JP6483019B2 - Novel adenovirus and method for promoting its growth - Google Patents

Description

  The present invention relates to an adenovirus (hereinafter referred to as “Ad”) capable of effectively growing in a desired cell. Furthermore, it relates to a method for promoting the proliferation of Ad.

  This application claims the Japanese application Japanese Patent Application No. 2013-172810 priority which is used here by reference.

  In recent years, development of gene therapy for various diseases has been attempted. The key to developing a gene therapy method is to develop a technology for safely and efficiently delivering a therapeutic gene to a target tissue or cell, but there are still many problems to be overcome.

  Ad vectors are used for gene transformation research and production of genetically engineered cells for industrial use as gene transfer vectors due to their excellent gene transfer characteristics, and also applicable to various diseases as gene therapy vectors. Is expected. On the other hand, the limited growth type Ad is characterized in that it does not grow on normal cells but grows only on tumor cells or special cells. Ad (type 2 or type 5) infection begins when the knob on the tip of the fiber protruding from the viral protein shell (capsid) adsorbs to the cell surface coxsackie-adenovirus receptor (CAR). The penton base at the base of the fiber binds and enters the cell. The lysosome is then acidified to escape from the lysosome, the viral genome reaches the nucleus, and genome replication begins. Compared to other DNA viruses, Ad has a higher efficiency of translocation of the viral genome into the nucleus, and as a result, it is considered to have a high gene transfer efficiency as a vector.

Ad replication begins by first expressing the E1A protein and transactivating the expression of all other early proteins, E1B, E2, E3 and E4. Since the E1 substitution vector generally applied lacks E1A and E1B, HEK293 cells in which the E1 protein is constitutively expressed can replicate almost the same as the wild type. In cells other than HEK293 cells, the vector genome is efficiently transferred into the nucleus according to the previous invasion method, but since no protein expression from all subsequent viruses occurs, it does not replicate as a virus. Such vectors are classified as non-proliferating.
On the other hand, attempts have been made to replicate Ad only in tumor cells and kill the tumor cells. Restricted growth type Ad, which does not proliferate in normal cells but specifically kills tumor cells by infecting and proliferating in tumor cells, is expected as a next-generation tumor therapeutic agent. For example, E1B mutant viruses that can grow only in p53-deficient cells and E1A are expressed from tumor cell-specific promoters, and restricted-proliferation type Ad has been developed that replicates only in tumor cells. Furthermore, a technology has been developed in which a reporter gene such as GFP is mounted on a restricted growth type Ad, and is replicated only in tumor cells so that GFP is produced and fluorescent light is emitted to detect tumor cells. However, the conventional limited growth type Ad has a problem that a sufficient therapeutic effect cannot be obtained due to a slow growth rate in tumor cells.

  Also, Ad production packaging cells for producing restricted-proliferation type Ad, non-proliferation type Ad or other Ad used for gene transfer vectors, gene therapy vectors, tumor therapeutic agents, tumor detection agents, and other uses However, since the growth rate of Ad is slow, a sufficient amount of Ad cannot be obtained effectively.

VA-RNA, which is a small molecule RNA, can be cited as a viral factor that promotes Ad growth. VA-RNA includes VA-RNA I and VA-RNA II, both of which are untranslated RNA polymerase III transcripts (single-stranded RNA) of about 160 bases in length, especially VA-RNA I, which has a large amount of transcription Reaches ~ 10 ⁸ molecules per cell during Ad replication. VA-RNA I plays a central role in inhibiting the activation of protein kinase R (protein kinase R: PKR) as an antiviral response of host cells during Ad replication, and in the absence of VA-RNA I It has been reported that PKR is activated and phosphorylation of the translation initiation factor eIF-2α is induced, resulting in inhibition of translation of viral mRNA (Non-patent Documents 1 and 2). That is, it is considered that VA-RNA promotes the translation of the viral gene by inhibiting PKR and thus promotes the growth of the virus. It has also been reported that VA-RNA inhibits ADAR (RNA-specific adenosine deaminase) (Non-patent Document 3).

  After VA-RNA is transcribed in the nucleus, it is exported to the nucleus, that is, to the cytoplasm by Exportin-5 (XPO5), which is a nuclear export protein, and then cleaved by Dicer to form mivaRNA (viral miRNA) It has been reported that RISC (RNA-induced silencing complex) is formed with Ago (Argonaute) protein (Non-patent Document 4). It has been reported that mivaRNA incorporated into RISC controls the gene expression of infected cells by the same mechanism as miRNA (microRNA) and promotes virus growth (Non-patent Document 5). Probably, this was considered that mivaRNA controls the gene expression of infected cells by the same mechanism as miRNA, making the infected cells an environment suitable for virus propagation (Non-patent Document 6). In fact, the growth of Ad is suppressed by introducing mivaRNA antisense oligonucleotides into cells.

  Compared to conventional restricted growth type Ad, development of restricted growth type Ad having high growth ability that promotes virus growth in target tumor cells and enhances the antitumor effect is demanded.

Akusjarvi G et al., Mol Cell Biol. 1987 Jan; 7 (1): 549-51 Kitajewski J et al., Cell. 1986 Apr 25; 45 (2): 195-200 Lei M et al., Virology. 1998 Jun 5; 245 (2): 188-96 Shihua Lu et al., J Virol. 2004 December; 78 (23): 12868-12876 Aparicio O et al., Nucleic Acids Res. 2010 Jan; 38 (3): 750-63.doi: 10.1093 / nar / gkp1028. Epub 2009 Nov 19. Aparicio O et al., J Virol. 2006 Feb; 80 (3): 1376-84

  An object of the present invention is to provide Ad that can effectively proliferate in desired cells such as target tumor cells. Another object of the present invention is to provide a method for promoting the growth of Ad, in which Ad is effectively propagated in desired cells. Furthermore, an object of the present invention is to provide an Ad-producing packaging cell that can effectively proliferate Ad.

  In order to solve the above-mentioned problems, the present inventors focused on the relationship between Ad-derived mivaRNA and virus growth in the Ad genome, and as a result of intensive studies, conventionally, Ad-derived mivaRNA has suppressed gene expression in infected cells. Despite being thought to promote virus growth (Non-Patent Documents 5 and 6), surprisingly, Ad effectively proliferated in cells by suppressing the function of Ad-derived mivaRNA. The inventors have found that the problems can be solved and completed the present invention. Moreover, it discovered that the viral growth promotion effect of VA-RNA can be acquired by suppressing the cutting | disconnection of Ad origin VA-RNA.

