CN101333525B - SiRNA sequence against HCMV UL86 gene and applications - Google Patents

Abstract

The invention provides a cDNA sequence of siRNA aiming at a cytomegalovirus UL86 gene of human, and the nucleotide sequence is: 5'-GCACGTCAGTTATCATCAACA-3'. According to the design principle of the siRNA, the cDNA sequence of the selected siRNA has a GC content of 42.9 percent, and the selected siRNA is corresponding to 3161-3181 nucleotide sites in UL86 mRNA, siRNA eukaryotic expression vectors aiming at the HCMV UL86 gene are constructed, and plasmids are extracted after transforming Escherichia coli for transfecting AD293 cells, thereby effectively inhibiting the UL86 gene mRNA and the protein expression level, and the sequence can be applied to the preparation of drugs for curing cytomegalovirus infection of human.

Description

SiRNA sequence and application at HCMV UL86 gene

Technical field

The invention belongs to biotechnology, relate to molecular biology and gene engineering technology field, be specifically related at design, the screening of the siRNA sequence of human cytomegalic inclusion disease virus UL86 gene and suppress the application of human cytomegalic inclusion disease virus in vivo and in vitro.

Background technology

Human cytomegalic inclusion disease virus (HCMV) belongs to Betaherperesvirinae, infects extensively in the crowd, but mostly is asymptomatic subclinical infection greatly.HCMV infects then can cause the serious disease of multisystem in the crowd (as AIDS, organ transplantation patient etc.) of immunologic hypofunction, and may be relevant with the generation of multiple malignant tumour.Simultaneously, HCMV also is the topmost infectious factors that causes in congenital malformation and newborn infant's inborn defect.Therefore, control HCMV infection is one of focus of domestic and international medical attention always.At present, the medicine of HCMV mainly comprise ganciclovir (ganciclovir, GCV), Trisodium phosphonoformate hexahydrate (fascarnet, FOS) and cidofovir (cidofovir, CDV), but because the appearance of poisonous side effect of medicine and HCMV persister, urgent need is explored new treatment approach control HCMV and is infected.

The genomic expression of HCMV has certain sequential, albumen mutually in the time of can being divided at once three kinds of early stage (IE), early stage (E) and late periods (L).A kind of important late protein of UL86 coding HCMV---main capsid protein (major capsid protein, MCP).MCP is the important structure albumen that constitutes the HCMV virion, also is simultaneously one of major antigen that the HCMV stimulation of host produces specific antibody in the course of infection, and is significant to the interaction of research HCMV and host immune system.

(RNA interference is that sequence-specific double-stranded RNA (dsRNA) makes degradation of homologous mRNA in the cell RNAi), thereby produces the process of expression of specific gene silence in the RNA interference.It is the sequence-specific immunoprotection mechanism of a kind of microRNA mediation of body, can resist the genic effect of invasive.Since 1998 were in the news first, the RNAi technology was applied to rapidly in the research of antiviral and related fields with its distinctive superiority, makes important progress in the antiviral research of HIV, HBV, HCV, influenza virus etc. at present.

The effect of RNAi is mainly by the dsRNA mediation that is about 21～23nt, and wherein a class is called siRNA (small interfering RNA, siRNA), it and purpose mRNA sequence have strict pairing, can cause the corresponding mRNA degraded.Because the specificity degraded that RNAi is siRNA targeting mRNA to be caused, the key that therefore will produce effective RNAi is to select suitable siRNA action target spot.At present the selection principle of RNAi target spot may be summarized to be following some: 1. select the mRNA zone of GC content about 50%; 2. avoid selecting the initial position of promotor downstream 50～100nt with the zone in interior or the terminator upstream 50～100nt; 3. avoid surpassing the overlapping of three G or three C the reticent mechanism of RNA interfering i because poly G or poly C can form the class polymers; 4. select the sequence that begins with two AA, this will make synthetic siRNA be more prone to; 5. guarantee that target sequence and other genes do not have homology.

