CN102168151A - Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting rice black-streaked dwarf viruses in plant hopper - Google Patents
Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting rice black-streaked dwarf viruses in plant hopper Download PDFInfo
- Publication number
- CN102168151A CN102168151A CN2011100719302A CN201110071930A CN102168151A CN 102168151 A CN102168151 A CN 102168151A CN 2011100719302 A CN2011100719302 A CN 2011100719302A CN 201110071930 A CN201110071930 A CN 201110071930A CN 102168151 A CN102168151 A CN 102168151A
- Authority
- CN
- China
- Prior art keywords
- streaked dwarf
- rice black
- lamp
- plant hopper
- rice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a rapid detection technology for rice black-streaked dwarf viruses in plant hopper and a method for applying the rapid detection technology to disease diagnosis and prediction. By the method, the interference of southern rice black-streaked dwarf viruses can be eliminated, and whether the rice black-streaked dwarf viruses are carried in the plant hopper is rapidly identified, so that a pertinent control strategy is adopted to reduce the loss caused by diseases.
Description
Technical field
The present invention relates to the Fast Detection Technique of rice black-streaked dwarf virus in the plant hopper body and in disease screening with the application of observing and predicting, belong to the agricultural cience and farming techniques field.
Background technology
Rice black-streaked dwarf virus (Rice black-streaked dwarf virus, RBSDV), be a kind ofly on the paddy rice to endanger serious virus disease, be under the jurisdiction of plant Reoviridae Fijivirus and belong to (Fijivirus), virion is spherical, mainly propagated by small brown rice planthopper, the field symptom in earlier stage mainly shows as to plant stunts leaf dark green, later stage wax occurs and drips the shape projection on blade, leaf sheath and cane, then form secret note, very big to the yield effect of paddy rice, grave illness field even can cause not having output.This virus also can infect corn (maize rough dwarf virus), wheat (wheat is green short) and multiple gramineous weeds except that infecting paddy rice.1963 and 1966 in Chinese Jiangsu, Shanghai, Zhejiang one is with popularly, caused heavy losses in many corns of China and paddy rice producing region eruption and prevalence the nineties.Should disease spread generation in the area, Jiangsu and Zhejiang Provinces in recent years, and be day by day serious trend, 2008 are only Jiangsu Province's onset area just reaches 4,000,000 mu, causes local Rice Production loss serious.
Economized a kind of paddy rice virus disease of kainogenesis since 2007 in Guangdong and Hainan etc., the field symptom is extremely similar to rice black-streaked dwarf virus, its genome sequence is measured the back find that itself and rice black-streaked dwarf virus exist than big-difference (the segmental homology of both S9 and S10 only is 75% and 80%), name and be southern rice black-streaked dwarf virus (Southern rice black-streaked dwarf virus, SRBSDV), this virus also belongs to plant Reoviridae Fijivirus and belongs to (Fijivirus), virion is spherical, genome is made up of 10 double-stranded RNAs, vector is mainly white backed planthopper, small brown rice planthopper also can be propagated, the field symptom shows as plant and stunts, dark green leaf color, strip oyster white or Vandyke brown pimple appear in blade back and stem stalk, and the host also comprises corn and multiple weeds except that paddy rice.Should spread generation in disease THE LOWER YANGTZE VALLEY area in recent years, and be day by day serious trend, area takes place and reaches 3,000,000 mu in the southern rice black-streaked dwarf virus whole nation in 2009, rose to 1,900 ten thousand mu in 2010 rapidly, only the Hunan Province just takes place nearly 1,000 ten thousand mu, 80,000 mu of total crop failure areas have brought tremendous loss to paddy rice production.
