CN102246690A - Method for breeding all sterile line with genetic stability of rape recessive epistasis genic male sterile line by means of molecular marker - Google Patents
Method for breeding all sterile line with genetic stability of rape recessive epistasis genic male sterile line by means of molecular marker Download PDFInfo
- Publication number
- CN102246690A CN102246690A CN2010101771107A CN201010177110A CN102246690A CN 102246690 A CN102246690 A CN 102246690A CN 2010101771107 A CN2010101771107 A CN 2010101771107A CN 201010177110 A CN201010177110 A CN 201010177110A CN 102246690 A CN102246690 A CN 102246690A
- Authority
- CN
- China
- Prior art keywords
- line
- sterile
- strain
- generation
- transformation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention, belonging to the field of molecule breeding of rape, relates to a method for breeding an all sterile line with genetic stability of a rape recessive epistasis genic male sterile line by means of molecular marker. According to the invention, by the close link of molecular marker and fertility genes, the genotype of molecular mark is tracked and selected to select a program of the genotypes of a two-type line and a temporary maintainer line, so that the breeding strategy of the sterile line controlled by polygenes is improved from a process of complete phenotype identification to blanket search of genotype identification to a high efficiency breeding process of well-targeted marker genotype selection first to actual phenotype identification finally, by backcrossing and selfing multi-generation and field phenotype identification, the homozygous two type line and temporary maintainer line with same genetic background and uniform growth in fields are obtained, and then all sterile line seeds with genetic stability are produced for largely plantation. Therefore, the current situation that seeds for largely plantation of the sterile line are actual three-way cross hybrids is changed, and the problems of bad uniformity and declined advantages caused by the current situation are avoided.
Description
Technical field
The invention belongs to the rape molecular breeding field, be specifically related to a kind of method by the upper caryon sterile line system of molecular selection rapeseed plant recessive inheritance stability complete sterile line.
Background technology
Male sterile is cabbage type rape heterosis utilization important channel.Male sterility system involved in the present invention is a kind of caryon sterile line system (Chen Fengxiang etc. that done mutually to control by recessive sterile gene and recessive epistasis suppressor, Acta Agronomica Sinica, 1998,24 (4): 431-438), this sterile system has the sterile degree height, sterility is stable; The petal standard-sized sheet is put, hybrid seed yield high and common rape variety is the characteristics that its natural recovery is.Propositions such as Chen Fengxiang by " amphitypy system " and " temporary maintainer line " hybridization of isozygotying obtain complete sterile line again and " recovering system " (arbitrary common variety) hybridization " three are " of producing the F1 hybrid utilize the pattern (patent No.: 97125803.1), need manually pull out 50% drawback that can educate strain when having overcome traditional recessive cytoblast sterile " two line method " production of hybrid seeds.This sterile system is man of breeding extremely both at home and abroad and the concern of how tame breeding units after proposing, and successfully cultivates a plurality of hybrid combinations so far and is applied to production practices.Yet finding in Breeding Application has two difficult points to limit the application and the promotion rate of this sterile system.The one, filial generation that the controlled by multiple genes system brings heredity separate complex, the improvement of amphitypy system and the temporary maintainer line inefficiency that wastes time and energy; The 2nd, large tracts of land is used for that the male sterile line of the production of hybrid seeds is actual to be the F1 hybrid, and real crossbreed is a triple hybrid, and this can cause advantage decay and purity decline to a certain extent, may become this sterile system and be able on a large scale bottleneck problem with large-area applications.According to us this system hybrid is separated offspring's field fertility investigation for many years, the Molecular Identification of fertile gene and repeatedly practising of marking supplementary breeding, think that common rape variety all contains dominance in recessive sterile gene site and can educate allelomorph; Recessive epistasis suppressor site exists recessive and two kinds of allele distributions of dominance; Second pair of sterile overlapping genes of recessiveness is ms in most kinds
4Ms
4Genotype or do not have the 2nd sterile gene site.
Summary of the invention
In order to solve the technological deficiency of above-mentioned existence, the present invention seeks to propose a kind of method by the upper caryon sterile line system of molecular selection rapeseed plant recessive inheritance stability complete sterile line, " two types that the isozygoty system " and the temporary maintainer line that utilize pattern to select to have identical improved seeds (being) genetic background according to recessive epistasis nuclear sterile " three are ", thereby obtain the complete sterile line of inheritance stability, realize a large amount of F of production
1The purpose of (single cross hybrid) cross rape reduces and avoids triple hybrid to be applied to produce the problem that the appearance that may occur is inconsistent and advantage descends.