At present, the method for preparing siRNA mainly contains 5 kinds: 1. chemical synthesis: directly by the RNA single strand of synthetic two the complementary 21～23nt of chemical process, annealing forms double-stranded siRNA then, and shortcoming is to cost an arm and a leg; 2. in-vitro transcription method: with Oligo DNA is template, and in-vitro transcription is synthesized siRNA, this method efficient height, but be not suitable for big quantity research; 3. long segment dsRNA is through RNase III edman degradation Edman: after the said target mrna of 200～1000bp is equipped with the in-vitro transcription legal system, carry out external digestion with RNase III again, obtain the mixture of different siRNA, this method is not suitable for the research of specific siRNA, might cause non-specific gene silencing yet; 4. siRNA expression vector method: plasmid by will containing the rna plymerase iii promotor or virus vector transfection are in host cell, transcribe out short hairpin RNA (short hairpin RNA, shRNA), shRNA is cut into siRNA by the Dicer enzyme and plays a role in born of the same parents, this method has the advantage that can increase in a large number and study for a long time; 5. the siRNA expression cassette method of PCR preparation: obtain by PCR method and comprise rna plymerase iii promotor, the dna profiling of coding shRNA and the expression framework of rna plymerase iii termination site, be transcribed into siRNA in the transfered cell then, its advantage is a simple and fast, but has the potentially dangerous of gene integration.

Summary of the invention

The purpose of this invention is to provide the cDNA sequence at effective siRNA of HCMV UL86 gene, its nucleotide sequence is: 5 '-GCACGTCAGTTATCATCAACA-3 '.

Another object of the present invention provides this cDNA sequence in the heavy application of preparation treatment human cytomegalovirus infection's medicine.

The present invention is according to the siRNA principle of design, structure extracts plasmid at the siRNA carrier for expression of eukaryon of HCMV UL86 gene behind the transformed into escherichia coli, transfection AD293 cell, can effectively suppress UL86 gene mRNA and protein expression level, therefore can be applicable to the preparation of HCMV medicine.

Usefulness of the present invention is: the siRNA sequence that provides is at the main capsid protein encoding gene UL86 of HCMV, and still useless siRNA expression vector method is screened the report of the effective siRNA sequence of HCMV UL86 gene both at home and abroad at present.Have in cell based on the carrier for expression of eukaryon of this sequence and to continue, effectively suppress the advantage of UL86 gene mRNA and protein expression, so can be used as the novel targets that the HCMV medicine is developed.

Embodiment

The present invention is further described in conjunction with the embodiments.

Embodiment one siRNA carrier for expression of eukaryon vitro inhibition UL86-EGFP Expression of Fusion Protein

1.siRNA design: according to the siRNA principle of design, from UL86mRNA initiator codon AUG downstream 100nt search AA sequence, the adjacent 21nt sequence of its 3 ' end is as candidate's target spot, therefrom select GC content in 40～55% siRNA sequence, and compare by the Blast function and the human genomic sequence of GenBank database, guaranteeing does not have homology.Final its cDNA sequence of siRNA of selecting is 5 '-GCACGTCAGTTATCATCAACA-3 ', and GC content is 42.9%, 3161-3181 nucleotide site among the corresponding UL86 mRNA.

2. express the synthetic and preparation of the required shDNA of siRNA: the positive-sense strand sequence of expressing the required shDNA of siRNA is:

5’-GATCC GCACGTCAGTTATCATCAACATTCG TGTTGATGATAACTGACGT GCTTTTTA-3’，

The antisense strand sequence is:

5 '-AGCTTAAAAA GCACGTCAGTTATCATCAACACGAA TGTTGATGATAAC TGACGTGCG-3 ' after trust biotech firm is synthetic, forms positive and negative adopted chain annealing double-stranded.

3.siRNA Construction of eukaryotic: eukaryon expression plasmid pSilencer2.0-U6 (U.S. Ambion company) BamH I and Hind III double digestion with U6 promotor, be connected with the shDNA after the annealing is double-stranded, transformed into escherichia coli competent cell DH5 α, 37 ℃ of overnight incubation, picking clone extracting plasmid is served Hai Yingjun company and is carried out the dna sequencing evaluation, chooses the correct plasmid amplification of sequencing result, preservation.

4.siRNA the experiment of expression plasmid vitro inhibition UL86-EGFP expressing fusion protein

(1) reporter plasmid pUL86-EGFP: be the plasmid of expressing green fluorescent protein (EGFP) and UL86 fusion rotein, the HindIII and the EcoR I site structure that are inserted pEGFP-N1 (U.S. Clontech company) by the UL86 gene cDNA form, because EGFP is positioned at the downstream of UL86, and a shared promotor, so the expression of EGFP can reflect the expression of UL86 indirectly.