That is, this invention consists of the following.
1. A method for promoting the growth of adenovirus, comprising suppressing the function of adenovirus-derived mivaRNA.
2. A method for promoting the growth of adenovirus, wherein the method promotes the growth of adenovirus by inhibiting miR-27a and / or miR-27b.
3. 3. The method of promoting the growth of adenovirus according to item 1 or 2, wherein suppressing mivaRNA function or inhibiting miR-27a and / or miR-27b inhibits at least one of Dicer and Ago2.
4). 4. The method for promoting the growth of adenovirus according to item 3, wherein the inhibition of Dicer or Ago2 is inhibition of Dicer or Ago2 by RNA interference.
5. Inhibition of Dicer or Ago2 by RNA interference is inhibition by siRNA against Dicer or Ago2, and siRNA against Dicer or Ago2 is introduced into the siRNA against Dicer or Ago2 mounted on the adenovirus, into adenovirus-producing packaging cells 5. The method for promoting the growth of adenovirus according to item 4 above, which is a siRNA against Dicer or Ago2, or an siRNA against Dicer or Ago2.
6). 4. The method for promoting the growth of adenovirus according to item 3, wherein the inhibition of Dicer or Ago2 is inhibition by knockout of Dicer gene or Ago2 gene in a packaging cell for producing adenovirus.
7). 4. The method for promoting the growth of adenovirus according to item 3 above, wherein the inhibition of Dicer or Ago2 is inhibition by a Dicer or Ago2 antibody, or inhibition by a Dicer or Ago2 inhibitor.
8). 3. The method for promoting the growth of an adenovirus according to item 2, wherein the inhibition of miR-27a or miR-27b is inhibition by a decoy nucleic acid for miR-27a or miR-27b, or an inhibitor for miR-27a or miR-27b.
9. An adenovirus comprising an siRNA expression cassette for Dicer or Ago2 or a decoy nucleic acid expression cassette for miR-27a or miR-27b in the adenovirus genome.
10. The siRNA for Dicer is RNA containing the oligonucleotide shown in 1) or 2) below, and the siRNA for Ago2 is RNA containing the oligonucleotide shown in 3) or 4) below, and the decoy nucleic acid for miR-27a Is an RNA containing the oligonucleotide shown in 5) below, and the decoy nucleic acid against miR-27b is an RNA containing the oligonucleotide shown in 6) below;
1) GAAUCAGCCUCGCAACAAA (SEQ ID NO: 1)
2) UUUGUUGCGAGGCUGAUUC (SEQ ID NO: 2)
3) GCACGGAAGUCCAUCUGAA (SEQ ID NO: 3)
4) UUCAGAUGGACUUCCGUGC (SEQ ID NO: 4)
5) GCGGAACUUAGAUCUCCACUGUGAA (SEQ ID NO: 10)
6) GCAGAACUUAGAUCUCCACUGUGAA (SEQ ID NO: 11)
11. 11. The adenovirus according to item 9 or 10 above, wherein the adenovirus is a restricted propagation adenovirus.
12 An antitumor agent or tumor detection agent comprising the restricted-proliferative adenovirus according to item 11 as an active ingredient.
13. In the genome of adenovirus-producing packaging cells, an adenovirus is produced, characterized in that at least an expression cassette of siRNA for Dicer or Ago2 or an expression cassette of miR-27a or miR-27b decoy nucleic acid is introduced Packaging cells to do.
14 The siRNA for Dicer is RNA containing the oligonucleotide shown in 1) or 2) below, and the siRNA for Ago2 is RNA containing the oligonucleotide shown in 3) or 4) below, and the decoy nucleic acid for miR-27a Is a RNA containing the oligonucleotide shown in 5) below, and the decoy nucleic acid against miR-27b is an RNA containing the oligonucleotide shown in 6) below:
1) GAAUCAGCCUCGCAACAAA (SEQ ID NO: 1)
2) UUUGUUGCGAGGCUGAUUC (SEQ ID NO: 2)
3) GCACGGAAGUCCAUCUGAA (SEQ ID NO: 3)
4) UUCAGAUGGACUUCCGUGC (SEQ ID NO: 4)
5) GCGGAACUUAGAUCUCCACUGUGAA (SEQ ID NO: 10)
6) GCAGAACUUAGAUCUCCACUGUGAA (SEQ ID NO: 11)
15. A packaging cell for producing an adenovirus, characterized in that either Dicer or Ago2 gene or miR-27a or miR-27b is knocked out in the genome of the packaging cell for producing adenovirus.

Furthermore, the present invention includes the following concepts.
A. 12 above. A method for treating a malignant tumor, comprising administering the antitumor agent according to 1.
B. A method for producing Ad, comprising a step of suppressing the function of Ad-derived mivaRNA in a system that produces Ad using an Ad genome and an Ad-producing packaging cell.
C. A method for producing Ad, comprising a step of inhibiting miR-27a and / or miR-27b in a system that produces Ad using an Ad genome and an Ad-producing packaging cell.
D. The production method according to item B or C, wherein the step of suppressing the function of Ad-derived mivaRNA or the step of inhibiting miR-27a and / or miR-27b is a step of inhibiting Dicer or Ago2.
E. The method for producing Ad according to item D, wherein the inhibition of Dicer or Ago2 is inhibition of Dicer or Ago2 by RNA interference.
F. Inhibition of Dicer or Ago2 by RNA interference is due to the expression of siRNA against Dicer mounted on Ad or the expression of siRNA against Ago2, or the expression of siRNA against Dicer or the siRNA against Ago2 introduced into Ad production packaging cells. The Ad production method according to item E above.
G. The production method according to item D, wherein the inhibition of Dicer or Ago2 is inhibition by knockout of the Dicer gene or Ago2 gene in Ad production packaging cells.
H. The production method according to item D, wherein the inhibition of Dicer or Ago2 is inhibition by an antibody of Dicer or Ago2, or inhibition by an inhibitor of Dicer or Ago2.
I. The production method according to item C, wherein the inhibition of miR-27a or miR-27b is inhibition by a decoy nucleic acid for miR-27a or miR-27b, or an inhibitor for miR-27a or miR-27b.

  The Ad of the present invention can promote the proliferation of Ad more effectively than the conventional Ad. According to the antitumor agent containing Ad of the present invention as an active ingredient, proliferation is effectively promoted in the target tumor cells, and an antitumor effect is exhibited.

  According to the method for promoting the proliferation of Ad of the present invention, it is possible to effectively promote the proliferation of Ad as compared with the conventional method. If Ad can be effectively proliferated in the desired cells, such as target tumor cells and Ad proliferation cells, it will effectively demonstrate anti-malignant tumor effects such as tumor lysis, tumor detection effects, and efficient Ad production effects Yes.

It is a figure which shows typically the structure of the genome of Ad carrying shRNA (short hairpin RNA) with respect to Dicer (Hereinafter, Ad produced in Example 1 is called "Ad-shDicer".). (Example 1) It is a figure which shows the result of having confirmed the genome growth ability of Ad-shDicer in various human cancer cells. (Experimental example 1-1) It is a figure which shows the result of having confirmed the cell survival rate when making Ad-shDicer act on various human cancer cells. (Experimental example 1-2) It is a figure which shows the result of having confirmed the cell survival rate when making Ad-shDicer act on various human normal cells. (Experimental example 1-2) It is a figure which shows the relative value by measuring the amount of Dicer mRNA when making Ad-shDicer act on various cancer cells. (Experimental Example 1-3) It is a conceptual diagram which shows the process in which Ad-derived VA-RNA is cleaved by Dicer and forms an Ago2 protein and RISC complex. (Experimental Example 1-4) It is a figure which shows the result of having confirmed the viral genome amount when adding wild type Ad to the said various cells made to interfere with RNA by siRNA introduction | transduction with respect to Ago2, Dicer, or XPO5 in various cancer cells. (Experimental Example 1-4) It is a figure which shows the result of having confirmed the influence which it has on the production of Ad origin VA-RNA I or VA-RNA II when introducing siRNA with respect to Ago2 or Dicer into various cancer cells by electrophoresis. (Experimental Example 1-4) It is a figure which shows the result of having confirmed the relative expression level of Ad origin mivaRNA I or mivaRNA II when siRNA with respect to Ago2 or Dicer is introduce | transduced into various cancer cells. (Experimental Example 1-4) It is a figure which shows the result of having confirmed the viral genome amount when adding wild-type Ad to each said cell which introduce | transduced the shDicer expression cassette into each cancer cell, and was made to interfere with RNA. (Experimental example 1-5) It is a figure which shows the result of having confirmed the viral genome amount when adding wild-type Ad to each cell when Ago2 or Dicer is overexpressed in various cancer cells. (Comparative Example 1) It is a figure which shows the result of having confirmed the cell killing effect with respect to the cancer cell of Ad-shDicer. (Example 2) It is a figure which shows the result of having confirmed the anticancer effect | action with respect to various cancer cells of Ad-shDicer. Example 3 It is a figure which shows the result of having confirmed the expression level of miR-27a, b in a Dicer knockdown cell. (Reference Example 1) It is a figure which shows the result of having confirmed the overexpression of VA-RNA and the influence which acts on Dicer and miR-27a, b. A: It is a figure which shows that the expression level of miR-27a, b reduces by overexpression of VA-RNA. B: It is a figure which shows that the expression level of miR-27a, b reduces by VA-RNA. (Reference Example 2) It is a figure which shows the result of having confirmed the relationship with the expression level of miR-27a, b by the infection of Ad. (Reference Example 3) It is a figure which shows the result confirmed about the influence which miR-27a, b has on the proliferation of Ad. (Reference Example 4) The genome structure of an Ad carrying a tough decoy RNA for miR-27a or miR-27b (hereinafter, the Ad produced in Example 4 is referred to as “Oncolytic Ad-TuD-27a” or “Oncolytic Ad-TuD-27b”). It is a figure shown typically. (Example 4) It is a figure which shows the result of having confirmed the cancer cell survival rate when making Oncolytic Ad-TuD-27a or Oncolytic Ad-TuD-27b act. (Experimental example 4-1) It is a figure as a result of confirming Ad genome growth ability in a cancer cell by Oncolytic Ad-TuD-27a or Oncolytic Ad-TuD-27b. (Experimental example 4-2)

