CN102168150B - Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting southern rice black-streaked dwarf viruses in plant hopper - Google Patents
Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting southern rice black-streaked dwarf viruses in plant hopper Download PDFInfo
- Publication number
- CN102168150B CN102168150B CN 201110071917 CN201110071917A CN102168150B CN 102168150 B CN102168150 B CN 102168150B CN 201110071917 CN201110071917 CN 201110071917 CN 201110071917 A CN201110071917 A CN 201110071917A CN 102168150 B CN102168150 B CN 102168150B
- Authority
- CN
- China
- Prior art keywords
- streaked dwarf
- lamp
- rice black
- plant hopper
- dwarf virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 241000756822 Southern rice black-streaked dwarf virus Species 0.000 title claims abstract description 30
- 238000000034 method Methods 0.000 title claims abstract description 22
- 241001498622 Cixius wagneri Species 0.000 title claims abstract description 20
- 238000007397 LAMP assay Methods 0.000 title description 4
- 238000010839 reverse transcription Methods 0.000 title 1
- 238000001514 detection method Methods 0.000 claims abstract description 15
- 238000006243 chemical reaction Methods 0.000 claims description 24
- 241000209094 Oryza Species 0.000 claims description 12
- 241000700605 Viruses Species 0.000 claims description 11
- 235000007164 Oryza sativa Nutrition 0.000 claims description 10
- 235000009566 rice Nutrition 0.000 claims description 10
- 238000001962 electrophoresis Methods 0.000 claims description 5
- 239000007850 fluorescent dye Substances 0.000 claims description 3
- 241000702634 Rice black streaked dwarf virus Species 0.000 abstract description 12
- 201000010099 disease Diseases 0.000 abstract description 9
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 abstract description 9
- 238000003745 diagnosis Methods 0.000 abstract description 6
- 238000011217 control strategy Methods 0.000 abstract description 2
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 7
- 241000176086 Sogatella furcifera Species 0.000 description 7
- 238000013461 design Methods 0.000 description 7
- 241000196324 Embryophyta Species 0.000 description 6
- 238000004519 manufacturing process Methods 0.000 description 6
- 235000021329 brown rice Nutrition 0.000 description 5
- 208000024891 symptom Diseases 0.000 description 5
- 241000702658 Fijivirus Species 0.000 description 4
- 238000003199 nucleic acid amplification method Methods 0.000 description 4
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 3
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 3
- 230000003321 amplification Effects 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 241000702656 Phytoreovirus Species 0.000 description 2
- 108700009942 Rice black streaked dwarf virus S9 Proteins 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 238000006073 displacement reaction Methods 0.000 description 2
- 238000004043 dyeing Methods 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 238000011081 inoculation Methods 0.000 description 2
- 108020004707 nucleic acids Proteins 0.000 description 2
- 102000039446 nucleic acids Human genes 0.000 description 2
- 150000007523 nucleic acids Chemical class 0.000 description 2
- 239000002773 nucleotide Substances 0.000 description 2
- 125000003729 nucleotide group Chemical group 0.000 description 2
- 230000000644 propagated effect Effects 0.000 description 2
- 230000035484 reaction time Effects 0.000 description 2
- 210000002845 virion Anatomy 0.000 description 2
- 102000040650 (ribonucleotides)n+m Human genes 0.000 description 1
- QKNYBSVHEMOAJP-UHFFFAOYSA-N 2-amino-2-(hydroxymethyl)propane-1,3-diol;hydron;chloride Chemical compound Cl.OCC(N)(CO)CO QKNYBSVHEMOAJP-UHFFFAOYSA-N 0.000 description 1
- 241000193830 Bacillus <bacterium> Species 0.000 description 1
- 241000894006 Bacteria Species 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 241000237502 Ostreidae Species 0.000 description 1
- 229920002684 Sepharose Polymers 0.000 description 1
- 240000008042 Zea mays Species 0.000 description 1
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 description 1
- 235000002017 Zea mays subsp mays Nutrition 0.000 description 1
- 206010000496 acne Diseases 0.000 description 1
- 238000013459 approach Methods 0.000 description 1
