CN102212520A - Small interfering RNA (siRNA) sequence for specifically silencing chicken Marek's disease virus gI and gE genes and vectors and application thereof - Google Patents

Abstract

The invention provides a small interfering RNA (siRNA) sequence capable of effectively and specifically silencing chicken Marek's disease viruses (MDV) gI and gE and vectors thereof and application in MDV gene therapy and preparation of gene engineering vaccines. A target site screening and designing tool of http//www.ambion.com is used, and one-step polymerase chain reaction (PCR) amplification is performed on an siRNA expression box containing avian U6 promoters to quickly screen the interfering sequence of MDV gI and gE genes. According to the positions of initial sites corresponding to the siRNA on the messenger RNA (mRNA) sequence of the gI and gE genes, the initial sites are named as sig1735 and sigE936 respectively. SiRNA eukaryotic expression vectors containing the interfering sequence respectively are constructed, and purified plasmid transfected chick embryo fibroblasts (CEF) are extracted, so that the expression of the MDV gI and gE genes can be effectively inhibited; and the effect of inhibiting the expression of the MDV gI and gE genes is further detected by using DF1, Vero and MDCK stable cell lines.

Description

SiRNA sequence and the carrier and the application of the reticent chicken Marek's disease virus of specificity gI, gE gene

Technical field

The invention belongs to biotechnology, relate to molecular biology and gene engineering technology field, be specifically related at chicken Marek's disease virus US7 (gI) and US8 (gE) gene siRNA sequences Design, screening and in the application of vitro inhibition MDV gI and gE.Particularly, the present invention relates to sequence is SEQ ID NO:1, SEQ ID NO:2, and the siRNA sequence of SEQ ID NO:3 and SEQ ID NO:4, it can specificity disturb chicken Marek's disease virus gI gene.

Background technology

1.MDV present Research

Chicken Marek's disease (MD) is a kind of lymphocytic hyperplasia venereal disease of chicken, is subjected to extensive concern in aquaculture.If the shortage control device, MD will produce tremendous loss.MD was found in 1907, and nineteen sixty-eight is separated to chicken Marek's disease virus (MDV) first.MDV belongs to the herpetoviridae double-stranded DNA virus, and genome is near 180kb, and MDV has the biological characteristics of γ-simplexvirus, but is classified as herpes simplex virus group according to its genome structure.Its genome is huge, is made up of the reverse short weight complex sequences (TRS and IRS) of the reverse long tumor-necrosis factor glycoproteins (TRL and IRL) of long distinct zones (UL) and both sides thereof, short distinct zones (US) and both sides thereof.MDV comprises three kinds of serotypes, and all MDV of tumour that can cause all belong to serum 1 type (MDV-1), and the MDV of natural not tumorigenesis and herpes turkey virus (HVT) belong to serum 2 types and serum 3 types respectively.Compare other herpes simplex virus groups, MDV has following characteristics: strict cell binding characteristic, in lymphocyte, set up latent infection, and the oncogene that comprises in the genome can produce lymphoma.Since 1969, MD just obtained better controlled by vaccine immunity.Yet, being accompanied by the MDV virulence and constantly strengthening, the immune effect of vaccine progressively reduces, and virus constantly develops and forces us must accelerate the research and development progress of MD novel vaccine with the continuous disease control pressure that is brought that strengthens of reply virulence.Yet novel vaccine research and development speed does not also far catch up with virus evolution speed, and this is to aviculture potential biggest threat undoubtedly.In addition,, strengthen commercial chicken production management, make chicken contact virus in early days or inoculation low dosage virus also is a good method of this disease of control.Existing result proves that the MD vaccine can be controlled this disease effectively, but can not stop the evolution of virus.The CVI988 virus strain remains the best vaccine of current control MD, the MDV virulence enhanced trend that reply (perhaps adapting to) is constantly evolved in the future, and the better novel MD vaccine of exploitation immune effect is a kind of strategic demand of this disease of control.Three critical control point are arranged on the controlling unit of MD, that is: respiratory tract, cell-to-cell spread, viral door (feather follicular epithelium cell), the breakthrough of these three link any point all can produce the influence of crossing over property to the control of MD.

2.MDV the present Research of gI and gE gene and expressing protein thereof.