  In this specification, “Ad” means an adenovirus, and “Ad genome” refers to genetic information possessed by Ad, that is, a DNA sequence contained in Ad.

  The present invention relates to a method for promoting the proliferation of Ad, comprising suppressing the function of Ad-derived mivaRNA. In the present specification, “suppressing the function of mivaRNA” means “inhibition of mivaRNA production” or “inhibition of mivaRNA activity”. Specifically, it means “inhibition of mivaRNA production by inhibiting cleavage of VA-RNA” or “inhibition of mivaRNA activity by inhibiting RISC formation of mivaRNA and Ago2.” Such “suppressing the function of mivaRNA” is achieved by inhibiting at least one of Dicer and Ago2. In addition, by inhibiting Dicer, “inhibiting cleavage of VA-RNA”, it is possible to obtain a virus growth promoting effect of VA-RNA.

  The present invention also relates to a method for promoting the proliferation of Ad by inhibiting miR-27a and / or miR-27b. In this specification, inhibition of miR-27a and / or miR-27b is achieved by inhibiting at least one of Dicer and Ago2. Other methods include, for example, inhibition by mico-27a or miR-27b described later with a decoy nucleic acid, inhibition with an inhibitor against miR-27a or miR-27b, inhibition by miR-27a or miR-27b knockout, etc. .

  The method for inhibiting Dicer or Ago2 is not particularly limited, but for example, inhibition by RNA interference with Dicer or Ago2, inhibition by Dicer gene or Ago2 gene knockout, or inhibition by using antibodies or inhibitors against Dicer or Ago2 etc. Can be mentioned. Inhibition by RNA interference and inhibition by gene knockout are preferred, and inhibition by RNA interference is most preferred. Inhibition by RNA interference with Dicer or Ago2 can be achieved by allowing the Ad genome or Ad producing cells to act with siRNA against Dicer or Ago2. In order to cause siRNA to act on Dicer or Ago2, an siRNA expression cassette for Dicer or Ago2 can be mounted on the Ad genome or introduced into an Ad-producing cell. Moreover, siRNA for Dicer or Ago2 may be added to the culture system of Ad-producing cells.

  The siRNA for Dicer or Ago2 may be any siRNA having an RNA interference function for Dicer or Ago2, and is not particularly limited, and may be any siRNA known per se or developed in the future. Examples of siRNA and shRNA having an RNA interference function for Dicer known per se include shRNAs shown in the following papers. Inhibition by RNA interference on Dicer or Ago2 and inhibition by knockout of Dicer gene or Ago2 gene are known methods such as Nucleic Acids Research, (2006) Vol. 34, No. 17 4801-4815 (doi: 10.1093). / nar / gkl646), Cell 141, 1195-1207, June 25 (2010), Molecular Therapy vol. 17 no. 4, 725-732 apr. (2009), Nucleic Acids Research, Vol. 38, No. 21, 7736 -7748 (2010), Nucleic Acids Research, Vol. 38, No. 15 5141-5151 (2010), PNAS, vol.107, no.17, 7904-7909, April 27, (2010), JOURNAL OF VIROLOGY, Vol 85, No. 5, p.2342-2350, Mar. (2011), PLoS ONE 8 (3): e59445. Doi: 10.1371 / journal.pone.0059445 and the like can be referred to. In addition, as for shRNA against Dicer or shRNA against Ago2, those shown in these documents can be appropriately selected and used.

Specific examples of siRNA against Dicer include oligonucleotides having the base sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 below.
・ GAAUCAGCCUCGCAACAAA (SEQ ID NO: 1)
・ UUUGUUGCGAGGCUGAUUC (SEQ ID NO: 2)
In order to express siRNA against Dicer in Ad or cells by gene recombination techniques, for example, an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 5 is used as a vector based on the sequence of shRNA that is the precursor of siRNA. It can be mounted and used. The base sequence shown in SEQ ID NO: 6 or 7 is the base sequence of the underlined part in SEQ ID NO: 5, and this part is considered to be the most important part in RNA interference action.
GATCCC GAATCAGCCTCGCAACAAA TTCAAGAGA TTTGTTGCGAGGCTGATTC TTTTTGGAAAT (SEQ ID NO: 5)
GAATCAGCCTCGCAACAAA (SEQ ID NO: 6)
・ TTTGTTGCGAGGCTGATTC (SEQ ID NO: 7)

Specific examples of siRNA against Ago2 include oligonucleotides comprising the nucleotide sequence shown in SEQ ID NO: 3 or SEQ ID NO: 4 below. GCACGGAAGUCCAUCUGAA (SEQ ID NO: 3)
・ UUCAGAUGGACUUCCGUGC (SEQ ID NO: 4)

  In the “method for promoting the proliferation of Ad”, when Dicer or Ago2 is inhibited using RNA interference, it can be achieved by inhibition by expression of siRNA against Dicer or Ago2 mounted on Ad. Similarly, it can be achieved by expression of siRNA against Dicer or Ago2 introduced into packaging cells for producing Ad. Specific examples of siRNA against Dicer or Ago2 are as described above. Here, the “expression of siRNA against Dicer or Ago2” may be an siRNA expression cassette containing siRNA against Dicer or Ago2. The siRNA expression cassette containing “siRNA against Dicer or Ago2” may be, for example, an siRNA expression cassette containing “siRNA against Dicer or Ago2,” or an siRNA expression cassette containing “shRNA against Dicer or Ago2.” There may be. Since shRNA is a precursor of siRNA, it is also included in “expression of siRNA” in this specification that siRNA is produced after shRNA is expressed.

  In the method of promoting Ad growth, when Dicer or Ago2 is inhibited using a Dicer or Ago2 antibody, or a Dicer or Ago2 inhibitor, a known antibody or inhibitor (decoy nucleic acid or aptamer nucleic acid is used). Can be used). By inhibiting Dicer or Ago2 of Ad proliferation cells with the antibody or the inhibitor, Ad proliferation in the Ad proliferation cells can be promoted.

In the method of promoting Ad proliferation, when miR-27a or miR-27b is inhibited, inhibition by mico-27a or miR-27b by decoy nucleic acid, inhibition by miR-27a or miR-27b inhibitor Can be mentioned. For example, a decoy nucleic acid against miR-27a or miR-27b can act on Ad to inhibit miR-27a or miR-27b. Specifically, a decoy nucleic acid expression cassette for miR-27a or miR-27b can be mounted on the Ad genome or introduced into Ad-producing cells. In addition, as an inhibitor against miR-27a or miR-27b, an antisense oligonucleotide against miR-27a or miR-27b, or a reagent commercially available as an inhibitor of miR-27a or miR-27b, such as miRVana miRNA inhibitor (Ambion) may be used.