In order to realize above-mentioned technical purpose, the present invention has adopted following technical scheme:
By the method for the upper caryon sterile line system of molecular selection rapeseed plant recessive inheritance stability complete sterile line, this method comprises the steps:
1) at first with treat the kind of transformation or strain respectively with known stable amphitypy system in the sterile strain and stablize the temporary maintainer line plant and hybridize F respectively of isozygotying
1Obtain F for selfing
2Segregation population;
2) according to treating transformation kind or strain and stable temporary maintainer line hybridization F
2The fertility separation case is determined next step transformation approach from generation to generation, treats transformation kind or strain and temporary maintainer line hybridization F if there is fertility to separate then utilization
2In generation, is as next round transformation colony; If no fertility is separated, then to isozygoty sterile strain and treat transformation kind or incross F in the amphitypy system
2Colony is as next round transformation colony;
3.1) treat transformation kind or strain and temporary maintainer line hybridization F
2In generation, utilized MS during as transformation colony
3/ ms
3Select temporary maintainer line genotype individual plant with Rf/rf gene compact linkage molecule mark, and backcross with treating the kind of transformation or strain, obtain BC after the selfing generation as male parent
1F
2In generation, repeat above-mentioned same method then and carry out the mark evaluation, backcross and selfing, until BC
3F
2Or highlyer backcross, self-generation;
3.2) treat the sterile strain hybridization F that isozygotys in transformation kind or strain and the amphitypy system
2The sterile strain of the back molecular markers for identification of blooming was chosen the sterile pnca gene type that isozygotys and was backcrossed with treating the kind of transformation or strain, obtains BC after the selfing generation during as transformation colony generation
1F
2From generation to generation, repeating same method then carries out the mark evaluation, backcrosses and selfing, until BC
3F
2Or highlyer backcross, self-generation;
4) to transformation BC
3F
2Or the higher self-generation of backcrossing, use MS earlier
3/ ms
3The compact linkage molecule mark is identified all individual plants, filters out MS
3Ms
3And ms
3Ms
3Continue behind the marker gene type further to detect with Rf/rf linkage molecule mark, selecting the transformation amphitypy at last is MS
3Ms
3RfRf, ms
3Ms
3RfRf and temporary maintainer line ms
3Ms
3Rfrf marker gene type individual plant;
5) the homozygous two-type line MS to selecting
3Ms
3RfRf, ms
3Ms
3RfRf and temporary maintainer line ms
3Ms
3Rfrf genotype plant carries out the field phenotypic evaluation, to treat that transformation kind or product are contrast, carry out the uniformity comparative test of growing way appearance, the results seed carries out Quality Detection, finally choose appearance and treat that transformation kind or strain are consistent, quality reaches the homozygous two-type line MS of two substandards
3Ms
3RfRf, ms
3Ms
3RfRf and temporary maintainer line ms
3Ms
3Rfrf genotype strain system with alternate plantation homozygous two-type line of certain proportion and temporary maintainer line, pulls out in the amphitypy system after first the spending of buddingging and can educate strain in isolation environment, gathers in the crops seed in the sterile strain when ripe, and the complete sterile line that promptly obtains inheritance stability provides the land for growing field crops production of hybrid seeds.
6) selfing of temporary maintainer line genotype material is numerous kind, and the male sterile line that isozygotys can be educated by homozygous two-type line that brother and sister hand over procreation between strain and sterile strain.
As preferably, to the marker assisted selection of segregative generation, extract the genomic DNA of rape single-strain blade, use and MS
3/ ms
3M1 and the M2 codominance molecular labeling primer chain with Rf/rf carry out pcr amplification, and the PCR product is carried out polyacrylamide gel electrophoresis, filter out homozygous two-type line MS
3Ms
3RfRf, ms
3Ms
3RfRf and temporary maintainer line ms
3Ms
3Rfrf genotype individual plant.