GI and gE are the very important viral glycoprotein of MDV genes encoding, be positioned at the genomic US district of MDV, the homologous gene that in all herpes simplex virus groups, all has coding gE, all have 2 conservative halfcystines bunch among the gE, and the halfcystine of gE PROTEIN C end bunch all has 5 cysteine residues in all herpes simplex virus groups, and it is very conservative that the gE that each member of Herpesvirus is described has similar function.(HSV-1, VZV, PRV etc.) have very high homology with the I herpes simplex virus type, influence the growth of external virus.GE is an important virulence gene, and gI is also relevant with virulence, and protection is necessary to inducing fully.GE and gI gene are to be combined into complex body gI/gE with the non covalent bond form, and they and MDV invasion and attack and the diffusion in the lymph group is closely related, are the functional components that influences viral growth.

It is virus replication, propagation indispensable gene that bibliographical information gI/gE is arranged, and gE is a gG Fc acceptor, utilizes the articulating mechanism of cell to help virus and spreads at iuntercellular.And the gI-gE mixture helps to mediate virus and invades cell, propagates at iuntercellular and plays important effect (Schumacher et al., 2001; Shamblin et al., 2004; Tischer et al., 2002).Knapp etc. studies have shown that, the PrV of disappearance gI/gE reduces significantly to the virulence of rat, but after the gI/gE of BHV-1 was cloned into this PrV mutant strain, recombinant virus had recovered the virulence to rat again.The homology segment of BHV-1 can remedy PrV gE and the strain of gI disappearance is damaged to the virulence of mouse, and this proves further that also simplexvirus homology gE albumen has mutual complementary function.By outer phenotypic analysis discloses to BHV-1gE deletion mutantion virosome, gE is favourable to dwindling of viral secretory and plaque.

3.RNA interferential present Research

(RNA interference is that sequence-specific double-stranded RNA (dsRNA) makes degradation of homologous mRNA in the cell RNAi), thereby produces the process of expression of specific gene silence in the RNA interference.It is the sequence-specific immunoprotection mechanism of a kind of microRNA mediation of body, can resist the genic effect of invasive.Since 1998 were in the news first, the RNAi technology was applied to rapidly in the research of antiviral and related fields with its distinctive superiority, makes important progress in the antiviral research of HBV, HCV, influenza virus etc. at present.Have successfully can be anti-hepatitis C express the transgenic mouse of siRNA.MicroRNAs (miRNAs) is that the intravital oligogene of numerous biologies is expressed regulatory factor, comprises virus.Current, reported 6 miRNAs of genomic MEQ of MDV and LAT regional code.In addition, 17 new serum characteristic type miRNAs have been discerned.The action function analytical work of these miRNAs in pathogenic course and vaccine immune response carried out.

The effect of RNAi is mainly by the dsRNA mediation that is about 19-21nt, and wherein a class is called siRNA (small interfering RNA, siRNA), it and purpose mRNA sequence have strict pairing, can cause the corresponding mRNA degraded.Because the specificity degraded that RNAi is SiRNA targeting mRNA to be caused, the key that therefore will produce effective RNAi is to select suitable SiRNA action target spot.At present the selection principle of RNAi target spot may be summarized to be following some: 1. select the mRNA zone of GC content about 50%; 2. avoid selecting the initial position of promotor downstream 50-100nt with the zone in interior or the terminator upstream 50-100nt; 3. avoid surpassing the overlapping of three G or three C the reticent mechanism of RNA interfering i because poly G or poly C can form the class polymers; 4. select the sequence that begins with two AA, this will make synthetic siRNA be more prone to; 5. guarantee that target sequence and other genes do not have homology.At present, the method for preparing siRNA comprises that mainly chemical synthesis, in-vitro transcription method, long segment dsRNA transcribe 5 kinds of the siRNA expression cassette methods of method and PCR preparation etc. through RNaseIII edman degradation Edman, siRNA expression vector.

Summary of the invention

The present invention is according to the siRNA principle of design, and the GC content of its sequence of siRNA of selection is respectively 47.5% and 52%, the corresponding position of initiation site on gI and gE gene mRNA sequence, called after sigI735 and sigE936 respectively.Structure is at the siRNA carrier for expression of eukaryon of MDV gI and gE gene, after extracting plasmid purification, transfection CEF cell can suppress MDV gI and gE expression of gene effectively, further detects interference sequence by DF1, Vero, MDCK stable cell lines again and suppresses MDV gI and gE expression of gene effect.