  The decoy nucleic acid for miR-27a may be a sequence containing at least one or more of the base sequence shown in SEQ ID NO: 10. Specific examples of the decoy nucleic acid for miR-27a include an oligonucleotide having the base sequence shown in SEQ ID NO: 12 below. The underlined part of SEQ ID NO: 12 is an antisense sequence for miR-27a, which corresponds to the base sequence shown in SEQ ID NO: 10. In addition, the decoy nucleic acid for miR-27b may be a sequence containing at least one or more of the base sequence shown in SEQ ID NO: 11. Similarly, a specific example of a decoy nucleic acid for miR-27b includes an oligonucleotide having the base sequence shown in SEQ ID NO: 13 below. The underlined part of SEQ ID NO: 13 is an antisense sequence for miR-27b and corresponds to the base sequence shown in SEQ ID NO: 11. In order to express a decoy nucleic acid for miR-27a or miR-27b in Ad or a cell by a genetic recombination technique, an oligonucleotide necessary as appropriate may be included.

GCGCAACUUAGAUCUCCACUGUGAA (SEQ ID NO: 10)
GCAGAACUUAGAUCUCCACUGUGAA (SEQ ID NO: 11)
・ GACGGCGCUAGGAUCAUCAAC GCGGAACUUAGAUCUCCACUGUGAA CAAGUAUUCUGGUCACAGAAUACAAC GCGGAACUUAGAUCUCCACUGUGAA CAAGAUGAUCCUAGCGCCGUCUU (SEQ ID NO: 12)
・ GACGGCGCUAGGAUCAUCAAC GCAGAACUUAGAUCUCCACUGUGAA CAAGUAUUCUGGUCACAGAAUACAAC GCAGAACUUAGAUCUCCACUGUGAA CAAGAUGAUCCUAGCGCCGUCUU (SEQ ID NO: 13)

  Examples of the Ad whose proliferation is promoted in the “method for promoting the proliferation of Ad” of the present invention include an Ad that can be replicated only in a specific cell type, that is, a restricted proliferation Ad and a non-proliferation Ad vector Particularly preferred is restricted growth type Ad. As shown in the background art section of this specification, a restricted growth type Ad that does not grow in normal cells but specifically infects and proliferates and kills tumor cells or detects tumor cells is a next generation tumor. Although it has been expected as a therapeutic drug and a tumor detection drug, the conventional limited growth type Ad has a problem that a sufficient therapeutic effect cannot be obtained due to a slow growth rate in tumor cells. If Ad can be specifically infected and proliferated by the “Ad growth promotion method” of the present invention, an antitumor agent or tumor cell that causes Ad to replicate only in tumor cells and kills tumor cells is detected. It can be effectively used as a detection agent. Restricted growth type Ad is an Ad that occurs only in tumor cells, for example, and can be exemplified by those reported in NATURE MEDICINE, 7, 781-787 (2001). For example, Ad carrying a promoter that controls gene expression in a tumor cell-specific manner can be mentioned. As long as it is a promoter capable of exhibiting such a function, either a promoter known per se or a promoter developed in the future may be used. Examples include hTERT promoter, IAI.3B promoter, midkine promoter, β-HCG promoter, SCCA1 promoter, cox-2 promoter, PSA promoter, or other tumor-specific promoters. As a suitable promoter that can correspond to the virus used for expression of the target gene, for example, CMV promoter, SV40 late promoter, MMTV LTR promoter, RSV LTR promoter, SRα promoter, etc. can be used in addition to the tumor specific promoter. it can.

  The “Ad” that promotes proliferation of the present invention needs to be devised to suppress the function of Ad-derived mivaRNA or to inhibit miR-27a and / or miR-27b in the Ad genome. is there. Specifically, expression cassettes such as decoy nucleic acids and aptamer nucleic acids for Dicer or Ago2, and expression cassettes such as antisense oligonucleotides for Dicer or Ago2 genes may be mounted. When focusing only on miR-27a or miR-27b suppression, expression cassettes such as decoy nucleic acids and aptamer nucleic acids for miR-27a or miR-27b, antisense oligonucleotides for miR-27a or miR-27b, etc. The expression cassette may be mounted. The siRNA or shRNA for Dicer and Ago2, respectively, or the decoy nucleic acid for miR-27a or miR-27b is as described above.

  In the present specification, Ad is typically a human type 2, type 5, type 11, type 35 Ad, a non-human type host Ad, mouse Ad, dog Ad, sheep Ad and bird Ad and so on.

  In the present specification, the E1 region-deficient Ad refers to an Ad that is functionally deficient in the E1 gene region so that the E1 protein is not expressed in the Ad genome. The E1 gene region specifically corresponds to positions 342 to 3523 in the human type 5 Ad genome (GenBank Accession Nos .: M73260, M29978), for example. The functional deletion of the E1 gene region means, for example, that the E1 protein that functions in the host cell is not expressed, and it is not necessary to delete all of the genomic region encoding the E1 protein. The Ad that can be used for the Ad of the present invention may be, for example, a 5-type Ad that functionally lacks the E3 gene region in addition to the E1 region. The E3 region of the type 5 Ad genome (GenBank Accession No .: M73260, M29978) refers to a site corresponding to the 28133-30308th or 27865-30309th.

  Further, the production of Ad can be promoted by applying the “method for promoting the proliferation of Ad” of the present invention to at least either “Ad” or “Ad proliferation cell”. The Ad in this case is not limited to the restricted growth type Ad, and may be a non-growth type Ad. Regardless of the restricted growth type Ad and the non-growth type Ad, Ad can be effectively utilized if virus growth can be promoted in vitro. Examples of the “Ad proliferation cell” for producing Ad by effectively promoting proliferation include “Ad production packaging cell”.

  In the present specification, the “Ad production packaging cell” is not particularly limited as long as it is a cell capable of producing Ad. Examples of cells that can be used as packaging cells for producing Ad include HEK293 cells in addition to various tumor cells. Ad production packaging cells to effectively promote growth of Ad are designed to suppress the function of Ad-derived mivaRNA or to inhibit miR-27a and / or miR-27b It must be a cell. An expression cassette such as a decoy nucleic acid or aptamer nucleic acid for Dicer or Ago2 or an antisense cassette for a Dicer or Ago2 gene may be introduced. When focusing only on miR-27a or miR-27b suppression, expression cassettes such as decoy nucleic acids and aptamer nucleic acids for miR-27a or miR-27b, antisense oligonucleotides for miR-27a or miR-27b, etc. The expression cassette may be introduced. The siRNA or shRNA for Dicer and Ago2, respectively, or the decoy nucleic acid for miR-27a or miR-27b is as described above.

  The present invention also extends to an antitumor agent or tumor detection agent comprising the Ad of the present invention as an active ingredient. The antitumor agent of the present invention includes tablets, capsules, powders, granules, pills, liquids, syrups and other oral administration agents, injections, external preparations, suppositories, ophthalmic preparations and the like. Depending on the form, it can be administered orally or parenterally. Preferably, local injection into a tumor, muscle, abdominal cavity, etc., injection into a vein, etc. are exemplified. The antitumor agent or tumor detection agent containing an effective amount of Ad of the present invention is produced according to a conventional method, and generally a physiological saline, a cell culture solution or the like can be used as a diluent. Further, if necessary, bactericides, preservatives, stabilizers, tonicity agents, soothing agents and the like may be added.

  The antitumor agent of the present invention can be applied to almost all malignant tumors, and the types of cancer to be treated are ovarian cancer, squamous cell carcinoma (cervical cancer, skin cancer, head and neck cancer, esophageal cancer, Lung cancer etc.), digestive organ cancer (colon cancer, pancreatic cancer, liver cancer, gastric cancer etc.), neuroblastoma, brain tumor, breast cancer, testicular cancer, prostate cancer and the like.

  The present invention also extends to a method for treating malignant tumors. Specifically, it is by administering an effective amount of the antitumor agent of the present invention for the treatment and / or prevention of any of the aforementioned malignant tumors. The antitumor agent of the present invention can be applied to the affected area as it is, or any known method such as intravenous, intramuscular, intraperitoneal or subcutaneous injection, inhalation from the nasal cavity, oral cavity or lung, oral administration, It can also be introduced into a living body (target cell or organ) by intravascular administration using a catheter or the like. Further, for example, after making it easy to handle by a method such as freezing, a known pharmaceutically acceptable carrier such as an excipient, a bulking agent, a binder or a lubricant, a known additive (buffering agent, isotonicity) Agents, chelating agents, coloring agents, preservatives, fragrances, flavoring agents, sweetening agents, etc.).

The dose for treatment can be appropriately determined according to the size / type of the tumor, the degree of symptoms, the administration route, the administration subject, the age of the patient, the body weight, and the like. The antitumor agent of the present invention may be administered to a patient several times, or may be divided into multiple courses, and the number of administrations per course, the administration interval, etc. may be arbitrarily set. As a daily dose, the amount of the virus of the present invention, which is usually an active ingredient, can be about 10 ⁶ to 10 ¹¹ PFU (plaque forming units), preferably about 10 ⁹ to 10 ¹¹ PFU. Moreover, when using the antitumor agent of this invention, it can also make it easy to infect Ad contained as an active ingredient by suppressing a living body's immunity by using a well-known immunosuppressive agent etc. Furthermore, the antitumor agent of the present invention can be used in combination with at least one anticancer agent selected from the group consisting of known anticancer agents and radiation. Anticancer agents include, but are not limited to:
(A) Alkylation activator: This preparation has an action of introducing an alkyl group into a nucleic acid protein of cancer cells to cause cell damage. For example, carbocon, psulfan (mustard drug), nimustine (nitrosoureas) ) Etc.
(B) Antimetabolite active agent: This preparation has an action of antagonizing an enzyme in the metabolic process and inhibiting cell synthesis. For example, methotrexate (folic acid), mercaptopurine (purine), cytarabine (pyrimidine) System), fluorouracil, tegafur, carmofur and the like.
(C) Antibiotics: Actinomycin D, preomycin, adriamycin, mitomycin C, etc. having anticancer activity.
(D) Microtubule inhibitory active agent: This preparation acts on microtubules and exhibits an antitumor effect, such as docetaxel, paclitaxel (taxane), vinorelbine, pinklistin, vinblastine (alkaloids), etc. .
(E) Platinum preparation: This preparation has an action of inhibiting DNA synthesis by forming intra-DNA chain or inter-chain bond or DNA protein bond, and examples thereof include cisplatin, arboplatin, nedaplatin and the like. .
(F) Topoisomerase inhibitory activator: Examples include irinotecan (topoisomerase I inhibitor), podophyllotoxin derivative (topoisomerase II inhibitor), which inhibit topoisomerase. Topoisomerase is an enzyme that catalyzes a reaction that temporarily cuts DNA and changes the linking number of DNA strands.

  The present invention also extends to a highly sensitive detection method for malignant tumors. Specifically, for detection of any of the above-mentioned malignant tumors, the target cell, cultured cell, cultured tissue, collected blood or biopsy tissue of the tumor detection agent of the present invention loaded with a reporter gene such as GFP Or by administering to a living body. The tumor detection agent of the present invention can be applied to the affected part of a living body as it is, or any known method, for example, injection such as vein, muscle, intraperitoneal or subcutaneous, inhalation from nasal cavity, oral cavity or lung, oral It can also be introduced into a living body (target cells or organs) by administration, intravascular administration using a catheter or the like. Further, for example, after making it easy to handle by a method such as freezing, a known pharmaceutically acceptable carrier such as an excipient, a bulking agent, a binder or a lubricant, a known additive (buffering agent, isotonicity) Agents, chelating agents, coloring agents, preservatives, fragrances, flavoring agents, sweetening agents, etc.).

  The amount used to detect malignant tumors is appropriately determined according to the collection conditions, culture conditions, tumor size / type, degree of symptoms, administration route, administration target, animal species, patient age, body weight, etc. be able to. The tumor detection agent of the present invention may be administered to a living body several times, or may be divided into multiple courses, and the number of administrations per course, the administration interval, etc. may be arbitrarily set. It is also possible to collect and inspect blood and biopsy material from a living body. For example, referring to J. Clin. Invest., 119: 3172-3181 (2009) and VNATURE MEDICINE, 12: 1214-12193181 (2006), the usage amount of the tumor detection agent of the present invention can be appropriately determined. .

  Furthermore, according to the growth promoting method of the present invention, Ad as an active ingredient can be promoted effectively compared to the conventional method. The cells in which the proliferation of Ad of the present invention is promoted include ovarian cancer, squamous cell carcinoma (cervical cancer, skin cancer, head and neck cancer, esophageal cancer, lung cancer, etc.), digestive organ cancer (colon cancer, pancreatic cancer, liver cancer, gastric cancer). Etc.), target tumor cells such as neuroblastoma, brain tumor, breast cancer, testicular cancer, prostate cancer and the like. If Ad can be effectively proliferated in a desired cell such as a target tumor cell, an anti-malignant tumor effect such as tumor lysis and a tumor detection effect can be effectively exhibited. Then, by applying the growth promotion method of the present invention to an in vitro Ad production system using cells, for example, a virus production system using HEK293 cells, Ad can be produced more effectively. it can.

  EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, experimental examples, and reference examples, but the present invention is not limited thereto.

(Example 1) Production of Ad loaded with shRNA against Dicer In this example, a cassette loaded with shRNA against Dicer (hereinafter referred to as "shDicer" in the Examples and Experimental Examples), The production of Ad carrying a cassette capable of expressing siRNA will be described. Hereinafter, the Ad in this embodiment is referred to as “Ad-shDicer”. The genomic structure of the produced Ad-shDicer is as shown in FIG.

1) Preparation of Ad-shDicer genome In this example, the human type 5 Ad genome (GenBank Accession No .: M73260, M29978) lacks the E1 region (342-3523) and E3 region (28133-30818) of the genome. It was constructed based on a vector plasmid that can insert a foreign gene into the E1-deficient region. The hTERT promoter, which is a tumor-specific promoter, and E1A, IRES, E1B, and polyA (pA) signal sequences are ligated and mounted in the E1 deficient region of the vector plasmid pAdHM19 to obtain an oncolytic Ad genome. It was. Furthermore, the shDicer expression cassette was mounted in the E3-deficient region. The sequence corresponding to shDicer in the shDicer expression cassette used in this example consists of the base sequence shown in SEQ ID NO: 5. What is important for exerting the RNA interference function is considered to be the base sequence shown underlined in SEQ ID NO: 5, specifically the base sequence part shown in SEQ ID NO: 6 or SEQ ID NO: 7.
(SEQ ID NO: 5) GATCCC GAATCAGCCTCGCAACAAA TTCAAGAGA TTTGTTGCGAGGCTGATTC TTTTTGGAAAT
(SEQ ID NO: 6) GAATCAGCCTCGCAACAAA
(SEQ ID NO: 7) TTTGTTGCGAGGCTGATTC

2) Preparation of Ad-shDicer The Ad-shDicer genome prepared in 1) above was cleaved and washed with the restriction enzyme PacI present at the end of the viral genome, and transferred to HEK293 cells using the transfection reagent Lipofectamine2000 ^™ (Invitrogen). Transfected to produce Ad-shDicer.