As preferably, above-mentioned and MS
3/ ms
3The upstream and downstream sequence of linkage molecule mark M1 primer is respectively: 5 '-GTCTGTTTCTCTTCCCGTTGTC-3 ' and 5 '-GTGCTGCTCCGGTGTTATC-3 '; With the upstream and downstream sequence of Rf/rf linkage molecule mark M2 primer be respectively: 5 '-AGGAAGCCCAACAGGACTTT-3 ' and 5 '-AATTCGATTCTCCATCGTGC-3 '.Certainly that need among the present invention and MS
3/ ms
3The linkage molecule mark also can adopt document " Theor Appl Genet (2007) 115:113-118, Theor Appl Genet (2008) 117:11-18 "; With Rf/rf linkage molecule labeled primer also can be with reference to " Plant Breeding (2008), 127,145-149 " and Euphytica (2008), 164 (2): the last disclosed primer of 377-384.
As preferably, step 3.1) described temporary maintainer line genotype individual plant and the known sterile strain ms that isozygotys
3Ms
3The RfRf test cross, the summer numerous added-generation is identified the temporary maintainer line genotype.
As preferably, step 3.2) described sterile strain and the known stable temporary maintainer line ms of isozygotying
3Ms
3The rfrf test cross, the sterile pnca gene type that isozygotys that summer numerous added-generation checking is selected.
The present invention the invention has the advantages that owing to adopted above-mentioned technical scheme:
1, the present invention proposes to utilize the assisting sifting strategy with recessive cytoblast sterile gene and the closely linked codominance molecular labeling of recessive epistasis suppressor, can be like a cork from segregative generation target pick out temporary maintainer line genotype (1/13) exactly and the male sterile line genotype (1/3) of isozygotying continues to backcross; Again through once hybridization, then continuous backcross adds selfing 3-4 wheel until segregation population genetic background with treat that the transformation kind is basic identical.At last from BC
3-4F
2In the segregative generation, utilize molecular labeling to filter out homozygous two-type line and temporary maintainer line genotype simultaneously.This invention will significantly reduce the seed selection workload, improve seed selection accuracy rate and success rate greatly.The proposition of this method will make the application potential and the using value of cabbage type rape recessive epistasis caryon sterile line system be doubled and redoubled.
2, the seed selection strategy that proposes according to the present invention, be expected in identical good genetic background colony, obtain homozygous two-type line and temporary maintainer line genotype simultaneously with the 4-5 year, further under isolation environment, the complete sterile line seed application of producing inheritance stability is in the large tracts of land production of hybrid seeds.The hybrid of results is common single cross hybrid, changed the present large tracts of land of this system produce with kind actual be the present situation of triple hybrid, avoid the risk of the regularity difference advantage decline that may bring.
3, the present invention is directed to rape variety in esse two kinds of genotype patterns on two fertility-related genes, proposed at MS
3MS
3The appropriate to the occasion selection temporary maintainer line of the genotypic kind transformation of RfRf genotype ms
3Ms
3Rfrf is a donor parents; And at MS
3MS
3Rfrf then will select the male sterile line ms that isozygotys during genotypic transformation parent
3Ms
3RfRf is a donor, can guarantee to occur among the transformation offspring various possible genotype; In the transformation program " Xia Fan " non-segregative generation is proposed in addition, normal growth season plantation segregative generation, the pattern that hockets.This is to consider that strange land " Xia Fan " should simplify procedures, avoid selecting error (under the situation that impossible mark detects), and under the positive season growing environment, utilize the mark assisting sifting, from the segregation population that expands, filter out the individual backcross transformation that continues of minority target gene type, embody the ingenious combination on the space-time from each orientation, reached best and the fastest selection effect.
Description of drawings
Fig. 1 is a techniqueflow chart of the present invention.
Embodiment
Method as shown in Figure 1 by the upper caryon sterile line system of molecular selection rapeseed plant recessive inheritance stability complete sterile line, the technical scheme that this method is taked may further comprise the steps:
1, waiting to change kind recessive epistasis suppressor site allelomorph confirms: errorless for guaranteeing, at first wait isozygoty sterile strain and temporary maintainer line (for male parent) hybridization during changeing kind with stable amphitypy is simultaneously, the F1 selfing has or not fertility to separate from generation to generation from F2 and judges that kind to be changeed is MS
3MS
3RfRf (there is sterile strain to separate with temporary maintainer line hybridization F2 generation, sterile/as can to educate: 3/13) or MS
3MS
3Rfrf (F2 separates for no sterile strain with temporary maintainer line hybridization) genotype.