In one aspect, the invention provides a kind of siRNA sequence at MDV gI and gE gene, its nucleotide sequence is: sigI735 positive-sense strand 5 ' CAATTCCCATGTCGATGCA 3 ' (SEQ ID NO:1), antisense strand 5 ' TGCATCGACATGGGAATTG 3 ' (SEQ ID NO:3); SigE936 positive-sense strand 5 ' AGATGTCCAGGTAGACGAT 3 ' (SEQ ID NO:2); Antisense strand 5 ' ATCGTCTACCTGGACATCT 3 ' (SEQ ID NO:4).

In aspect second, the invention provides the carrier that comprises the described siRNA sequence in above-mentioned first aspect.In one embodiment, described carrier is a pGEM-T Easy carrier.In one embodiment, described carrier is characterised in that as follows to make up and forms: the specificity that the single stage method pcr amplification contains fowl source U6 promotor is disturbed the expression cassette of the cU6-3-siRNA of gI and gE gene, its directed cloning to pGEM-T Easy carrier, is made up and obtains pGEM-T-cU6-3-shgI735 and pGEM-T-cU6-3-shgE935 expression vector; SiRNA positive-sense strand, 7bp loop ring, the siRNA antisense strand of 19nt, 6 continuous T that described cU6-3-siRNA sequence comprises cU6-3 promotor, the 19nt of 394bp are termination signal sequence, 5 ' and 3 ' end be the HindIII restriction enzyme site.In one embodiment, described carrier is a carrier for expression of eukaryon.In one embodiment, described carrier for expression of eukaryon is the carrier for expression of eukaryon that has the EGFP mark.In one embodiment, described carrier is the carrier based on pGEM-T Easy vector construction.

In aspect the 3rd, the invention provides the described siRNA sequence in first aspect and second described carrier in aspect at the application in the gene studies of MDV.

In aspect the 4th, the invention provides the described siRNA sequence in first aspect and second described carrier in aspect and be used for application at the MDV recombinant vaccine in preparation.

In aspect the 5th, the invention provides the described siRNA sequence in first aspect and second described carrier in aspect are used for preventing or treating the medicine of the disease that is caused by chicken Marek's disease virus in preparation application.In one embodiment, the described disease that is caused by chicken Marek's disease virus is a chicken Marek's disease.

In aspect the 6th, the invention provides a kind of medicine that is used to prevent or treat the disease that is caused by chicken Marek's disease virus, described medicine comprises the described siRNA sequence in first aspect and second described carrier in aspect as activeconstituents.In one embodiment, the described disease that is caused by chicken Marek's disease virus is a chicken Marek's disease.

Another object of the present invention has provided the method that a kind of preliminary evaluation chicken Marek's disease virus replication specificity is disturbed target site, and the application in the gene therapy medicament of preparation treatment MDV virus infection.

Usefulness of the present invention is: the siRNA sequence that provides at present, still is difficult the report of this gene as the RNAi target spot both at home and abroad at propagation indispensable gene gI and the gE of MDV.Carrier for expression of eukaryon based on this sequence can effectively suppress gI and gE gene mRNA level and protein expression level in cell, therefore can be used as a novel targets of MDV gene therapy.

Description of drawings

Fig. 1 is the design of single stage method PCR rapid amplifying cU6-3-expression cassette upstream and downstream.

M：DL2000DNA；1：cU6-3-shgI97；2：cU6-3-shgI328；3：cU6-3-shgI487；4：cU6-3-shgI735；5：cU6-3-shgI922；6：cU6-3-shgE172；7：cU6-3-shgE328；8：cU6-3-shgE461；9：cU6-3-shgE936；10：cU6-3-shgE1261；11：cU6-3-conshRNA；12：Negative?control.

Fig. 2 is amplification cU6-3-shRNAgI and cU6-3-shRNAgE expression cassette PCR evaluation.

Fig. 3 cuts evaluation for pEGFP-gI and pEGFP-gE enzyme.

Fig. 4 suppresses observations for fluorescence microscope cU6-3-shRNA behind the transfection 48h to gE-EGFP, gI-EGFP Expression of Fusion Protein.

A：transfection?of?pEGFP-C1；B：cotransfection?of?pEGFP-gE?andpcU6-3-conshRNA；C：co-transfection?of?pEGFP-gI?and?cU6-3-conshRNA；D：transfection?reagent-only?control(no-plasmid?DNA)；E：no-fluorescencemicroscopy?image?cU6-3-conshRNA；F-J：Co-transfected?with?pEGFP-gE?andvarious?cU6-3-shRNA?gE?expression?Plasmids；K-O：Co-transfected?withpEGFP-gI?and?various?cU6-3-shRNAgI?expression?plasmids.