- 238000004737 colorimetric analysis Methods 0.000 description 1
- 235000005822 corn Nutrition 0.000 description 1
- 230000004069 differentiation Effects 0.000 description 1
- 239000000539 dimer Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000009313 farming Methods 0.000 description 1
- KWIUHFFTVRNATP-UHFFFAOYSA-N glycine betaine Chemical compound C[N+](C)(C)CC([O-])=O KWIUHFFTVRNATP-UHFFFAOYSA-N 0.000 description 1
- 238000011068 loading method Methods 0.000 description 1
- 230000001404 mediated effect Effects 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 239000013642 negative control Substances 0.000 description 1
- 238000005457 optimization Methods 0.000 description 1
- 235000020636 oyster Nutrition 0.000 description 1
- 244000045947 parasite Species 0.000 description 1
- 239000002245 particle Substances 0.000 description 1
- 239000002574 poison Substances 0.000 description 1
- 231100000614 poison Toxicity 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 239000000376 reactant Substances 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 239000003161 ribonuclease inhibitor Substances 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 230000000007 visual effect Effects 0.000 description 1
- 238000012800 visualization Methods 0.000 description 1
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a rapid detection technology for southern rice black-streaked dwarf viruses in plant hopper and a method for applying the rapid detection technology to disease diagnosis and prediction. By the method, the interference of rice black-streaked dwarf viruses can be eliminated, and whether the southern rice black-streaked dwarf viruses are carried in the plant hopper is rapidly identified, so that a pertinent control strategy is adopted to reduce the loss caused by diseases.
Description
Technical field
The present invention relates to the Fast Detection Technique of southern rice black-streaked dwarf virus in the plant hopper body and in disease screening with the application of observing and predicting, belong to the agricultural cience and farming techniques field.
Background technology
Rice black-streaked dwarf virus (Rice black-streaked dwarf virus, RBSDV), a kind ofly on the paddy rice to endanger serious virus disease, be under the jurisdiction of Phytoreovirus section Fijivirus and belong to (Fijivirus), virion is spherical, mainly propagated by small brown rice planthopper, symptom main manifestations in early stage in field stunts for planting, leaf dark green, later stage wax occurs at blade, leaf sheath and cane and drips the shape projection, then form secret note, very large to the yield effect of paddy rice, grave illness field even can cause without output.Should disease spread generation in the area, Jiangsu and Zhejiang Provinces in recent years, and be day by day serious trend, 2008 are only Jiangsu Province's onset area just reaches 4,000,000 mu, causes local Rice Production loss serious.Economized a kind of Virus Diseases of Rice of kainogenesis since 2007 in Guangdong and Hainan etc., the field symptom is extremely similar to rice black-streaked dwarf virus, its genome sequence is measured rear discovery itself and rice black-streaked dwarf virus have larger difference (homology of both S9 and S10 fragment only is 75% and 80%), name and be southern rice black-streaked dwarf virus (Southern rice black-streaked dwarf virus, SRBSDV), this virus also belongs to Phytoreovirus section Fijivirus and belongs to (Fijivirus), virion is spherical, genome is comprised of 10 double-stranded RNAs, vector is mainly white backed planthopper, small brown rice planthopper also can be propagated, the field Symptoms is that plant stunts, dark green leaf color, strip oyster white or Vandyke brown pimple appear in blade back and stem stalk, and the host also comprises corn and multiple weeds except paddy rice.Should spread generation in disease THE LOWER YANGTZE VALLEY area in recent years, and be day by day serious trend, area occurs and reaches 3,000,000 mu in the southern rice black-streaked dwarf virus whole nation in 2009, rose to rapidly 1,900 ten thousand mu in 2010, only the Hunan Province just occurs nearly 1,000 ten thousand mu, 80,000 mu of total crop failure areas have brought huge loss to paddy rice production.