Because two kinds of viruses are closely similar at aspects such as symptom, plastochondria shape, vector and hosts, also caused difficulty to its diagnosis and evaluation thus.Identify plant virus in the identification there be the normal method that adopts at present: the biology inoculation experiments, serology detects, electron microscopic observation and molecular Biological Detection.Because these two kinds of viruses all has very approaching characteristic aspect a lot, therefore traditional plant virus detection method identifies that as electron microscopic observation (the virus particle size shape is close), traditional biology inoculation (symptom, amboceptor, host range are close), serology detect methods such as (sequence still have higher homology) and all be difficult to differentiation.Ring mediated constant temperature nucleic acid amplification technology (loop-mediated isothermal amplification, LAMP), be that it is a kind of high-sensitive strand displacement technology, a kind of novel PCR substitute technology by the constant temperature nucleic acid amplification method in a kind of novelty of invention in 2000 such as Notomi T.The LAMP characteristics be at 6 zone design of target gene 4 special primers, utilizing a kind of strand displacement archaeal dna polymerase---Bst (Bacilluss tearothermophilus) DNA polymerase reacts under the condition of constant temperature (65 ℃) can finish nucleic acid amplification reaction in 1 hour, just can obtain reaction result clearly by the direct visual colorimetry of fluorescent dye.Do not need long temperature cycle, do not need expensive instruments such as PCR, do not need loaded down with trivial details processes such as electrophoresis ultraviolet visualization.Disease detection and quick diagnosis that the mankind and the various viruses of animals and plants, bacterium, parasite etc. cause have been widely used at present.
Summary of the invention
The invention provides the method for rice black-streaked dwarf virus in a kind of rapid detection plant hopper body, can quick diagnosis go out plant hopper by this method and whether carry rice black-streaked dwarf virus.
The method of rice black-streaked dwarf virus on a kind of rapid detection plant provided by the present invention obtains by the following method:
1) the rice black-streaked dwarf virus S10 nucleotide sequence of having reported according to NCBI, analyze the back by software DNAstar and select relative conservative region 950-1467bp, utilize the corresponding zone on the AY050488.1 to design 4 primers, comprising 2 outer primer F3/B3 and 2 inner primer FIP/BIP by online LAMP primer-design software primerExplorer V4.
2) Trizol reagent method is extracted the total RNA of plant;
3) different inside and outside primer concentration ratios, Mg are set
2+Concentration is determined the optimum response system; Change reaction times and temperature respectively and carry out the RT-LAMP amplified reaction, determine optimum reaction condition.
4) under optimum response parameter condition, be the specificity of this method of contrast checking with the southern rice black-streaked dwarf virus;
5) compare the reliability of checking RT-LAMP with the RT-PCR method;
6) by naked eyes judgement and SYBR GreenI dyeing the RT-LAMP product is carried out visualization processing.
Primer sequence provided by the invention is as follows:
F?3GGTACTTCTACTTCTAGTCCTT
B?3CTTTTTTCATGTCCATCAACTT
FIP?ACGTAAAGACGATCCTTTTTCAGT-ACAGATAAGAAATTCATTGACTGG
BIP?AGTGCCACTAATACTTCAACCAC-TCGTCAAAATATTGAACAGAGA
The temperature of reaction of RT-LAMP is 61-63 ℃, and the reaction times is 60-80min.Utilize electrophoresis detection or fluorescence dye method can get rid of the interference of southern rice black-streaked dwarf disease, quick diagnosis goes out plant hopper and whether carries rice black-streaked dwarf virus.
Utilize this method can get rid of the interference of southern rice black-streaked dwarf disease, whether Rapid identification goes out in the plant hopper body rice black-streaked dwarf virus, and then takes control strategy targetedly, reduces the loss that disease is brought.
Description of drawings
(M is a standard molecular weight to Fig. 1 for the electrophorogram of RT-LAMP result under the differential responses temperature condition; 1 is 60 ℃; 2 is 61 ℃; 3 is 62 ℃; 4 is 63 ℃; 5 is 64 ℃; 6 is 65 ℃; 7 negative contrasts).