(Experimental Example 1-1) Confirmation of Ad Genomic Proliferation Ability in Cancer Cells by Ad-shDicer The amount of viral genome when the Ad-shDicer prepared in Example 1 was allowed to act on various cancer cells was confirmed. The cancer cells were confirmed for HeLa cells (human cervical cancer cells), SK HEP-1 cells (human hepatocellular carcinoma cells) and H1299 cells (human non-small cell lung cancer cells). As a conventional Oncolytic Ad control, Ad-E3 (-) having the same genomic structure as Ad-shDicer prepared in Example 1 and expressing shRNA (shLuc) for firefly luciferase instead of shDicer Expressed Ad-shLuc was used.

  When various cancer cells became 70% confluent, various virus suspensions prepared using the culture solution were allowed to act at MOI 2 and were infected at 37 ° C. for 24 hours. Thereafter, the virus solution was removed, a culture solution was added, and the mixture was cultured at 37 ° C. The Ad genome copy number 50 hours after the start of culture was confirmed by quantitative PCR. As a result, in any of the above three types of cancer cells, in the case of Ad-shDicer, remarkable Ad genome proliferation ability was recognized as compared with other control Ad (see FIG. 2).

(Experimental Example 1-2) Confirmation of cell viability when Ad-shDicer was allowed to act The cell viability when Ad-shDicer prepared in Example 1 was allowed to act on various cancer cells and normal cells was confirmed. The control shown in Experimental Example 1-1 was confirmed in the same manner. In addition, a mock system without Ad was also used as a control. Cancer cells are HeLa cells (human cervical cancer cells), H1299 cells (human non-small cell lung cancer cells) and HepG2 cells (human hepatocellular carcinoma cells), normal cells are HUVEC (human umbilical vein endothelial cells), NHLF (human lung fibroblasts) and PrSC (prostate stromal cells) were confirmed.

When the cells became 70% confluent, various virus suspensions prepared using the culture medium were allowed to act at MOI 2 and infected at 37 ° C. for 24 hours. Thereafter, the virus solution was removed, a culture solution was added, and the mixture was cultured at 37 ° C. The survival rate of each cell on the third day (day 3) and the fifth day (day 5) was confirmed when the cell survival rate of the Ad non-acting group was 100% at the time of measurement. Cell viability was confirmed by Alamar Blue ^(R) assay (Invitrogen).

  As a result, when Ad-shDicer was allowed to act, a marked cell killing effect was observed in cancer cells compared to the control group (see FIG. 3), and there was almost no difference in survival rate in normal cells (FIG. 4). reference).

(Experimental Example 1-3) Confirmation of Dicer mRNA Level when Ad-shDicer was Acted The amount of Dicer mRNA when Ad-shDicer prepared in Example 1 was allowed to act on various cancer cells was measured. The cancer cells were confirmed for HeLa cells (human cervical cancer cells), H1299 cells (human non-small cell lung cancer cells) and SK HEP-1 cells (human hepatocellular carcinoma cells).

When various cells were 70% confluent, various virus suspensions prepared using the culture solution were allowed to act at MOI 2 and were infected at 37 ° C. for 48 hours. After infection, RNA was collected from the infected cells, and the amount of Dicer mRNA was measured by quantitative RT-PCR.
As a result, in any of the above three types of cancer cells, in the case of Ad-shDicer, a marked decrease in the amount of Dicer mRNA was observed compared to other control Ad (see FIG. 5).

(Experimental Example 1-4) Propagation of wild-type Ad when Ago2, Dicer or XPO5 is knocked down In various cancer cells, siRNA against Ago2, Dicer or XPO5 is prepared, and each siRNA is introduced into each cell to interfere with RNA. I let you. When the wild type Ad was added to each of the cells and cultured, the amount of Ad genome was confirmed. As shown in the background section, after VA-RNA is transcribed in the cell nucleus, it is transported outside the nucleus by XPO5, cleaved by Dicer in the cytoplasm, and then forms RISC together with the Ago2 protein (Fig. 6). Therefore, it was confirmed how siRNA against Ago2, Dicer or XPO5 was introduced into various cancer cells to affect Ad proliferation.

The base sequences of each siRNA used in this example are shown in SEQ ID NOs: 1-4, 8, and 9.
1) siRNA sequence for Dicer: GAAUCAGCCUCGCAACAAA (SEQ ID NO: 1)
2) siRNA sequence for Dicer: UUUGUUGCGAGGCUGAUUC (SEQ ID NO: 2)
3) Sequence of siRNA against Ago2: GCACGGAAGUCCAUCUGAA (SEQ ID NO: 3)
4) siRNA sequence for Ago2: UUCAGAUGGACUUCCGUGC (SEQ ID NO: 4)
5) siRNA sequence for XPO5: CUCGAUUGGAGAAGGUGUA (SEQ ID NO: 8)
6) siRNA sequence for XPO5: UACACCUUCUCCAAUCGAG (SEQ ID NO: 9)

  SiRNA for Ago2, Dicer or XPO5 was introduced into HeLa cells (human cervical cancer cells) or H1299 cells (human non-small cell lung cancer cells). As a control, cells into which control siRNA (Allstars negative control siRNA; Qiagen) was introduced were used. When the various cancer cells became 70% confluent, the wild-type Ad solution was infected at 37 ° C. for 24 hours so as to have a MOI of 5. Wild-type Ad does not carry a shDicer expression cassette, and the E1 gene essential for virus self-growth is transcribed by the virus's own promoter.

  For each cell infected with Ad, the Ad genome copy number was confirmed by quantitative PCR. As a result, in any of the two types of cancer cells, when the siRNA against Ago2 or Dicer was introduced into the cells, the copy number of the Ad genome was significantly increased compared to the control (see FIG. 7). On the other hand, when siRNA against XPO5 was allowed to act, the copy number of the Ad genome showed a value equal to or lower than that of the control (see FIG. 7).

  Next, the effect of introducing siRNA against Ago2 or Dicer on the production of mivaRNA I or mivaRNA II was confirmed by electrophoresis. As a result, it was confirmed that the production of mivaRNA I and mivaRNA II was suppressed in any cell (see FIG. 8).

 SiRNA for Dicer or Ago2 was introduced into HeLa cells or H1299 cells, respectively. Control siRNA (Allstars negative control siRNA) was used as a control. 48 hours after siRNA introduction, a VA-RNA expression plasmid was introduced. 24 hours after plasmid introduction, the copy number of VA-RNA was measured by quantitative RT-PCR. That is, knocking down Dicer or Ago2 is thought to increase the copy number of full-length VA-RNA (see FIG. 9).

  From the above results, after VA-RNA is transcribed in the cell nucleus, it is not a stage where it is transported out of the nucleus by XP05, or by suppressing the production of Ad-derived mivaRNA by introducing siRNA against Dicer or Ago2, etc. Alternatively, it was confirmed that by suppressing the activity of mivaRNA, an effect of promoting Ad proliferation can be obtained.

(Experimental example 1-5) Propagation of wild-type Ad when Dicer is knocked down in various cells In this Example, wild-type Ad was introduced into each cancer cell by introducing shDicer expression cassette and causing RNA interference. The amount of viral genome when culturing was added was confirmed. The sequence corresponding to shDicer in the shDicer expression cassette consists of the base sequence shown in SEQ ID NO: 5.
(SEQ ID NO: 5) GATCCC GAATCAGCCTCGCAACAAA TTCAAGAGA TTTGTTGCGAGGCTGATTC TTTTTGGAAAT

  The shDicer expression cassette was introduced into H1299 cells (human non-small cell lung cancer cells), SK HEP-1 cells (human hepatocellular carcinoma cells) or HepG2 cells (human hepatocellular carcinoma cells). The control was a cell into which shRNA was not introduced. When the various cancer cells became 70% confluent, the wild-type Ad solution was infected at 37 ° C. for 24 hours so as to have a MOI of 5.