Because two-strain is closely similar at aspects such as symptom, plastochondria shape, vector and hosts, has also caused difficulty to its diagnosis and evaluation thus.The normal method that adopts has on the plant virus Identification at present: the biological inoculation experiment, serology detects, electron microscopic observation and molecular Biological Detection.Because this two-strain all has the characteristic that approaches very much aspect a lot, therefore traditional plant virus detection method identifies that such as electron microscopic observation (the virus particle size shape is close), traditional biological inoculation (symptom, amboceptor, host range are close), serology detect methods such as (sequence still have higher homology) and all be difficult to differentiation.Ring mediated constant temperature nucleic acid amplification technology (loop-mediated isothermal amplification, LAMP), that it is a kind of high-sensitive strand displacement technology, a kind of novel PCR substitute technology by the constant temperature nucleic acid amplification method in a kind of novelty of invention in 2000 such as Notomi T.The LAMP characteristics be for 6 zone design of target gene 4 special primers, utilizing a kind of strand displacement archaeal dna polymerase---Bst (Bacilluss tearothermophilus) DNA polymerase reacts under the condition of constant temperature (65 ℃) can finish nucleic acid amplification reaction in 1 hour, just can obtain clearly reaction result by the direct visual colorimetry of fluorescent dye.Do not need long temperature cycle, do not need the expensive instruments such as PCR, do not need the loaded down with trivial details processes such as electrophoresis ultraviolet observation.Disease detection and quick diagnosis that the mankind and the various viruses of animals and plants, bacterium, parasite etc. cause have been widely used at present.
Summary of the invention
The invention provides the method for southern rice black-streaked dwarf virus in a kind of rapid detection plant hopper body, can quick diagnosis go out plant hopper by the method and whether carry southern rice black-streaked dwarf virus.
The method of southern rice black-streaked dwarf virus in a kind of rapid detection plant hopper body provided by the present invention obtains by the following method:
1) the southern rice black-streaked dwarf virus S9 nucleotide sequence of having reported according to NCBI, analyze the rear relative conservative region 311-770bp of selection by software DNAstar, utilize the corresponding zone on the EU523359.1 to design primer by online primer-design software primerExplorer V4 (http://primerexplorer.jp/elamp4.0.0/index.html), comprising 2 outer primer F3/B3 and 2 inner primer FIP/BIP.;
2) Trizol reagent method is extracted the total RNA of plant;
3) different inside and outside primer concentration ratios, Mg are set
2+Concentration is determined the optimum response system; Change respectively reaction times and temperature and carry out the RT-LAMP amplified reaction, determine optimum reaction condition.
4) under optimum response system, condition, take the specificity of rice black-streaked dwarf virus as this method of contrast checking;
5) compare the reliability of checking RT-LAMP with the RT-PCR method;
6) by naked eyes judgement and SYBR GreenI dyeing the RT-LAMP product is carried out visualization processing.
Primer sequence provided by the invention is as follows:
F3 GCTAACTACGTTCGACAACC
B3 ACAGAGGAAGCAAAGACATT
FIP GCTTTCAACGACAATTTTCAAAACG-GAACATCAGCATTAAATCTCCT
BIP AAGATGATGAATCACAGAGACCCA-ACAAACTTCTTTTCTTGCTCAT。
The temperature of reaction of RT-LAMP is 61-62 ℃, and the reaction times is 40-120min.Utilize electrophoresis detection or fluorescence dye method can get rid of the interference of black streaked dwarf virus of rice, quick diagnosis goes out plant hopper and whether carries southern rice black-streaked dwarf virus.
Utilize this method can get rid of the interference of black streaked dwarf virus of rice, Rapid identification goes out whether to carry southern rice black-streaked dwarf virus in the plant hopper body, and then takes targetedly control strategy, reduces the loss that disease is brought.
Description of drawings
Fig. 1 is that (M is standard molecular weight for the electrophorogram of RT-LAMP result under the differential responses temperature condition; 1 is 60 ℃; 2 is 61 ℃; 3 is 62 ℃; 4 is 63 ℃; 5 is 64 ℃; 6 is 65 ℃; 7 negative contrasts).
Fig. 2 be southern rice black-streaked dwarf virus RT-LAMP reaction specific test as a result figure (M is standard molecular weight; 1 is the white backed planthopper of carrying SRBSDV; 2 is the small brown rice planthopper of carrying RBSDV; 3 is the white backed planthopper of not carrying SRBSDV; 4 negative contrasts).