(M is a standard molecular weight to the specificity test-results figure that Fig. 2 reacts for rice black-streaked dwarf virus RT-LAMP; 1 is the small brown rice planthopper of carrying RBSDV; 2 is the white backed planthopper of carrying SRBSDV; 3 is the small brown rice planthopper of not carrying RBSDV; 4 negative contrasts).
Specific implementation method
1. rice black-streaked dwarf virus RT-LAMP primer design.
According to the rice black-streaked dwarf virus of having reported on the NCBI (AF227206.1, http://www.ncbi.nlm.nih.gov/nuccore/183229399; EU784843.1, http://www.ncbi.nlm.nih.gov/nuccore/209867306) the S10 nucleotide sequence, by finding out the conservative relatively regional 950-1467bp design primer of this viral nucleic acid after the software DNAstar analysis.Use online LAMP primer-design software primerExplorer V4 (http://primerexplorerjp/elamp4.0.0/index.html) to design primer with one section sequence (950-1467bp) that this virus is conservative relatively as template.After template sequence uploaded, calculate the preliminary LAMP combination of primers (F3 of acquisition by system software, B3, FIP, BIP), corresponding 3 ' end of the primer that provides by software or parameters such as 5 ' end stability and primer dimer manyly compare selection to primer to what design again, finally choose one group of only primer, and sequence is as follows:
F3?GGTACTTCTACTTCTAGTCCTT
B3?CTTTTTTCATGTCCATCAACTT
FIP?ACGTAAAGACGATCCTTTTTCAGT-ACAGATAAGAAATTCATTGACTGG
BIP?AGTGCCACTAATACTTCAACCAC-TCGTCAAAATATTGAACAGAGA
2. the thermograde of rice black-streaked dwarf virus RT-LAMP experiment
Raise poison back and obtain to be with malicious white backed planthopper for examination on susceptible rice plant, the detection of susceptible rice plant is with reference to season quintessence's etc. method (season quintessence etc., " rice in China science ", 2011).Reference
Reagent (Invitrogen) operation instruction is extracted the total RNA of sample.Though the optimal reactive temperature of Bst DNA polymerase is 65.8 ℃, but many reports have confirmed that the suitable temperature of reaction of RT-LAMP is between 60 ℃-65 ℃, simultaneously because different primers can not guarantee that when design the Tm value of all primers is in full accord, and RT-LAMP also will consider the suitable temperature of reaction of ThermoScript II, in view of this, the present invention is optimized test to the RT-LAMP temperature of reaction.The RT-LAMP system is: each 0.2 μ M of outer primer F3 and B3, each 1.2 μ M of inner primer FIP and BIP, dNTP mixture (10mM each) 2.5 μ l, 20mM Tris-HCl (pH8.8,25 ℃), 10mM KCl, 10mM (NH4)
2SO
4, 8mM MgSO
4, 0.1%TritonX-100, Bst archaeal dna polymerase, big fragment 8U, M-MuLV ThermoScript II 100U, RNase Inhibitor 20U, 0.8M trimethyl-glycine, 5.5 μ l RNA templates.The mixing reactant is at 60 ℃, and 61 ℃, 62 ℃, 63 ℃, 64 ℃, isothermal reaction 1h under 65 ℃ of six kinds of conditions, 80 ℃ of reaction 5min stop the RT-LAMP reaction, get sample on the 2 μ L amplified productions, carry out electrophoresis on 1.5% sepharose, electrophoresis result EB dyeing.The result is presented under the same reaction system condition, at 60 ℃, 61 ℃, 62 ℃, behind 63 ℃ of isothermal reaction 1h stepped amplified band is arranged, 61 ℃, 62 ℃, the electrophoretic band brightness of the amplified production behind 63 ℃ of isothermal reaction 1h much at one, the band brightness of amplified production weakens a bit behind 60 ℃ of isothermal reaction 1h, and 64 ℃, 65 ℃ of isothermal reaction 1h and negative control do not have stepped amplified band (Fig. 1).Therefore the temperature of reaction of RT-LAMP of the present invention should be 61-63 ℃.
In order to verify the specificity of RT-LAMP method, the southern rice black-streaked dwarf virus (SRBSDV) of selection and the same genus of RBSDV in contrast.Be template with small brown rice planthopper of carrying RBSDV and the total RNA of white backed planthopper that carries SRBSDV respectively, react by the RT-LAMP reaction system in the example 1.The result shows that the white backed planthopper and the total RNA template of nontoxic small brown rice planthopper of carrying SRBSDV do not have amplified production; And the small brown rice planthopper of carrying RBSDV can amplify purpose product (Fig. 2).This specificity that shows this RT-LAMP primer is better.
The method of rice black-streaked dwarf virus in a kind of rapid detection plant hopper body can quick diagnosis goes out plant hopper by this method and whether carries rice black-streaked dwarf virus.
Above-mentioned enforcement does not limit the present invention in any form.
Claims (2)
1. the method for rice black-streaked dwarf virus in the rapid detection plant hopper body, it is characterized in that: the Auele Specific Primer that utilizes the RT-LAMP reaction, isothermal reaction 40-80min under 60-63 ℃ of condition, utilize electrophoresis detection or fluorescence dye method can get rid of the interference of southern rice black-streaked dwarf disease, identify whether carry rice black-streaked dwarf virus in the plant hopper body.
2.1 described in " RT-LAMP reaction Auele Specific Primer " be meant following 4 primers:
F3?GGTACTTCTACTTCTAGTCCTT
B3?CTTTTTTCATGTCCATCAACTT
FIP?ACGTAAAGACGATCCTTTTTCAGT-ACAGATAAGAAATTCATTGACTGG
BIP?AGTGCCACTAATACTTCAACCAC-TCGTCAAAATATTGAACAGAGA。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110071930 CN102168151B (en) | 2011-03-24 | 2011-03-24 | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting rice black-streaked dwarf viruses in plant hopper |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110071930 CN102168151B (en) | 2011-03-24 | 2011-03-24 | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting rice black-streaked dwarf viruses in plant hopper |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102168151A true CN102168151A (en) | 2011-08-31 |
| CN102168151B CN102168151B (en) | 2013-01-09 |
Family
ID=44489464
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110071930 Expired - Fee Related CN102168151B (en) | 2011-03-24 | 2011-03-24 | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting rice black-streaked dwarf viruses in plant hopper |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102168151B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104141015A (en) * | 2014-07-09 | 2014-11-12 | 江苏省农业科学院 | Method for quickly detecting rice stripe virus and rice black-streaked dwarf virus in laodelphax striatellus |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101430335A (en) * | 2008-11-13 | 2009-05-13 | 江苏省农业科学院 | Immunity detection reagent kit for rice black-streaked dwarf fijivirus in single-head small brown rice planthopper |
| CN101691614A (en) * | 2009-10-09 | 2010-04-07 | 江苏省农业科学院 | Method for rapidly identifying rice black-streaked dwarf virus and southern rice black-streaked dwarf virus |
| CN101713000A (en) * | 2009-12-09 | 2010-05-26 | 湖南农业大学 | RT-PCR detection method of ordinary rice black streaked dwarf virus (RBSDV) |
-
2011
- 2011-03-24 CN CN 201110071930 patent/CN102168151B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101430335A (en) * | 2008-11-13 | 2009-05-13 | 江苏省农业科学院 | Immunity detection reagent kit for rice black-streaked dwarf fijivirus in single-head small brown rice planthopper |
| CN101691614A (en) * | 2009-10-09 | 2010-04-07 | 江苏省农业科学院 | Method for rapidly identifying rice black-streaked dwarf virus and southern rice black-streaked dwarf virus |
| CN101713000A (en) * | 2009-12-09 | 2010-05-26 | 湖南农业大学 | RT-PCR detection method of ordinary rice black streaked dwarf virus (RBSDV) |
Non-Patent Citations (2)
| Title |
|---|
| DUNG TIEN LE ET AL.: "Molecular detection of nine rice viruses by a reverse-transcription loop-mediated isothermal amplification assay", 《JOURNAL OF VIROLOGICAL METHODS》, 15 September 2010 (2010-09-15), pages 90 - 93 * |
| 周彤等: "水稻黑条矮缩病毒RT-LAMP 快速检测方法的建立", 《中国农业科学》, vol. 45, no. 7, 30 April 2012 (2012-04-30), pages 1285 - 1292 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104141015A (en) * | 2014-07-09 | 2014-11-12 | 江苏省农业科学院 | Method for quickly detecting rice stripe virus and rice black-streaked dwarf virus in laodelphax striatellus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102168151B (en) | 2013-01-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101691614B (en) | Method for rapidly identifying rice black-streaked dwarf virus and southern rice black-streaked dwarf virus | |
| CN102827929B (en) | Method for detecting nucleic acid | |
| CN107254552B (en) | Method for detecting tomato yellow leaf curl virus based on RPA | |
| CN109913565B (en) | Kit, primer pair, probe and method for detecting vibrio parahaemolyticus | |
| CN104774955A (en) | Botryosphaeria dothidea detection method | |
| CN102559928A (en) | Specific primer group, kit comprising the primer group, use method and detection method | |
| CN102154518B (en) | Technology for rapidly detecting rice black-streaked dwarf viruses in plants by reverse transcription-loop-mediated isothermal amplification (RT-LAMP) method | |
| Dubey et al. | Development of molecular markers and probes based on TEF-1α, β-tubulin and ITS gene sequences for quantitative detection of Fusarium oxysporum f. sp. ciceris by using real-time PCR | |
| CN102643910A (en) | Application of asymmetric multicolor fluorescence hairpin probe chain reaction in pathogenic bacterium detection | |
| CN102168150B (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting southern rice black-streaked dwarf viruses in plant hopper | |
| CN104195269B (en) | A kind of method detecting tomato spotted wilf virus | |
| CN101899530B (en) | Loop-mediated isothermal amplification detection method of tobacco mosaic viruses | |
| CN109439801A (en) | A kind of honeybee Israel acute paralysis virus real-time fluorescent RT-PCR detection reagent box and its detection method | |
| CN106350581A (en) | Method for detecting bacterial vaginosis by using detection kit | |
| CN102286634B (en) | Technology for quickly detecting southern rice black-streaked stunt virus of plant by RT-LAMP (Reverse Transcription-Loop-mediated Isothermal Amplification) method | |
| CN102168151B (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting rice black-streaked dwarf viruses in plant hopper | |
| CN108130385A (en) | A kind of human cytomegalovirus kit for detecting nucleic acid | |
| Ren et al. | A Portable Nucleic Acid Sensor Based on PCR for Simple, Rapid, and Sensitive Testing of Botrytis cinerea in Ginseng | |
| CN116287439A (en) | RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection primer and kit for hippeastrum chlorosis virus, and application and method thereof | |
| CN108411017A (en) | Detect the LAMP primer and method of pseudomonas syringae tomato pvs oryzae and oryzicola | |
| CN110804674B (en) | Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit | |
| CN102703605B (en) | Kit for rapidly detecting banana streak virus (BSV) by isothermal gene amplification and use method of kit | |
| CN102747161B (en) | Kit and oligonucleotides for detecting genetically modified maize line Mon88017 | |
| CN107557445B (en) | Nucleic acid, kit and method for simultaneously detecting pathogen causing blight, spot disease and powdery mildew of begonia | |
| CN107586863B (en) | Nucleic acid, kit and method for simultaneously detecting etiolation disease phytoplasma, ulcer disease pathogenic bacteria and leaf spot disease pathogenic bacteria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130109 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |