, the 220rpm shaking table was cultivated 12-24 hour.

5. the composition of shake flask fermentation substratum and every liter of content thereof are: peptone 20 grams, yeast powder 10 grams, yeast choline YNB13.4 gram, 10 milliliters of methyl alcohol, 0.1 mole of potassium phosphate buffer, 0.4 milligram of vitamin H.

6. shake flask fermentation culture condition: after the seed liquor of results Yeast engineering bacteria, centrifugal collection thalline, through the fermention medium lotion, according to volume ratio 1%-30% inoculum size Yeast engineering bacteria is inoculated in the above-mentioned shake flask fermentation substratum, 20 ℃-50 ℃, 100rpm-300rpm, during need the regular replenishment methanol induction keep the concentration that volume ratio is 0.5%-5%, shaking table was cultivated 1-10 days.

(3) described Human-like Collagen slightly mention checking:

The Yeast engineering bacteria fermentation ends, centrifugal collection fermented supernatant fluid adds ammonium sulfate that mass percent is 60%-100% or sodium sulfate or sodium-chlor then and precipitates concentratedly, and last centrifugal collecting precipitation obtains the Human-like Collagen crude product; Be the SDS-PAGE gel detection of 5% concentrated glue and 10%-20% separation gel again through mass percent.

Innovative point of the present invention has been to obtain a synthetic human-like collagen gene that is applicable to yeast expression system, one strain can be expressed the Yeast engineering bacteria of small molecular weight Human-like Collagen, and the alternative gelatin of the Human-like Collagen of the small molecular weight of expression is used for the vaccine stablizer.

The invention has the advantages that, utilize the Human-like Collagen of yeast gene engineering bacteria production not only to have good biological characteristics, and compare with the product of animal-origin have virus-free hidden danger, good characteristic such as low rejection, so the purified collagen protein of alternative animal-origin afterwards is applied to the vaccine stablizer.

Culture presevation information:

Title: pichia spp (Pichia sP.), numbering CGMCC No.4187;

Depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center;

Deposit number: CGMCC No.4187;

The preservation time: on September 20th, 2010.

Embodiment

The structure of embodiment 1 expression vector

Synthetic external source fragment obtains with the form that is connected on the plasmid pUC57, this plasmid and carrier for expression of eukaryon pPICZ α are carried out double digestion with EcoRI and two kinds of enzymes of XbaI simultaneously, reclaim the synthetic human-like collagen gene (referring to Fig. 1) and the linearizing carrier pPICZ α of 300bp size then.

Utilize the T4DNA ligase enzyme that above-mentioned two fragments are connected, promptly be configured to expression vector pPICZ α/col.Then linked system is converted into competent escherichia coli cell, utilize Sac I single endonuclease digestion method to verify 14 clone institute upgrading grains, because of only containing 1 Sac I restriction enzyme site on the correct plasmid, so cutting, enzyme finishes the positive result who plasmid linearization occurs, referring to Fig. 2.And will screen 11 of acquisition ^#, 12 ^#, 14 ^#Three plasmids are sent to further sequence verification, and final comparison result shows 12 ^#With 14 ^#Plasmid contains correct, complete synthetic human-like collagen gene.

The structure of embodiment 2 Yeast engineering bacterias

1. the linearizing of plasmid

Expression vector pPICZ α/col needs to transform pichia spp X-33 competence after the linearizing, and this purpose is in order to obtain higher transformation efficiency.In this experiment, the expression vector after the linearizing reclaims gained by Sac I digestion back.

2. the yeast cell electricity changes competent preparation

(1) in containing the 50ml centrifuge tube of 5mlYPD, cultivate pichia spp, 30 ℃ are spent the night.

(2) get the 0.5ml overnight culture, the 2L that inoculation contains the 500ml fresh culture shakes bottle, and overnight growth is to 0D6001.5.

(3) at 4 ℃, the centrifugal 5min collecting cell of 1500g is with the aqua sterilisa suspension cell of 500ml precooling.

(4) as above centrifugal, with the aqua sterilisa suspension cell of 250ml precooling.

(5) as above centrifugal, with the 1M sorbyl alcohol suspension cell of 20ml precooling.

(6) as above centrifugal, with the 1M sorbyl alcohol suspension cell of 1ml precooling, to the about 1.5ml of final volume.

3. transform:

(1) gets the above-mentioned cell of 80ul and mix, change in the 0.2cm electricity revolving cup of precooling with the linearizing expression vector pPICZ of 15ug α/col (being dissolved in 5ulTE).

(2) place 10min on ice.

(3) adjust the electroporation apparatus parameter: voltage 1.5KV; Electric capacity 25 μ F; Resistance 200 Ω.The electric shock sample, the electric shock time is 4.6msec.

(4) the 1M sorbyl alcohol that adds the 1ml precooling immediately is transferred to content in the centrifuge tube of 1.5ml to cup.30 ℃ of incubators were placed 2 hours.

(5) be divided into the 200ul equal portions, be applied on the YEPD solid medium flat board that contains bleomycin.

(6) hatching dull and stereotyped extremely clone at 30 ℃ produces.