Specific implementation method
1. the design of southern rice black-streaked dwarf virus RT-LAMP primer.
According to the southern rice black-streaked dwarf virus S9 nucleotide sequence (EU523359.1, the http://www.ncbi.nlm.nih.gov/nuccore/183229399 that have reported on the NCBI; EU784843.1.http: //www.ncbi.nlm.nih.gov/nuccore/209867306) design primer.As template, use online LAMP primer-design software primerExplorer V4 (http://primerexplorerjp/elamp4.0.0/index.html) to design primer with the relatively conservative one section sequence (311-770bp) of this virus.After template sequence uploaded, calculate the preliminary LAMP combination of primers (F3 of acquisition by system software, B3, FIP, BIP), corresponding 3 ' the end of the primer that provides by software again or the parameters such as 5 ' end stability and primer dimer manyly compare selection to primer to what design, finally choose one group of only primer, and sequence is as follows:
F3 GCTAACTACGTTCGACAACC
B3 ACAGAGGAAGCAAAGACATT
FIP GCTTTCAACGACAATTTTCAAAACG-GAACATCAGCATTAAATCTCCT
BIP AAGATGATGAATCACAGAGACCCA-ACAAACTTCTTTTCTTGCTCAT。
2. the thermograde of southern rice black-streaked dwarf virus RT-LAMP experiment
Obtain to be with malicious white backed planthopper for examination after susceptible rice plant is raised poison, susceptible rice plant and the detection that obtains malicious white backed planthopper are with reference to season quintessence's etc. method (season quintessence etc., " rice in China science ", 2011).Reference
Reagent (Invitrogen) operation instruction is extracted the total RNA of plant hopper.Although the optimal reactive temperature of Bst DNA polymerase is 65.8 ℃, but many reports have confirmed that the suitable temperature of reaction of RT-LAMP is between 60 ℃-65 ℃, simultaneously because different primers can not guarantee that when design the Tm value of all primers is in full accord, and RT-LAMP also will consider the suitable temperature of reaction of ThermoScript II, in view of this, the present invention is optimized test to the RT-LAMP temperature of reaction.The RT-LAMP system is: each 0.2 μ M of outer primer F3 and B3, each 1.6 μ M of inner primer FIP and BIP, dNTP mixture (10mM each) 2.5 μ l, 20mM Tris-HCl (8.8,25 ℃ of pH), 10mM KCl, 10mM (NH4)
2SO
4, 8mM MgSO
4, 0.1%TritonX-100, Bst archaeal dna polymerase, large fragment 8U, M-MuLV ThermoScript II 100U, RNase Inhibitor 20U, 0.8M trimethyl-glycine, 3.5 μ l RNA templates.The mixing reactant is at 60 ℃, and 61 ℃, 62 ℃, 63 ℃, 64 ℃, isothermal reaction 1h under 65 ℃ of six kinds of conditions, 80 ℃ of reaction 5min stop the RT-LAMP reaction, get 2 μ L amplified production loadings, carry out electrophoresis at 1.5% sepharose, electrophoresis result EB dyeing.The result is presented under the same reaction system condition, at 60 ℃, 61 ℃, 62 ℃, stepped amplified band is arranged, wherein 61 ℃ behind 63 ℃ and 64 ℃ of isothermal reaction 1h, the electrophoretic band brightness of the amplified production behind 62 ℃ of isothermal reaction 1h is almost identical, 60 ℃, some weakens slightly in the band brightness of amplified production behind 63 ℃, 64 ℃ isothermal reaction 1h, and 65 ℃ of isothermal reaction 1h and negative control are without stepped amplified band (Fig. 1).Therefore the temperature of reaction of RT-LAMP of the present invention should be 61-62 ℃
In order to verify the specificity of RT-LAMP method, the rice black-streaked dwarf virus (RBSDV) of selection and the same genus of SRBSDV in contrast.Take the white backed planthopper of carrying SRBSDV and the small brown rice planthopper RNA that carries RBSDV as template, react with the RT-LAMP reaction system among the embodiment 1 respectively.The result shows when the RT-LAMP primer with this experiment goes amplification to carry the total RNA of RBSDV small brown rice planthopper there is not amplified production; And can amplify purpose product (Fig. 2) when carrying the total RNA of SRBSDV white backed planthopper.This and expected results coincide, and show that the RT-LAMP detection method that the present invention sets up has fine specificity.