(2) siRNA expression plasmid and reporter plasmid cotransfection AD293 cell: after HEKC AD293 inoculates 12 porocyte culture plates, treat that cell reaches 80%～90% fusion rate, with the Lipofectamine of Invitrogen company 2000 reagent with siRNA expression plasmid and reporter plasmid pUL86-EGFP cotransfection cell, working method reference reagent specification sheets, establish the negative control group of transfection empty plasmid pSilencer 2.0-U6 and the blank group of not transfection plasmid simultaneously, change nutrient solution (DMEM that contains 10% new-born calf serum) after 5 hours and continue to cultivate.

(3) fluorescence quantitative RT-RCR detects the expression of UL86 mRNA in the AD293 cell: 48h behind the plasmid transfection, collect the AD293 cell, Trizol method extracting cell total rna, the SYBR PrimeScript RT-RCP Kit of employing TAKARA company detects the mRNA of viral UL86, experimental technique reference reagent box specification sheets.UL86 gene PCR primer sequence is:

Upstream primer sequence: 5 '-GACGCTGGCCGCCATGTTAT-3 ',

Downstream primer sequence: 5 '-GCATTGCGCTCGGACATGCT-3 '.

Internal reference adopts GAPDH, and the PCR primer sequence is:

Upstream primer sequence: 5 '-GAAGGTGAAGGTCGGAGTC-3 ',

Downstream primer sequence: 5 '-GAAGATGGTGATGGGATTTC-3 '.

The result shows, compares with negative control group, and the siRNA expression plasmid is 56.6% to the inhibiting rate that UL86 mRNA expresses.

(4) flow cytometer detects UL86 protein expression situation in the AD293 cell: 72h behind the plasmid transfection, collect every hole inner cell, and be resuspended among the PBS after washing 2 times with the PBS damping fluid.Under the 488nm excitation wavelength, detect every porocyte average fluorescent strength (mean fluorescence intensity with flow cytometer, MFI) and fluorescencepositive cell ratio α, calculate every porocyte total fluorescence intensity (total fluorescenceintensity, TFI)=MFI * α.The result shows that compare with negative control group, the siRNA expression plasmid is 74.2% to the inhibiting rate of UL86 protein expression.

The present invention binds and closes most preferred embodiment and be described, and after having read foregoing of the present invention, those skilled in the art can do various modifications to the present invention, and these equivalent form of values fall within the appended claims of the present invention institute restricted portion equally.

The sequence that the present invention relates to:

<210>1

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉according to the cDNA sequence of the siRNA of HCMV UL86 gene design

<400>1

GCACGTCAGT?TATCATCAAC?A 21

<210>2

<211>57

<212>DNA

＜213〉artificial sequence

<220>

＜223〉sequence of the required shDNA positive-sense strand of preparation UL86 gene siRNA

<400>2

GATCCGCACG?TCAGTTATCA?TCAACATTCG?TGTTGATGAT?AACTGACGTG?CTTTTTA 57

<210>3

<211>57

<212>DNA

＜213〉artificial sequence

<220>

＜223〉sequence of the required shDNA antisense strand of preparation UL86 gene siRNA

<400>3

AGCTTAAAAA?GCACGTCAGT?TATCATCAAC?ACGAATGTTG?ATGATAACTG?ACGTGCG 57

<210>4

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉UL86 gene PCR upstream primer sequence

<400>4

GACGCTGGCC?GCCATGTTAT 20

<210>5

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉UL86 gene PCR downstream primer sequence

<400>5

GCATTGCGCT?CGGACATGCT 20

<210>6

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAPDH gene PCR upstream primer sequence

<400>6

GAAGGTGAAG?GTCGGAGTC 19

<210>7

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉GAPDH gene PCR downstream primer sequence

<400>7

GAAGATGGTG?ATGGGATTTC 20

Claims (2)

1. cDNA at the siRNA of human cytomegalic inclusion disease virus UL86 gene, its nucleotide sequence is: 5 '-GCACGTCAGTTATCATCAACA-3 '.

2. the application of the described cDNA of claim 1 in preparation treatment human cytomegalovirus infection's medicine.