Fig. 5 detects cU6-3-shRNA to gE-EGFP, gI-EGFP Expression of Fusion Protein inhibition analysis result for flow cytometer behind the transfection 48h.(caption is partly seen Fig. 4)

Fig. 6 is a shRNA order-checking collection of illustrative plates in the pGEMT-cU6-3-shRANgI735 plasmid vector.

Fig. 7 is a shRNA order-checking collection of illustrative plates in the pGEMT-cU6-3-shRANgE936 plasmid vector.

Fig. 8 is the gene inhibition effect of specificity reorganization interference plasmid on different clones.

(a) fluorescence microscope (100 *) of different cells behind specificity reorganization interference plasmid and the fusion gene plasmid vector cotransfection 48h; (b) flow cytometer detection by quantitative plasmid transfection group is to the restraining effect of gE-EGFP and gI-EGFP positive cell.

Embodiment

The present invention is described further in conjunction with the embodiments.

Embodiment one: siRNA carrier for expression of eukaryon vitro inhibition gI-EGFP and gE-EGFP Expression of Fusion Protein

1.siRNA design:According to the siRNA principle of design, from gI and gE mRNA initiator codon AUG downstream 100nt search AA sequence, the adjacent 19nt sequence of its 3 ' end is as candidate's target spot, select 5 the siRNA sequences of GC content respectively at 40%-60%, utilize in the GenBank database Blast function that whole genome sequence in the chicken body is compared, guaranteeing does not have similarity.Final its cDNA sequence of siRNA of selecting is sigI735:5 ' CAATTCCCATGTCGATGCA 3 ' (SEQ ID NO:1); SigE936:5 ' AGATGTCCAGGTAGACGAT 3 ' (SEQ IDNO:2), 735 and 936 nucleotide sites of corresponding gI and gE mRNA.Described sigI735 and sigE936 antisense strand are respectively 5 ' TGCATCGACATGGGAATTG 3 ' (SEQ ID NO:3) or 5 ' ATCGTCTACCTGGACATCT 3 ' (SEQ ID NO:4).

2. express the synthetic and preparation of the required shRNA of siRNA:

Contain the siRNA expression cassette specificity interference gI of fowl source U6 promotor and the cU6-3-shRNA sequence of gE gene by the single stage method pcr amplification.

(gI gene open reading frame is as follows:

ATGTATCTACTACAATTATTATTTTGGATCCGCCTCTTTCGAGGCATCTGGTCTATA

GTTTATACTGGAACATCTGTTACGTTATCAACGGACCAATCTGCTCTTGTTGCGTT

CTGCGGATTAGATAAAATGGTGAATGTACGCGGCCAACTTTTATTCCTGGGCGAC

CAGACTCGGACCAGTTCTTATACAGGAACGACGGAAATCTTGAAATGGGATGAA

GAATATAAATGCTATTCCGTTCTACATGCGACATCATATATGGATTGTCCTGCTATA

GACGCCACGGTATTCAGAGGCTGTAGAGACGCTGTGGTATATGCTCAACCTCATG

ATAGAGTACAACCTTTTCCCGAAAAGGGAACATTGTTGAGAATTGTCGAACCCA

GAGTATCAGATACAGGCAGCTATTACATACGTGTAGCTCTCGCTGGAAGAAATATG

AGCGATATATTTAGAATGGCTGTTATTATAAGGAGTAGCAAATCTTGGGCCTGTAA

TCACTCTGCTAGTTCATTTCAGGCCCATAAATGTATTCGCTATGTCGACCGTATGGC

CTTTGAAAATTATCTGATTGGACATGTAGGCAATTTGCTGGACAGTGACTCGGAA

TTGCATGCAATTTATAATATTACTCCCCAATCCATTTCCACAGATATTAATATTATAA

CGACTCCATTTTACGATAATTCGGGAACAATTTATTCACCTACGGTTTTTAATTTGT

TTAATAACAATTCCCATGTCGATGCAATGAATTCGACTGGTATGTGGAATACCGTT

TTAAAATATACCCTTCCAAGGCTTATTTACTTTTCTACGATGATTGTACTATGTATAA

TAGCATTGGCAATTTATTTGGTCTGTGAAAGGTGCCGCTCTCCCCATCGTAGGATA

TACATCGGTGAACCAAGATCTGATGAGGCCCCACTCATCACTTCTGCAGTTAACG

AATCATTTCAATATGATTATAATGTAAAGGAAACTCCTTCAGATGTTATTGAAAAG

GAGTTGATGGAAAAACTGAAGAAGAAAGTCGAATTGTTGGAAAGAGAAGAATG

TGTATAG(SEQ?ID?NO：5)；

GE gene open reading frame is as follows:

ATGTGTGTTTTCCAAATCCTGATAATAGTGACGACGATCAAAGTAGCTGGAACGG

CCAACATAAATCATATAGACGTTCCTGCAGGACATTCTGCTACAACGACGATCCC

GCGATATCCACCAGTTGTCGATGGGACCCTTTACACCGAGACGTGGACATGGATT

CCCAATCACTGCAACGAAACGGCAACAGGCTATGTATGTCTGGAAAGTGCTCAC

TGTTTTACCGATTTGATATTAGGAGTATCCTGCATGAGGTATGCGGATGAAATCGT

CTTACGAACTGATAAATTTATTGTCGATGCGGGATCCATTAAACAAATAGAATCGC

TAAGTCTGAATGGAGTTCCGAATATATTCCTATCTACGAAAGCAAGTAACAAGTTG

GAGATACTAAATGCTAGCCTACAAAATGCGGGTATCTACATTCGGTATTCTAGAAA

TGGGACGAGGACTGCAAAGCTGGATGTTGTTGTGGTTGGCGTTTTGGGTCAAGC

AAGGGATCGCCTACCCCAAATGTCCAGTCCTATGATCTCATCCCACGCCGATATCA

AGTTGTCATTAAAAAACTTTAAAGCATTAGTATATCACGTGGGAGATACTATCAAT

GTCTCGACGGCGGTTATACTAGGACCTTCTCCGGAGATATTCACATTGGAATTTAG

GGTGTTGTTCCTCCGTTATAATCCAACGTGCAAGTTCGTCACGATTTATGAACCTT

GTATATTTCACCCCAAAGAACCAGAGTGTATTACTACTGCAGAACAATCGGTATGT

CATTTCGCATCCAACATTGACATTCTGCAGATAGCCGCCGCACGTTCTGAAAATTG

TAGCACAGGGTATCGTAGATGTATTTATGACACGGCTATCGATGAATCTGTGCAGG

CCAGATTAACATTCATAGAACCAGGAATTCCTTCCTTTAAAATGAAAGATGTCCA

GGTAGACGATGCTGGATTGTATGTGGTTGTGGCTTTATACAATGGACGTCCAAGT

GCATGGACTTACATTTATTTGTCAACGGTGGAAACATATCTTAATGTATATGAAAA

CTACCACAAGCCGGGATTTGGGTATAAATCATTTCTACAGAACAGTAGTATCGTCG

ACGAAAATGAGGCTAGCGATTGGTCCAGCTCGTCCATTAAACGGAGAAATAATGG

TACTATCATTTATGATATTTTACTCACATCGCTATCAATTGGGGCGATTATTATCGTC

ATAGTAGGGGGTGTTTGTATTGCCATATTAATTAGGCGTAGGAGACGACGTCGCAC

GAGGGGGTTATTCGATGAATATCCCAAATATATGACGCTACCAGGAAACGATCTGG

GGGGCATGAATGTACCGTATGATAATACATGCTCTGGTAACCAAGTTGAATATTAT

CAAGAAAAGTCGGCTAAAATGAAAAGAATGGGTTCGGGTTATACCGCTTGGCTA

AAAAATGATATGCCGAAAATTAGGAAACGCTTAGATTTATACCACTGA(SEQ?ID

NO：6))

Principle of design as shown in Figure 1, with the chicken complete genome DNA (accession number: DQ531569) be template that contains avian origin promoter (cU6-3), upstream primer and cU6 promotor 5 ' terminal sequence (GACTAAGAGCATCGAGACTG) complementation, its primer sequence is 5 ' AAGCTTCAGACAGACGTCAGGCTTTC 3 '; Downstream primer is as shown in table 1: comprise loop sequence (CTCTTGA), siRNA antisense strand sequence (underscore) and 6 sequences that continuous T is a termination signal with cU6-3 promotor 3 ' end (GACTAAGAGCATCGAGACTG) complementary sequence, coding siRNA positive-sense strand sequence (italic), 7nt, add restriction enzyme site (HindIII) in addition.