If 2 treat that the transformation kind is MS
3MS
3The RfRf genotype, continue according to the following steps:
1) treats that the transformation kind is maternal MS
3MS
3RfRf and known temporary maintainer line ms
3Ms
3The rfrf plant carries out conventional sexual hybridization, F
1The selfing of Dai Xiafan bagging produces F
2Generation.Normal growth season plantation F
2Segregation population is pressed individual plant seedling stage and is extracted DNA, uses MS earlier
3/ ms
3The compact linkage molecule mark detects all individual plants, selects ms
3Ms
3Continue behind the marker gene type to screen, obtain temporary maintainer line marker gene type individual plant with Rf/rf compact linkage molecule mark.
2) the temporary maintainer line marker gene type ms that selects
3Ms
3The rfrf individual plant, continue with treat transformation kind MS on one side
3MS
3RfRf is that female parent is backcrossed, and produces BC1F1 from generation to generation, on one side with the known sterile strain ms that isozygotys
3Ms
3The RfRf test cross, the summer numerous added-generation is identified the temporary maintainer line genotype.BC1F1 bagging selfing simultaneously produces BC1F2 from generation to generation.Next repeats first step from generation to generation, and normal growth is planted segregation population season, selects the sterile strain of isozygotying during mark is auxiliary and continues to backcross; Xia Fan plants non-segregation population, only need accompany each other generation certainly, until BC3F2 from generation to generation.
3) enlarge the BC3F2 kind and plant colony's (more than 1000 strains), extract individual plant DNA seedling stage, use MS earlier
3/ ms
3The compact linkage molecule mark is identified all individual plants, filters out MS
3Ms
3And ms
3Ms
3Continue behind the marker gene type to detect with Rf/rf linkage molecule labeled analysis, selecting the transformation amphitypy at last is MS
3Ms
3RfRff, ms
3Ms
3RfRf and temporary maintainer line ms
3Ms
3Rfrf marker gene type individual plant.Can repeat simultaneously first step and continue to select temporary maintainer line ms
3Ms
3Rfrf marker gene type is backcrossed, and produces more the transformation amphitypy system and the temporary maintainer line of advanced lines.
4) the auxiliary transformation amphitypy of mark is sterile ms
3Ms
3RfRf and can educate strain MS
3Ms
3Brother and sister hand between RfRf; Transformation temporary maintainer line ms
3Ms
3Rfrf and the known sterile strain ms that isozygotys
3Ms
3The RfRf test cross; The transformation sterile strain ms that isozygotys
3Ms
3RfRf and known temporary maintainer line ms
3Ms
3The rfrf test cross; Strain MS can educate in transformation amphitypy system
3Ms
3RfRf and known isozygoty sterile strain test cross and bagging selfing.The next generation is investigated all test crosses and self progeny's fertility performance, if transformation temporary maintainer line and the known sterile strain test cross that isozygotys, offspring's complete sterility, then temporary maintainer line transformation success.If the isozygoty sterile strain and the known temporary maintainer line test cross of transformation, offspring's complete sterility, and strain MS can educate in transformation amphitypy system
3Ms
3RfRf and the known sterile strain test cross that isozygotys, offspring's 1: 1 (can educate: sterile) separates, and self progeny's 3: 1 (can educate: sterile) separates, and then transformation amphitypy system succeeds.
5) amphitypy system and the temporary maintainer line strain system to all transformation successes carries out field phenotypic evaluation and Quality Detection, selects yield level, plant forms, resistance requirement and quality standard and amphitypy system and the temporary maintainer line for the treatment of that the transformation kind is consistent.Yet according to (Acta Agronomica Sinicas such as Chen Fengxiang, 1998,24 (4): the 431-438) method of Ti Chuing, the amphitypy of alternate plantation seed selection system and temporary maintainer line under isolation environment, initial bloom stage is pulled out the sterile strain in the amphitypy system, spontaneous pollination between temporary maintainer line and the sterile strain is gathered in the crops seed in the sterile strain when ripe, promptly obtains inheritance stability and is used for the large tracts of land production of hybrid seeds with the complete sterile line seed for the treatment of transformation variety and genetype basically identical.