The method of southern rice black-streaked dwarf virus in a kind of rapid detection plant hopper body can quick diagnosis goes out plant hopper by the method and whether carries southern rice black-streaked dwarf virus.
Above-mentioned enforcement does not limit the present invention in any form.
Claims (1)
1. the method for southern rice black-streaked dwarf virus in the rapid detection plant hopper body, it is characterized in that: the Auele Specific Primer that utilizes the RT-LAMP reaction, isothermal reaction 40-120min under 61-62 ℃ of condition, utilize electrophoresis detection or fluorescence dye method can get rid of the interference of black streaked dwarf virus of rice, identify whether carry southern rice black-streaked dwarf virus in the plant hopper body, described " Auele Specific Primer of RT-LAMP reaction " refers to following 4 primers:
F3 GCTAACTACGTTCGACAACC
B3 ACAGAGGAAGCAAAGACATT
FIP GCTTTCAACGACAATTTTCAAAACG-GAACATCAGCATTAAATCTCCT
BIP AAGATGATGAATCACAGAGACCCA-ACAAACTTCTTTTCTTGCTCAT。
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110071917 CN102168150B (en) | 2011-03-24 | 2011-03-24 | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting southern rice black-streaked dwarf viruses in plant hopper |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201110071917 CN102168150B (en) | 2011-03-24 | 2011-03-24 | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting southern rice black-streaked dwarf viruses in plant hopper |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102168150A CN102168150A (en) | 2011-08-31 |
CN102168150B true CN102168150B (en) | 2013-04-10 |
Family
ID=44489463
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201110071917 Expired - Fee Related CN102168150B (en) | 2011-03-24 | 2011-03-24 | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting southern rice black-streaked dwarf viruses in plant hopper |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102168150B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101980800B1 (en) | 2018-08-16 | 2019-05-21 | 대한민국 | Primers for loop-mediated isothermal amplification to detect Sogatella furcifera and detection method for S. furcifera by using the same |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104076144B (en) * | 2014-07-08 | 2016-01-27 | 福建农林大学 | A kind of immunofluorescence label detection method of planthopper hemolymph inner virus albumen |
CN106755601A (en) * | 2017-03-07 | 2017-05-31 | 江苏省农业科学院 | Using RT-LAMP method quick detection MRDV cause of diseases |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101430335A (en) * | 2008-11-13 | 2009-05-13 | 江苏省农业科学院 | Immunity detection reagent kit for rice black-streaked dwarf fijivirus in single-head small brown rice planthopper |
CN101691614A (en) * | 2009-10-09 | 2010-04-07 | 江苏省农业科学院 | Method for rapidly identifying rice black-streaked dwarf virus and southern rice black-streaked dwarf virus |
CN101713001A (en) * | 2009-12-09 | 2010-05-26 | 湖南农业大学 | RT-PCR detection method of south rice black-streaked dwarf virus (SRBSDV) |
-
2011
- 2011-03-24 CN CN 201110071917 patent/CN102168150B/en not_active Expired - Fee Related
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101430335A (en) * | 2008-11-13 | 2009-05-13 | 江苏省农业科学院 | Immunity detection reagent kit for rice black-streaked dwarf fijivirus in single-head small brown rice planthopper |
CN101691614A (en) * | 2009-10-09 | 2010-04-07 | 江苏省农业科学院 | Method for rapidly identifying rice black-streaked dwarf virus and southern rice black-streaked dwarf virus |
CN101713001A (en) * | 2009-12-09 | 2010-05-26 | 湖南农业大学 | RT-PCR detection method of south rice black-streaked dwarf virus (SRBSDV) |
Non-Patent Citations (4)
Title |
---|
Dung Tien Le et al..Molecular detection of nine rice viruses by a reverse-transcription loop-mediated isothermal amplification assay.《Journal of Virological Methods》.2010,第170卷90–93. |
Molecular detection of nine rice viruses by a reverse-transcription loop-mediated isothermal amplification assay;Dung Tien Le et al.;《Journal of Virological Methods》;20100915;第170卷;90-93 * |
Reverse transcription loop-mediated isothermal amplification of RNA for sensitive and rapid detection of southern rice black-streaked dwarf virus;Tong Zhou et al.;《Journal of Virological Methods》;20111230;第180卷;91-95 * |
Tong Zhou et al..Reverse transcription loop-mediated isothermal amplification of RNA for sensitive and rapid detection of southern rice black-streaked dwarf virus.《Journal of Virological Methods》.2011,第180卷91-95. |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101980800B1 (en) | 2018-08-16 | 2019-05-21 | 대한민국 | Primers for loop-mediated isothermal amplification to detect Sogatella furcifera and detection method for S. furcifera by using the same |
Also Published As
Publication number | Publication date |
---|---|
CN102168150A (en) | 2011-08-31 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101691614B (en) | Method for rapidly identifying rice black-streaked dwarf virus and southern rice black-streaked dwarf virus | |
CN102827929B (en) | Method for detecting nucleic acid | |
CN107022624B (en) | LAMP method and kit for rapidly detecting bakanae disease bacteria of rice from rice seeds | |
CN102099488B (en) | Method for amplifying oligonucleotide and small RNA by using polymerase-endonuclease chain reaction | |
CN109913565B (en) | Kit, primer pair, probe and method for detecting vibrio parahaemolyticus | |
CN104774955A (en) | Botryosphaeria dothidea detection method | |
CN102168150B (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting southern rice black-streaked dwarf viruses in plant hopper | |
CN102154518B (en) | Technology for rapidly detecting rice black-streaked dwarf viruses in plants by reverse transcription-loop-mediated isothermal amplification (RT-LAMP) method | |
CN107254552A (en) | A kind of method that tomato yellow leaf curl virus is detected based on RPA | |
CN104593502A (en) | Loop-mediated isothermal amplification primer composition capable of detecting colletotrichum truncatum and application thereof | |
CN104195269B (en) | A kind of method detecting tomato spotted wilf virus | |
CN102286634B (en) | Technology for quickly detecting southern rice black-streaked stunt virus of plant by RT-LAMP (Reverse Transcription-Loop-mediated Isothermal Amplification) method | |
CN101899530B (en) | Loop-mediated isothermal amplification detection method of tobacco mosaic viruses | |
KR101934548B1 (en) | Method for Multiplex Analysis of Cylindrocarpon destructans and Fusarium solani Using Real-time PCR | |
CN106350581A (en) | Method for detecting bacterial vaginosis by using detection kit | |
CN109439801A (en) | A kind of honeybee Israel acute paralysis virus real-time fluorescent RT-PCR detection reagent box and its detection method | |
CN102168151B (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) method for rapidly detecting rice black-streaked dwarf viruses in plant hopper | |
CN102676653A (en) | Non-diagnostic method for detection of O1 group and O139 group of vibrio cholerae through double TaqMan probe fluorescence RT-PCR (Reverse Transcription-Polymerase Chain Reaction) | |
CN110804674B (en) | Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit | |
CN102618627B (en) | Internal reference detection system and kit for isothermal nucleic acid amplification reaction | |
CN115029470A (en) | Combination product and kit for detecting rice bacterial blight | |
CN107904284A (en) | The nucleic acid constant-temperature amplification method of programmatic method and its kit application | |
CN102703605B (en) | Kit for rapidly detecting banana streak virus (BSV) by isothermal gene amplification and use method of kit | |
CN102747161B (en) | Kit and oligonucleotides for detecting genetically modified maize line Mon88017 | |
Ma et al. | Rapid detection of Prorocentrum donghaiense using nuclease protection assay integrated with dot nucleic acid chromatography strip |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130410 |
|
CF01 | Termination of patent right due to non-payment of annual fee |