The siRNA downstream primer of table 1MDV gI and gE gene

Table.1?The?MDV?gI?and?gE?of?siRNAs?reverse?primers

Annotate: the downstream primer of an other irrelevant sequence cU6-3-shRNA-control is:

5 ' AAGCTTAAAAAA TTCTCCGAACGTGTCACGTCtcttga

GACTAAGAGCATCGAGACTG 3 ' is with this negative control sequence as this invention.

Obtain cU6-3-shRNAgI97, cU6-3-shRNAgI328, cU6-3-shRNAgI487, cU6-3-shRNAgI735, cU6-3-shRNAgI922 and cU6-3-shRNAgE172, cU6-3-shRNAgE328, cU6-3-shRNAgE461, cU6-3-shRNAgE936, cU6-3-shRNAgE1261, cU6-3-conshRNA totally 11 expression cassettes by above-mentioned upstream and downstream primer amplification, its pcr amplification result as shown in Figure 2.

3.siRNA the structure of expression plasmid carrier: with above-mentioned 10 cU6-3-siRNA PCR products and cU6-3-shRNA-control PCR negative control be connected with pGEM-T Easy carrier (available from Qiagen) respectively, transformed into escherichia coli competent cell DH5 α, the single bacterium colony of picking extracts plasmid, enzyme is cut evaluation, choose and identify that correct plasmid serves marine life Engineering Co., Ltd and carry out dna sequencing and measure, and the plasmid that will check order correct preservation is standby.

4.siRNA the experiment of expression plasmid (pGEM-T-cU6-3-shgI and pGEM-T-cU6-3-shgE) vitro inhibition gI-EGFP and gE-EGFP expressing fusion protein

(1) structure of reporter plasmid pEGFP-gE and pEGFP-gI:

Reporter plasmid is the fusion expression plasmid of green fluorescent protein (EGFP) and gI/gE (concrete gene order is seen shown in the step method 2), form by gI and the directed multiple clone site structure that inserts pEGFP-Cl (available from Biosciences Clontec) of gE gene cDNA, because EGFP is positioned at the upstream of gI and gE, and a shared promotor, so the expression of EGFP can reflect the expression of gI and gE indirectly.Its construction process is as follows:

Design of primers such as table 2, gI gene upstream and downstream primer adds HindIII and KpnI restriction enzyme site respectively; The gE gene is BglII and HindIII restriction enzyme site, with MDV-ZY virulent strain genomic dna is template pcr amplification gI and gE gene (with reference to MDV highly virulent strain RB1B accession number AY032626 design primer), and PCR product subclone is made up pMD18-T-gI and pMD18-T-gE in pMD18-T (available from TaKaRa).Cut with checking order through enzyme and to identify that correct plasmid and pEGFP-C1 are with identical restriction enzyme (gI:HindIII and KpnI; GE:BglII and HindIII) carry out double digestion and handle.Press the test kit specification sheets and reclaim gI (1068bp) and gE (1494bp) fragment, with the T4 dna ligase gene fragment that reclaims is connected with linearizing pEGFP-C1 carrier, transformed into escherichia coli DH5 α, the single colony inoculation of picking are in the LB nutrient solution that contains Kan, and 37 ℃ of shaking culture are spent the night.Extract plasmid, carry out double digestion and identify (as shown in Figure 3), and positive plasmid is checked order recombinant plasmid called after pEGFP-gI and pEGFP-gE.

Table 2 primer amplification table

(2) siRNA expression cassette PCR product and reporter plasmid cotransfection chick embryo fibroblast (CEF)