If 3 treat that the transformation variety identification is MS
3MS
3The rfrf genotype then follows these steps to continue:
1) treats that the transformation kind is male parent MS
3MS
3Rfrf and the known male sterile line ms that isozygotys
3Ms
3The RfRf plant carries out conventional sexual hybridization, F1 for the summer when numerous the bagging selfing produce F2 generation.Normal growth season plantation F2 segregation population is buddingged or is just spent the back to extract sterile strain leaf DNA by individual plant, screens with Rf/rf compact linkage molecule mark, selects marker site and be the sterile strain ms of RfRf of isozygotying
3Ms
3RfRf.
2) the sterile marker gene type ms that isozygotys that filters out
3Ms
3The RfRrf individual plant, continue with treat transformation kind MS on one side
3MS
3Rfrf backcrosses, and produces BC1F1 from generation to generation, on one side with known stable temporary maintainer line test cross ms
3Ms
3Rfrf, the sterile pnca gene type that isozygotys that summer numerous added-generation checking is selected.BC1F1 bagging selfing simultaneously produces BC1F2 from generation to generation.Next repeats first step from generation to generation, and normal growth is identified sterile strain with Rf/rf compact linkage molecule mark season, and filtering out the marker gene type is the plant ms that isozygotys sterile
3Ms
3RfRrf continues with treating transformation kind MS
3MS
3Rfrf backcrosses, and test cross, Xia Fan plant non-segregative generation, accompanies each other generation certainly until BC3F2 from generation to generation.
3) obtain BC3F2 for seed after, on one side be MS by transformation genotype in above-mentioned the 2nd joint
3MS
3The the 3rd to the 5th step the during kind of RfRf is carried out.Can continue with treating transformation kind MS on one side
3MS
3Rfrf backcrosses, enter higher one take turns backcross, test cross and selfing.
Sequence table
＜110〉Zhejiang Academy of Agricultural Science
＜120〉by the method for the upper caryon sterile line of molecular selection rapeseed plant recessive system inheritance stability complete sterile line
<160>4
<210>1
<211>22
<212>DNA
＜213〉primer
<222>(1)…(22)
<400>1
GTCTGTTTCTCTTCCCGTTGTC?22
<210>2
<211>19
<212>DNA
＜213〉primer
<222>(1)…(19)
<400>2
GTGCTGCTCCGGTGTTATC 19
<210>3
<211>20
<212>DNA
＜213〉primer
<222>(1)…(20)
<400>3
AGGAAGCCCAACAGGACTTT?20
<210>4
<211>20
<212>DNA
＜213〉primer
<222>(1)…(20)
<400>4
AATTCGATTCTCCATCGTGC?20
Claims (6)
1. by the method for the upper caryon sterile line system of molecular selection rapeseed plant recessive inheritance stability complete sterile line, it is characterized in that this method comprises the steps:
1) at first with treat the kind of transformation or strain respectively with known stable amphitypy system in the sterile strain and stablize the temporary maintainer line plant and hybridize F respectively of isozygotying
1Obtain the F2 segregation population for selfing;
2) according to treating transformation kind or strain and stable temporary maintainer line hybridization F
2The fertility separation case is determined next step transformation approach from generation to generation, treats transformation kind or strain and temporary maintainer line hybridization F if there is fertility to separate then utilization
2In generation, is as next round transformation colony; If no fertility is separated, then to isozygoty sterile strain and treat transformation kind or incross F in the amphitypy system
2Colony is as next round transformation colony;
3.1) treat transformation kind or strain and temporary maintainer line hybridization F
2In generation, utilized MS during as transformation colony
3/ ms
3Select temporary maintainer line genotype individual plant with Rf/rf gene compact linkage molecule mark, and backcross with treating the kind of transformation or strain, obtain BC after the selfing generation as male parent
1F
2In generation, repeat above-mentioned same method then and carry out the mark evaluation, backcross and selfing, until BC
3F
2Or highlyer backcross, self-generation;
3.2) treat the sterile strain hybridization F that isozygotys in transformation kind or strain and the amphitypy system
2The sterile strain of the back molecular markers for identification of blooming was chosen the sterile pnca gene type that isozygotys and was backcrossed with treating the kind of transformation or strain, obtains BC after the selfing generation during as transformation colony generation
1F
2From generation to generation, repeating same method then carries out the mark evaluation, backcrosses and selfing, until BC
3F
2Or highlyer backcross, self-generation;
4) to transformation BC
3F
2Or the higher self-generation of backcrossing, use MS earlier
3/ ms
3The compact linkage molecule mark is identified all individual plants, filters out MS
3Ms
3And ms
3Ms
3Continue behind the marker gene type further to detect with Rf/rf linkage molecule mark, selecting the transformation amphitypy at last is MS
3Ms
3RfRf, ms
3Ms
3RfRf and temporary maintainer line ms
3Ms
3Rfrf marker gene type individual plant;
5) the homozygous two-type line MS to selecting
3Ms
3RfRf, ms
3Ms
3RfRf and temporary maintainer line ms
3Ms
3Rfrf genotype plant carries out the field phenotypic evaluation, to treat that transformation kind or product are contrast, carry out the uniformity comparative test of growing way appearance, the results seed carries out Quality Detection, finally choose appearance and treat that transformation kind or strain are consistent, quality reaches the homozygous two-type line MS of two substandards
3Ms
3RfRf, ms
3Ms
3RfRf and temporary maintainer line ms
3Ms
3Rkf genotype strain system with alternate plantation homozygous two-type line of certain proportion and temporary maintainer line, pulls out in the amphitypy system after first the spending of buddingging and can educate strain in isolation environment, gathers in the crops seed in the sterile strain when ripe, and the complete sterile line that promptly obtains inheritance stability provides the land for growing field crops production of hybrid seeds.