The screening of embodiment 3 recombination yeast engineering bacterias:

1. bacterium colony PCR checking:

Grow mono-clonal on the YEPD flat board to be transformed,, be template amplification purpose fragment with the yeast genes group again and send to order-checking through colony polymerase chain reaction (PCR) method primary dcreening operation positive colony.The final positive colony that has finally obtained 9 Yeast engineering bacterias from more than 200 transformants is referring to Fig. 3.

2. shake flask fermentation checking:

The positive colony of above-mentioned Yeast engineering bacteria also needs further to verify by the shake flask fermentation experiment expression of Human-like Collagen.Pichia spp X-33 increases the volume fermentation, utilize seed culture medium to cultivate seed earlier, it is to continue in the shake flask fermentation substratum of carbon source to cultivate that centrifugal then collection thalline is forwarded to methyl alcohol, adding volume ratio every 12 hours and be 0.5% methyl alcohol induces, fermentation to 96 hour end, collecting supernatant liquor, is 60% ammonium sulfate precipitation precipitation acquisition final sample through mass percent.Be the SDS-PAGE detected through gel electrophoresis Human-like Collagen of 5% concentrated glue and 15% separation gel with mass percent at last, referring to Fig. 4.Compare 3 with contrast (the yeast X-33 bacterial strain that contains blank expression vector pPICZ α) ^#Bacterial strain has band of expression at expection albumen size place (about 12.8KD).Mass percent is that the prescription of 5% concentrated glue and 15% separation gel is as shown in table 1:

Table 1:SDS-PAGE gel formula

Annotate: percentage sign is mass percent in the table.

Claims (3)

1. a Human-like Collagen that can be used for the vaccine stablizer is characterized in that, obtains this Yeast engineering bacteria called after pichia spp (Pichia Pastoris) X-33/col CGMCCNo.4187 by the Yeast engineering bacteria fermentation.

2. the described Yeast engineering bacteria of claim 1 is characterized in that, integrates a kind of human-like collagen gene col of synthetic on its karyomit(e), and its base sequence is as follows:

GAAGCTGGTTTGCCTGGTGCTAAGGGTCTGACTGGTTCTCCTGGTTCTCCCGGACCCGATGGTAAGACT

GGACCCCCAGGACCAGCTGGTCAAGATGGACGTCCTGGACCTCCAGGCCCTCCAGGGGCCCGAGGCCAA

GCAGGTGTTATGGGGTTTCCTGGACCAAAGGGAGCAGCCGGCGAGCCAGGTAAAGCCGGCGAAAGGGGT

GTCCCAGGACCACCAGGTGCTGTGGGACCAGCCGGCAAAGACGGTGAGGCAGGTGCTCAGGGTCCACCA

GGACCTGCTGGTCCTGCTGGAGAAAGATAA

Its length nucleic acid is 306bp.

3. the production method of claim 1 or 2 described Human-like Collagens is characterized in that,

(1) structure of Yeast engineering bacteria:

According to known collagen, amino acid sequence,, finally obtain synthetic human-like collagen gene col through the modification of yeast codon preference;

Again synthetic human-like collagen gene col is cloned into Yeast expression carrier pPICZ α, called after pPICZ α/col;

Utilize electric shock transformation method that recombinant plasmid pPICZ alpha/col is converted into yeast cell X-33;

Utilize the correct Yeast engineering bacteria of method screening of PCR and order-checking at last;

(2) Yeast engineering bacteria shake a bottle inducing culture:

The composition of solid medium YEPD and every liter of content thereof are: peptone 20 grams, yeast powder 10 grams, glucose 20 grams, agar powder 15 grams;

Solid culture condition: Yeast engineering bacteria is inoculated in the culture dish of above-mentioned solid medium, cultivated 3-5 days in 20 ℃-50 ℃;

The composition of seed culture medium and every liter of content thereof are: peptone 20 grams, yeast powder 10 grams, yeast choline YNB13.4 gram, 10 milliliters of glycerine, 0.1 mole of potassium phosphate buffer, 0.4 milligram of vitamin H;

The seed liquor culture condition: get an amount of thalline with the aseptic inoculation ring from above-mentioned culture dish, be inoculated in the sterilized above-mentioned seed culture medium, 20 ℃-50 ℃, the 220rpm shaking table was cultivated 12-24 hour;

The composition of shake flask fermentation substratum and every liter of content thereof are: peptone 20 grams, yeast powder 10 grams, yeast choline YNB13.4 gram, 10 milliliters of methyl alcohol, 0.1 mole of potassium phosphate buffer, 0.4 milligram of vitamin H;

Shake flask fermentation culture condition: after the seed liquor of results Yeast engineering bacteria, centrifugal collection thalline, through the fermention medium lotion, according to volume ratio 1%-30% inoculum size Yeast engineering bacteria is inoculated in the above-mentioned shake flask fermentation substratum, 20 ℃-50 ℃, 100rpm-300rpm, during need the regular replenishment methanol induction to keep the concentration of the 0.5%-5% of volume ratio, shaking table was cultivated 1-10 days;

(3) Human-like Collagen slightly mentions checking

The Yeast engineering bacteria fermentation ends, centrifugal collection fermented supernatant fluid adds ammonium sulfate that mass percent is 60%-100% or sodium sulfate or sodium-chlor then and precipitates concentratedly, and last centrifugal collecting precipitation obtains the Human-like Collagen crude product; Be the SDS-PAGE gel detection of 5% concentrated glue and 10%-20% separation gel again through mass percent.

Images