With the CEF cell (with SPF (specific pathogen free) chicken embryo idiosome through iodine disinfection, aseptic taking-up idiosome, remove head, four limbs and internal organ, all the other muscle mechanical process shred, and using 0.5% tryptic digestion behind the PBS flush away red corpuscle, and dispel into cell suspension with suction pipe, with PBS flush away trypsinase, be prepared into 1 * 10 with the DMEM that contains 10% serum ⁶The cell suspension of/ml) inoculation 24 porocyte culture plates (available from Invitrogen), when treating that cell density reaches 80%-90%, with siRNA expression cassette PCR product (cU6-3-shRNAgI97, cU6-3-shRNAgI328, cU6-3-shRNAgI487, cU6-3-shRNAgI735, cU6-3-shRNAgI922 and cU6-3-shRNAgE172, cU6-3-shRNAgE328, cU6-3-shRNAgE461, cU6-3-shRNAgE936, cU6-3-shRNAgE1261, cU6-3-conshRNA) respectively with the reporter plasmid pEGFP-gE of above-mentioned structure and pEGFP-gI with Lipofectamine 2000 (Invitrogen company) cotransfection CEF cell, working method reference reagent specification sheets, establish the negative control group of irrelevant shRNA target sequence and the blank group of not transfection plasmid simultaneously, every hole is provided with 3 repetitions.Change the DMEM that contains 10% new-born calf serum behind the 5h, continue to cultivate.Carry out fluorescence microscope and flow cytometry analysis behind the transfection 48h respectively.PEGFP-gE+cU6-3-shRNAgE936-PCR and pEGFP-gI+ cU6-3-shRNAgI735-PCR cotransfection groups of cells obviously weaken (as R among Fig. 4 than the specificity fluorescent intensity of blank group and negative control group, N), and the positive cell in other transfection holes express compare with negative control group change not obvious, gE in pEGFP-gE+cU6-3-shRNAgE936 and the pEGFP-gI+cU6-3-shRNAgI735 transfection group is described, the proteic expression of gI has been subjected to obvious suppression, and other gE, the gE of gI experiment interference group, the proteic expression of gI and blank are compared the inhibition that is subjected to negative control group not obvious (as shown in Figure 4, wherein Fig. 4-A is the blank group, Fig. 4-B is the gE negative control group, Fig. 4-C is the gI negative control group, and Fig. 4-F-J is a gE interference group, Fig. 4-F-J is a gI interference group).Flow cytometer carries out the detection by quantitative result and shows, more than two transfection hole fluorescencepositive cell numbers be respectively 9.3% and 8.5% and (see R among Fig. 5, N), compare (F:38.1% and K:40.5%) respectively with negative control group separately and obviously reduce, this and fluorescence microscope result demonstration match.Interference sequence-the cU6-3-shgE936 and the cU6-3-shgI735 arrestin expressional function that are preliminary screening are better than other interference experiment group sequences.

Above fluorescence microscope and flow cytometry analysis result have illustrated that all this research successfully filters out best siRNA sequence promptly: cU6-3-shgI735 and cU6-3-shgE936, also set up the quick siRNA screening of cover system.Not only saved loaded down with trivial details screening time, building process is simple and feasible also, provides significance for carrying out stable the interference.

(3) different clones are stablized interference experiment

Disturb the cU6-3-shgI735 and the cU6-3-shgE936 expression cassette of target sequence to be cloned into respectively on the pGEM-T Easy carrier with filtering out specificity, through the reorganization interference plasmid carrier difference called after pGEM-T-cU6-3-shgI735 that enzyme is cut and the evaluation of checking order is correct, (the order-checking collection of illustrative plates is seen Fig. 6 respectively to pGEM-T-cU6-3-shgE936, shown in 7), respectively with reporter plasmid pEGFP-gE and pEGFP-gI with Lipofectamine 2000 cotransfection duck embryo fibroblast passage cells (DF1), African green monkey kidney cell (Vero), Madin-Darby canine kidney(cell line) (MDCK) (MDCK) (Vet Biotechnology National Key Laboratory buys and preserves): DF1, Vero, mdck cell, 3 repetitions are established in every hole, transfection method is with identical shown in the 4-2, and 48h carries out fluorescence microscope after transfection respectively.If the pGEM-T-cU6-3-conshRNA negative control is observed gI and gE expressing fusion protein situation in the cultivation of pGEM-T-cU6-3-shRNA transfectional cell.

(4) interferon activity of specificity reorganization interference plasmid on different clones measured:

Reorganization interference plasmid carrier pGEM-T-cU6-3-shgI735 and pGEM-T-cU6-3-shgE936 plasmid respectively with reporter plasmid pEGFP-gE and pEGFP-gI with Lipofectamine 2000 cotransfection DF1, Vero, mdck cell 48h after, collect each porocyte respectively, wash 2 times with phosphate buffer soln (PBS), and the adjustment cell density is 10 ⁵-10 ⁶Cell/ml detects each porocyte average fluorescent strength with flow cytometer under the 488nm excitation wavelength.Shown in Fig. 8-A, the result shows, compares with negative control group, and two reorganization interference plasmid carriers all exist on different clones and suppress effect, but it is different to suppress effect.On the DF1 cell, siRNA expression plasmid pGEM-T-cU6-3-shRNA, promptly pGEM-T-cU6-3-shgI735 and pGEM-T-cU6-3-shgE936 are respectively 87.39% and 85.04% to the inhibiting rate ((1-experiment transfection group fused cell expression amount/negative control group fused cell expression amount) * 100%) of MDV gI and gE protein expression; On mdck cell, inhibiting rate is respectively 76.19% and 73.60%; On the Vero cell, inhibiting rate is respectively 60.09% and 58.57% (as Fig. 8-B).Interference plasmid group gI and gE protein expression on the DF1 cell all have been subjected to obvious suppression, and gI and gE protein expression also are subjected to a certain degree inhibition in MDCK, Vero cell, but it is low than the former to suppress effect, promptly has certain cell species specificity under same experimental conditions on the different cells.The result shows that fowl source U6 promotor drives the active the best of transcribing siRNA on the fowl source cell.

This research with gE-EGFP, gI-EGFP fusion rotein as reporter gene, adopt DF1, Vero, MDCK stable expression cell line, with fluorescence microscope and cells were tested by flow cytometry expressed fusion protein positive cell number, the result shows that fowl source U6 promotor can drive the expression of gene specific siRNA in the fowl source cell, has further determined the gE that filters out, the interference effect of gI gene specific siRNA interference sequence; Be target to obtain fowl U6 promotor in addition, by the transcriptional activity of the startup siRNA of comparative analysis fowl source U6 promotor on different sources clone, for the research of the gene silencing of the exploitation of avian origin promoter mediation provides reference frame.

The invention provides the siRNA new approaches that a kind of rapid screening expression of specific gene suppresses, not only saved loaded down with trivial details screening time, building process is simple and feasible also.

The present invention is directed to the siRNA sequence of gE and gI gene, can carry the siRNA sequence by forms such as liposome, bioabsorbable carrier material, virus vector.The present invention compared with prior art has following advantage and beneficial effect: the invention provides two siRNA sequences that can suppress the MDV protein gene effectively, having made up can stably express target gene expression carrier.Behind this carrier transfectional cell, screen, thereby obtain the cell strain of the siRNA of stably express, and make that the RNA interference effect time length is more of a specified duration, and lay the foundation for of the new generation vaccine research of utilization RNAi means at MDV by stable cell lines.

The present invention binds and closes most preferred embodiment and be described, and after having read foregoing of the present invention, those skilled in the art can do various modifications to the present invention, and these equivalent form of values fall within the appended claims of the present invention institute restricted portion equally.

Claims (11)

1. a specific specificity is disturbed the siRNA sequence of chicken Marek's disease virus gI gene, it is characterized in that described siRNA sequence is:

SigI735: positive-sense strand 5 ' CAATTCCCATGTCGATGCA 3 ' (SEQ ID NO:1)

Antisense strand 5 ' TGCATCGACATGGGAATTG 3 ' (SEQ ID NO:3).

2. a specific specificity is disturbed the siRNA sequence of chicken Marek's disease virus gE gene, it is characterized in that described siRNA sequence is: sigE936:

Positive-sense strand 5 ' AGATGTCCAGGTAGACGAT 3 '; (SEQ ID NO:2)

Antisense strand 5 ' ATCGTCTACCTGGACATCT 3 '.(SEQ?ID?NO：4)。

3. carrier that comprises claim 1 or 2 described siRNA sequences.

4. the described carrier of claim 3, it is a carrier for expression of eukaryon.

5. the carrier of claim 3 is characterized in that described carrier is the carrier based on pGEM-T Easy vector construction.

6. claim 1 or 2 described siRNA sequences, each described carrier is at the application in the gene studies of chicken Marek's disease virus among the claim 3-5.

7. claim 1 or 2 described siRNA sequences, each described carrier is used for the application of the recombinant vaccine of chicken Marek's disease virus among the claim 3-5 in preparation.

8. claim 1 or 2 described siRNA sequences, each described carrier is used for preventing or treating the application of the medicine of the disease that is caused by chicken Marek's disease virus among the claim 3-5 in preparation.

9. the described application of claim 8, the wherein said disease that is caused by chicken Marek's disease virus is a chicken Marek's disease.

10. medicine, it is used to prevent or treat the disease that is caused by chicken Marek's disease virus, comprises claim 1 or 2 described siRNA sequences, and each described carrier is as activeconstituents among the claim 3-5.

11. the described medicine of claim 10, the wherein said disease that is caused by chicken Marek's disease virus is a chicken Marek's disease.

Images