  For each cell infected with Ad, the Ad genome copy number was confirmed by quantitative PCR. As a result, in each cancer cell, when the shDicer expression cassette was introduced into the cell, the copy number of the Ad genome was significantly increased compared to the control (see FIG. 10). From this, it was confirmed that by suppressing the production of Ad-derived mivaRNA with shDicer, the effect of promoting Ad growth can be obtained.

(Comparative Example 1) Proliferation of wild-type Ad when Ago2 or Dicer was overexpressed Ad proliferation was confirmed when Ago2 or Dicer was overexpressed in cancer cells.

  Ago2 or Dicer expression plasmids were introduced into HeLa cells (human cervical cancer cells) or H1299 cells (human non-small cell lung cancer cells). The control was a cell into which a control plasmid (p3 × FLAG-CMV10) that expresses nothing was introduced. When the various cancer cells became 70% confluent, the wild-type Ad solution was infected at 37 ° C. for 24 hours so as to have a MOI of 5.

  For each cell infected with Ad, the Ad genome copy number was confirmed by quantitative PCR. As a result, in any of the two types of cancer cells, when Ago2 or Dicer was overexpressed in the cells, the copy number of the Ad genome was significantly reduced compared to the control (see FIG. 11).

(Example 2) Cell killing effect of Ad-shDicer on each cancer cell Ad-shDicer prepared by the same method as in Example 1 was used for each of HeLa cells (human cervical cells) or H1299 cells (human non-small cell lung cancer cells). The cell viability when acting on cancer cells was confirmed. The control shown in Experimental Example 1-1 was confirmed in the same manner. When each cell becomes 70% confluent, various virus suspensions prepared using the culture medium are allowed to act at MOI 0.01, 0.1, 1, 10, 100, and 37 ° C. For 24 hours. Thereafter, the virus solution was removed, a culture solution was added, and the mixture was cultured at 37 ° C. When the cell viability of the Ad non-acting group was 100% at the time of measurement, the viability of each cell on the fifth day of culture was confirmed. Cell viability was confirmed by Alamar Blue ^(R) assay (Invitrogen). As a result, the Ad-shDicer of the present invention showed a higher cell killing effect than the control Ad-E3 (−) and Ad-shLuc (see FIG. 12).

(Example 3) Anti-cancer effect of Ad-shDicer on each cancer cell (anti-tumor effect)
The anti-tumor effect of Ad-shDicer prepared by the same method as in Example 1 on mouse subcutaneous tumors was examined. The control shown in Experimental Example 1-1 was confirmed in the same manner. 5-week-old nude mice (BALB / c nu / nu, female) 2 × 10 ⁶ H1299 cells (human non-small cell lung cancer cells) or SK-OV-3 cells (human ovarian cancer cells) subcutaneously for each mouse Implantation was performed to form solid tumors with a diameter of 5-6 mm. Thereafter, for each group of n = 6, 10 ⁷ ifu (Infectious Units) was locally administered into the formed solid tumor. Further, Ad was again administered locally three days after the first administration. Thereafter, the tumor diameter was measured daily. As a result, it was shown that the Ad-shDicer of the present invention has a higher antitumor activity than the control Ad-E3 (−) and Ad-shLuc (see FIG. 13).

(Reference Example 1) miR-27a, b expression level in Dicer knockdown cells From the results of Experimental Examples 1-4 and the like, it was confirmed that the proliferation of Ad was promoted by Dicer knockdown. From this, when Dicer is knocked down, production of any miRNA is expected to be suppressed. Therefore, it was considered that Dicer knockdown reduced the amount of certain miRNAs, thereby restoring the expression of genes that promote virus growth and promoting Ad growth.

  Based on the above findings, focusing on miR-27a and miR-27b, the expression levels of miR-27a and miR-27b in Dicer knockdown cells were measured. A cassette expressing shDicer in a doxycycline (Dox: tetracycline derivative) dependent manner was inserted into HeLa cells. HeLa cells were cultured for 48 hours in a medium containing or not containing 100 ng / ml of Dox. The amount of miR-27a or miR-27b was measured by quantitative RT-PCR. As a result, it was revealed that when HeLa cells were cultured in the presence of Dox, miR-27a and miR-27b were decreased in expression due to Dicer knockdown (see FIG. 14).

(Reference Example 2) Relationship between VA-RNA, Dicer and miR-27a, b Conventionally, VA-RNA has been reported to suppress the expression of Dicer. Therefore, it was examined whether miR-27a and miR-27b expression is suppressed by overexpression of VA-RNA. VA-RNAI and II expression plasmids (pAdvantage) -DNaeI, pAdVantage, VA-RNAI expression plasmid (pVAI) or VA-RNAII expression plasmid (pVAII) are transfected, and VA-RNA (I and II), VA-RNAI or HeLa cells overexpressing VA-RNAII were cultured for 48 hours, and the expression levels of miR-27a and miR-27b were measured by quantitative RT-PCR. As a result, it was shown that the expression levels of miR-27a and miR-27b decreased due to overexpression of VA-RNA, respectively (see FIG. 15A). HeLa cells were transfected with a VA-RNA expression plasmid and a reporter plasmid (psiCHECK-2-mR-27aT or -miR-27bT) containing 2 copies of the miR-27a or miR-27b complementary sequence in the 3'-UTR of the RLuc gene And cultured for 48 hours. Thereafter, luciferase activity was measured. As a result, it was shown that the expression levels of miR-27a and miR-27b were decreased by VA-RNA (see FIG. 15B).

(Reference Example 3) Ad infection and the relationship with miR-27a, b As a result of Reference Example 2, it was confirmed that the expression level of miR-27a and miR-27b was decreased by VA-RNA. The relationship between infection and the expression level of miR-27a and miR-27b was confirmed. When wild type Ad (WT-Ad) was added to HeLa cells at 100 VP (vector particles) / cell and infected each time, the expression level of miR-27a and miR-27b increased significantly 24 hours after infection. Was confirmed (see FIG. 16).

Reference Example 4 Relationship between miR-27a, b and Ad Infection Next, the effect of miR-27a and miR-27b on Ad proliferation was examined. HeLa cell mimic miR-27a or mimic miR-27b (synthesized miR-27a or miR-27b), or miR-27a or miR-27b inhibitor (miR-27a or miR-27b antisense oligonucleotide: miRVana miRNA inhibitor (Ambion) was transfected with 1, 3, 10 or 30 nM, and then 100 VP / cell of wild-type Ad (WT-Ad) was added and infected for 24 hours. The amount of Ad genome was measured by quantitative RT-PCR. As a result, Ad proliferation was suppressed in the system containing mimic miR-27a or mimic miR-27b, and Ad proliferation was promoted in the system containing the inhibitor (FIGS. 17A and 17B). For H1299 cells, mimic miR-27a or miR-27b was added at 30 nM, or miR-27a or miR-27b inhibitor (inhibitor) was added at 30 nM, and mimic miR-27a or mimic miR-27b was added. In FIG. 17, the growth of Ad was suppressed, but the growth of Ad was promoted in a system containing an inhibitor (FIG. 17C).

(Example 4) Preparation of Ad loaded with a tough decoy RNA expression cassette that inhibits miR-27a, b In this example, a tough decoy RNA against miR-27a or miR-27b (hereinafter referred to as "TuD- 27a or TuD-27b "), and the production of an oncolytic Ad carrying a cassette capable of expressing siRNA against miR-27a or miR-27b will be described. Hereinafter, the Ad in this example is referred to as “Oncolytic Ad-TuD-27a” or “Oncolytic Ad-TuD-27b”. The genomic structure of the produced Oncolytic Ad-TuD-27a or Oncolytic Ad-TuD-27b is as shown in FIG.

1) Production of Oncolytic Ad-TuD-27a or Oncolytic Ad-TuD-27b genome In this example, as in Example 1, in the human type 5 Ad genome (GenBank Accession number: M73260, M29978), E1 It was constructed based on a vector plasmid that lacks the region (342-3523) and the E3 region (28133-30818) and can insert foreign genes into the E1-deficient region. The hTERT promoter, which is a tumor-specific promoter, and E1A, IRES, E1B, and polyA (pA) signal sequences were ligated and mounted on the E1 deficient region of the vector plasmid pAdHM19 to obtain an Oncolytic Ad genome.

Furthermore, an expression cassette for TuD-27a or TuD-27b was mounted in the E3-deficient region. The sequence corresponding to TuD-27a or TuD-27b used in this example consists of the base sequence shown in SEQ ID NO: 12 or 13. The underlined portion is an antisense sequence against miR-27a or miR-27b.
TuD-27a: GACGGCGCUAGGAUCAUCAAC GCGGAACUUAGAUCUCCACUGUGAA CAAGUAUUCUGGUCACAGAAUACAAC GCGGAACUUAGAUCUCCACUGUGAA CAAGAUGAUCCUAGCGCCGUCUU (SEQ ID NO: 12)
TuD-27b: GACGGCGCUAGGAUCAUCAAC GCAGAACUUAGAUCUCCACUGUGAA CAAGUAUUCUGGUCACAGAAUACAAC GCAGAACUUAGAUCUCCACUGUGAA CAAGAUGAUCCUAGCGCCGUCUU (SEQ ID NO: 13)

2) Production of Oncolytic Ad-TuD-27a or Oncolytic Ad-TuD-27b The TuD-27a or TuD-27b genome produced in 1) above is cleaved with the restriction enzyme PacI present at the end of the viral genome, washed, and transferred. Oncolytic Ad-TuD-27a or Oncolytic Ad-TuD-27b was prepared by transfecting HEK293 cells using the injection reagent Lipofectamine2000 ^™ (Invitrogen).

(Experimental example 4-1) Confirmation of cell viability when Oncolytic Ad-TuD-27a or Oncolytic Ad-TuD-27b was allowed to act Oncolytic Ad-TuD-27a or Oncolytic Ad-TuD-27b produced in Example 4 The cell viability was confirmed when this was allowed to act on HeLa cells or H1299 cells. The control (conventional Oncolytic Ad) shown in Ad-E3 (-) that does not express any tough decoy RNA was also confirmed in the same manner. In addition, a mock system without Ad was also used as a control.

When the cells became 70% confluent, the various virus suspensions prepared using the culture solution were allowed to act at MOI 2 and were infected at 37 ° C. for 24 hours. Thereafter, the virus solution was removed, a culture solution was added, and the mixture was cultured at 37 ° C. The survival rate of each cell on the third day (day 3) and the fifth day (day 5) was confirmed when the cell survival rate of the Ad non-acting group was 100% at the time of measurement. Cell viability was confirmed by Alamar Blue ^(R) assay (Invitrogen). As a result, when Oncolytic Ad-TuD-27a or Oncolytic Ad-TuD-27b was allowed to act, a remarkable cell killing effect was recognized as compared to the control group (see FIG. 19).

(Experimental example 4-2) Oncolytic Ad-TuD-27a or Oncolytic Ad-TuD-27b Confirmation of Ad genome growth ability in cancer cells Oncolytic Ad-TuD-27a or Oncolytic Ad-TuD- produced in Example 4 The amount of viral genome when 27b was allowed to act on HeLa cells or H1299 cells was confirmed. The control (conventional Oncolytic Ad) was confirmed in the same manner as in Experimental Example 4-1.

  When the cells became 70% confluent, the various virus suspensions prepared using the culture solution were allowed to act at MOI 2 and were infected at 37 ° C. for 24 hours. Thereafter, the virus solution was removed, a culture solution was added, and the mixture was cultured at 37 ° C. The Ad genome copy number 48 hours after the start of culture was confirmed by quantitative PCR. As a result, when Oncolytic Ad-TuD-27a or Oncolytic Ad-TuD-27b was allowed to act, higher proliferation ability in cancer cells was observed than in the control group (see FIG. 20).

  As described in detail above, the Ad of the present invention can promote the proliferation of Ad more effectively than the conventional Ad. According to the antitumor agent containing Ad of the present invention as an active ingredient, proliferation is effectively promoted in the target tumor cells, and an antitumor effect is exhibited. Thereby, a more effective antitumor agent can be provided and useful.

  Ad contained as an active ingredient in the antitumor agent of the present invention has a growth promoting ability in a desired target cell, and therefore can be used at a lower concentration than normal restricted growth Ad, and is also economically useful. .

  Furthermore, according to the growth promoting method of the present invention, Ad can be promoted effectively compared to the conventional method. If Ad can be effectively propagated in a desired cell such as a target tumor cell, an antimalignant effect such as tumor lysis can be effectively exerted. Then, by applying the growth promotion method of the present invention to an Ad production system in cells, Ad can be produced more effectively, which is useful.

Claims (11)

A method for promoting the growth of an adenovirus having VA-RNA, comprising suppressing the function of an adenovirus-derived mivaRNA. The method for promoting the growth of adenovirus according to claim 1, wherein suppressing the function of mivaRNA inhibits at least one of Dicer and Ago2. The method of promoting the growth of adenovirus according to claim 1, wherein the mivaRNA function is inhibited by inhibiting Dicer. The method for promoting the growth of adenovirus according to claim 1, wherein suppressing the function of mivaRNA inhibits Ago2. The method for promoting the growth of adenovirus according to any one of claims 2 to 4 , wherein the inhibition of Dicer or Ago2 is inhibition of Dicer or Ago2 by RNA interference. Inhibition of Dicer or Ago2 by RNA interference is inhibition by siRNA against Dicer or Ago2, and siRNA against Dicer or Ago2 is introduced into the siRNA against Dicer or Ago2 mounted on the adenovirus, into adenovirus-producing packaging cells 6. The method of promoting the growth of adenovirus according to claim 5 , wherein the siRNA against Dicer or Ago2 is used, or siRNA against Dicer or Ago2. The siRNA against Dicer is RNA containing the oligonucleotide shown in the following 1) or 2), and the siRNA against Ago2 is RNA containing the oligonucleotide shown in 3) or 4) below. Method for promoting the growth of adenovirus:
1) GAAUCAGCCUCGCAACAAA (SEQ ID NO: 1)
2) UUUGUUGCGAGGCUGAUUC (SEQ ID NO: 2)
3) GCACGGAAGUCCAUCUGAA (SEQ ID NO: 3)
4) UUCAGAUGGACUUCCGUGC (SEQ ID NO: 4) The method for promoting the growth of adenovirus according to any one of claims 2 to 4 , wherein the inhibition of Dicer or Ago2 is inhibition by knockout of Dicer gene or Ago2 gene in a packaging cell for producing adenovirus. The method for promoting the proliferation of adenovirus according to any one of claims 2 to 4, wherein the inhibition of Dicer or Ago2 is inhibition by an antibody of Dicer or Ago2, or inhibition by an inhibitor of Dicer or Ago2. The method for promoting the growth of adenovirus according to any one of claims 1 to 9 , wherein the adenovirus having VA-RNA is a restricted-proliferation adenovirus. An antitumor agent or a tumor detection agent comprising, as an active ingredient, a restricted growth type adenovirus whose growth is promoted by the growth promotion method of claim 10 .