6) selfing of temporary maintainer line genotype material is numerous kind, and the male sterile line that isozygotys can be educated by homozygous two-type line that brother and sister hand over procreation between strain and sterile strain.
2. the method by the upper caryon sterile line system of molecular selection rapeseed plant recessive inheritance stability complete sterile line according to claim 1 is characterized in that: to the marker assisted selection of segregative generation, extract the genomic DNA of rape individual plant, use and MS
3/ ms
3M1 and the M2 codominance molecular labeling primer chain with Rf/rf carry out pcr amplification, and the PCR product is carried out polyacrylamide gel electrophoresis, filter out homozygous two-type line MS
3Ms
3RfRf, ms
3Ms
3RfRf and temporary maintainer line ms
3Ms
3Rfrf genotype individual plant.
3. the method by the upper caryon sterile line system of molecular selection rapeseed plant recessive inheritance stability complete sterile line according to claim 1 and 2 is characterized in that: with MS
3/ ms
3The upstream and downstream sequence of linkage molecule mark M1 primer is respectively: 5 '-GTCTGTTTCTCTTCCCGTTGTC-3 ' and 5 '-GTGCTGCTCCGGTGTTATC-3 '; With the upstream and downstream sequence of Rf/rf linkage molecule mark M2 primer be respectively: 5 '-AGGAAGCCCAACAGGACTTT-3 ' and 5 '-AATTCGATTCTCCATCGTGC-3 '.
4. the method by the upper caryon sterile line system of molecular selection rapeseed plant recessive inheritance stability complete sterile line according to claim 1 is characterized in that: step 3.1) described temporary maintainer line genotype individual plant and the known sterile strain ms that isozygotys
3Ms
3The RfRf test cross, the summer numerous added-generation is identified the temporary maintainer line genotype.
5. the method by the upper caryon sterile line system of molecular selection rapeseed plant recessive inheritance stability complete sterile line according to claim 1 is characterized in that: step 3.2) described sterile strain and the known stable temporary maintainer line ms of isozygotying
3Ms
3The rfrf test cross, the sterile pnca gene type that isozygotys that summer numerous added-generation checking is selected.
6. be used for the molecular labeling of selectively breeding hybrid rape recessive epistasis caryon sterile line system inheritance stability complete sterile line, it is characterized in that: with MS
3/ ms
3The upstream and downstream sequence of linkage molecule mark M1 primer is respectively: 5 '-GTCTGTTTCTCTTCCCGTTGTC-3 ' and 5 '-GTGCTGCTCCGGTGTTATC-3 '; With the upstream and downstream sequence of Rf/rf linkage molecule mark M2 primer be respectively: 5 '-AGGAAGCCCAACAGGACTTT-3 ' and 5 '-AATTCGATTCTCCATCGTGC-3 '.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010177110 CN102246690B (en) | 2010-05-19 | 2010-05-19 | Method for breeding all sterile line with genetic stability of rape recessive epistasis genic male sterile line by means of molecular marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010177110 CN102246690B (en) | 2010-05-19 | 2010-05-19 | Method for breeding all sterile line with genetic stability of rape recessive epistasis genic male sterile line by means of molecular marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102246690A true CN102246690A (en) | 2011-11-23 |
| CN102246690B CN102246690B (en) | 2013-04-17 |
Family
ID=44974559
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010177110 Active CN102246690B (en) | 2010-05-19 | 2010-05-19 | Method for breeding all sterile line with genetic stability of rape recessive epistasis genic male sterile line by means of molecular marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102246690B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1559187A (en) * | 2004-03-09 | 2005-01-05 | 华中农业大学 | Method for selectively breeding cabbage type rape dominant karyon male sterility isozygotic wo-purpose line |
-
2010
- 2010-05-19 CN CN 201010177110 patent/CN102246690B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1559187A (en) * | 2004-03-09 | 2005-01-05 | 华中农业大学 | Method for selectively breeding cabbage type rape dominant karyon male sterility isozygotic wo-purpose line |
Non-Patent Citations (3)
| Title |
|---|
| 《作物学报》 19980430 陈凤祥等 甘蓝型油菜细胞核雄性不育性的遗传研究__Ⅰ.隐性核不育系9012A的遗传 , 第04期 * |
| 王贵春: "甘蓝型油菜隐性细胞核雄性不育两型系9012AB雄性不育基因的分子标记开发", 《中国博士学位论文全文数据库》, no. 2, 15 February 2009 (2009-02-15) * |
| 陈凤祥等: "甘蓝型油菜细胞核雄性不育性的遗传研究――Ⅰ.隐性核不育系9012A的遗传", 《作物学报》, no. 04, 30 April 1998 (1998-04-30) * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102246690B (en) | 2013-04-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101889544B (en) | Method for quickly breeding high-quality multi-resistant rice photo-thermo-sensitive nucleic male sterile line | |
| CN102224801B (en) | Rapid multi-target property polymerization breeding method for rape | |
| CN101956007B (en) | Method for breeding raphanus sativus L. CMS (genic male sterility) lines by using marker assisted selection | |
| CN106688878B (en) | The method for cultivating perennial rice using long male wild rice vegetative propagation characteristic | |
| CN104170720A (en) | Seed selection method for molecular marking assisted selection of high-resistance rice blast materials | |
| CN104313016B (en) | The molecular labeling of the QTL/ major gene resistance relevant with cotton verticillium wilt resistance | |
| CN102640700A (en) | Cabbage type rape Ogura cytoplasmic male sterility (OGU CMS) restorer and transformation method and application thereof | |
| CN104285776A (en) | Breeding method for corn male sterile line | |
| Surma et al. | Preliminary results of in vitro culture of pea and lupin embryos for the reduction of generation cycles in single seed descent technique | |
| CN103355160A (en) | Gradually oozing between the Cucumis kind is the method that colony made up and be used for breed cucumber | |
| CN101773067B (en) | Method for recurrently and selectively breeding non-glutinous rice by using recessive cytoblast sterile material | |
| CN112375840B (en) | Major QTL for regulating and controlling resistance of rice sogatella furcifera, molecular marker and application | |
| CN102805029A (en) | Cultivation method of hybrid rapeseed capable of being planted at high altitude localities | |
| CN109006456B (en) | Breeding method of pimento nuclear male sterile dual-purpose line | |
| CN101487050B (en) | Molecular marker method for rice anti-rice stripe major gene loci qSTV11 | |
| CN103843654B (en) | The selection of glossy leaf recessive cytoblast sterile homozygous two-type line and glossy leaf temporary maintainer line and application | |
| CN103120118A (en) | Method for breeding cabbage type rape recessive epistasis interaction genic male sterility two type line | |
| CN1843091A (en) | Rape cytoplasm male sterility three line selection and breeding method | |
| CN106342677A (en) | Multi-line hybrid breeding method and application thereof | |
| CN104642092A (en) | Selection method for onion male sterility maintainer line | |
| CN102246690B (en) | Method for breeding all sterile line with genetic stability of rape recessive epistasis genic male sterile line by means of molecular marker | |
| CN114568294A (en) | Method for breeding clubroot-resistant variety based on brassica napus Ogu-CMS restorer line | |
| CN102919116B (en) | Selection breeding method of new homozygous sterile line of brassica napus | |
| CN105830914A (en) | Breeding method of cabbage-type rape high oil-content recessive epistatic interaction nuclear sterile homozygous two-type line | |
| CN101228842A (en) | Artificial breeding method of pimiento male sterile restoring line |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |