CN102154504A - HRM (high resolution melting) joint detection method for ADSL (adenylosuccinate lyase) and LPL (lipoprotein lipase) genes related to meat quality and flavor of chicken - Google Patents
HRM (high resolution melting) joint detection method for ADSL (adenylosuccinate lyase) and LPL (lipoprotein lipase) genes related to meat quality and flavor of chicken Download PDFInfo
- Publication number
- CN102154504A CN102154504A CN 201110099362 CN201110099362A CN102154504A CN 102154504 A CN102154504 A CN 102154504A CN 201110099362 CN201110099362 CN 201110099362 CN 201110099362 A CN201110099362 A CN 201110099362A CN 102154504 A CN102154504 A CN 102154504A
- Authority
- CN
- China
- Prior art keywords
- adsl
- lpl
- gene
- chicken
- values
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a HRM (high resolution melting) joint detection method for ADSL (adenylosuccinate lyase) and LPL (lipoprotein lipase) genes related to meat quality and flavor of a chicken; the method is characterized in that the method comprises the following steps of: (a) extracting the DNA (deoxyribonucleic acid) of a genome template of chicken blood, and using a fluorescence quantitative PCR (polymerase chain reaction) procedure for simultaneously carrying out ADSL (adenylosuccinate lyase) and LPL (lipoprotein lipase) gene amplification; (b) using a high resolution melting curve analytical method for detecting Tm values of the amplified target genes; and (c) screening out mutational sites according to the typing standard of the ADSL (adenylosuccinate lyase) and LPL (lipoprotein lipase) genes. The method is simple, convenient and rapid, has low cost and accurate results, solves the trouble of batch operation on multiple genes, is conductive to speeding up screening of broilers with higher content of flavor materials and guide molecular labeling and breeding of meat quality and flavor of the chicken.
Description
Technical field
The present invention relates to a kind of associating, fast, accurately screen the detection method of chicken matter local flavor related gene polymorphism, belong to agricultural biological technical field.
Background technology
High quality meat chicken is meant the class meat chicken kind for the fast big chicken kind of external white plumage.The high quality meat chicken production of China is through the fast development of three more than ten years, become that industry is with conspicuous characteristics, regional advantages are obvious, the market share continues to enlarge, the powerful day by day agriculture mainstay industry of competitive power.2008, China's annual listing high-quality chicken reached 4,200,000,000, and 3,800,000 tons of meat yields have accounted for more than 55% of China's chicken ultimate production.Different with the seed selection direction of valuing growth of meat chicken speed and body composition (meat yield) merely in the past, choice meat a breed of chicken, production more should be emphasized to win victory with meat matter and local flavor.From heredity, long speed of livestock and poultry and meat are the seed selection proterties of the mutual containing of two classes, only with traditional breeding technique, are difficult to reach the target that fryer output, growth performance and muscle flavour substances improve simultaneously.And along with the continuous progress of Protocols in Molecular Biology, adopt molecular genetic marker come assist-breeding not only meat flavor good, but also take into account the high quality meat chicken of the long speed of body weight, not only become possibility, and become the developing direction of modern poultry breeding day by day.Utilize little satellite, single nucleotide polymorphism equimolecular mark, can obviously accelerate breeding process, improve breeding efficiency.
Current research is thought, with the closely-related chemical ingredients of meat flavor amino acid (particularly L-glutamic acid and glycine), t-inosinic acid (IMP) and intramuscular fat (IMF) are arranged, the candidate gene that influences these chemical constitutions is a lot, wherein just comprises adenosine succsinic acid lyase (ADSL) gene and lipoproteinesterase (LPL) gene.Muscle IMP content is the essential substance basis of decision meat delicate flavour, and ADSL is that but catalysis has the enzyme of the two-step reaction of material impact to the final content of IMP in the purine nucleotides biosynthetic pathway, plays requisite effect to keeping normal cell division and metabolism.Shu Jingting etc. (2005) carry out snp analysis to the exon 2 of chicken ADSL gene, found that 1 polymorphic site, and the IMP content difference is remarkable between its different genotype.Muscle IMF and meat taste are proportionate, influence tender degree, shearing force, local flavor and the succulence of meat, and the LPL synthetic and a kind of glycoprotein of excretory that is parenchymas such as adipocyte, Skeletal Muscle Cell, scheming cell, triglyceride hydrolysis in main catalysis chylomicron and the vldl, generation can be the key enzyme of lipid metabolism for the lipid acid and the monoacylglycerol of tissue utilization.Mu Yanshuan etc. (2005) adopt PCR-SSCP and sequencing to analyze the nucleotide diversity of lpl gene, found that the sudden change of lpl gene heavily has remarkably influenced to live-weight, the abdomen fat of chicken.
(High Resolution Melting curve, HRM) analytical technology is a kind of brand-new the sudden change scanning and the methods of genotyping of rising in recent years to the high resolving power melting curve.Based on efficient sane fluorescent quantitative PCR technique, HRM is not limited to by the site of mutating alkali yl and type can, need not the sequence-specific probe, finish directly operation product fusion program of back at PCR, can finish the new transgenation of scanning, screening mononucleotide pleomorphism, differentiation insertion/disappearance or other mutation types, measure methylate DNA ratio or the like work.The cardinal principle of HRM is that the melting curve of application of high resolution is analyzed sample according to dna sequence dna length, GC content and base complementrity difference, and high temperature uniformity and temperature resolving accuracy can make it reach detectivity to single base difference.The HRM technological operation easy quick, with low cost, the result is accurate, can realize stopped pipe operation truly.
At present, other research meanses that can be used for Polymorphism Analysis mainly contain technology such as RFLP, SSCP, Taqman probe quantitative PCR, dna direct order-checking, but complex operation mostly, it is expensive to waste time and energy, poor repeatability does not possess the practicality that sample in enormous quantities is quick and precisely detected.For example the RFLP method combines PCR with restriction enzyme digestion, and experimental implementation is loaded down with trivial details, and sense cycle is long, exists first enzyme to cut the false positive that not exclusively causes.The PCR-SSCP method can not detect the sudden change position, and may have false negative, and result's repeatability is not high.The Taqman probe method can only detect known SNP, and cost value is high relatively.The dna direct sequencing cycle is grown, costs dearly, and the detection of polygene multidigit point needs repeatedly reaction to finish, so should not adopt some genes bigger, that exon is more; And direct sequencing is not suitable for yet and clinical a large amount of samples is detected.
Summary of the invention
The objective of the invention is to overcome the shortcomings and deficiencies that exist in the prior art, a kind of chicken matter local flavor genes involved (ADSL and lpl gene) associated detecting method based on the HRM genotyping technique is provided.This method easy quick, with low cost, the result is accurate, has solved the trouble of a plurality of gene batchwise operations, helps to accelerate to screen the higher fryer individuality of flavour substances content, instructs the molecular selection of high-quality chicken meat flavor.
The ADSL relevant with chicken matter local flavor and the HRM associated detecting method of lpl gene is characterized in that may further comprise the steps:
A) extract chicken blood genomic templates DNA, utilize the quantitative fluorescent PCR response procedures to carry out the amplification of ADSL and lpl gene simultaneously, wherein, specific primer sequence is:
ADSL upstream region of gene primer: 5 ' GAAGAAGCTGCGCCATGATGTG 3 '
ADSL gene downstream primer: 5 ' CCAGCTCTGCAGGCAGGAAAATGA 3 '
Lpl gene upstream primer: 5 ' GTGAAGGATGGGAGGGACAGC 3 '
Lpl gene downstream primer: 5 ' CCCTACAAATCAACCTGGCTCCATC 3 ';
B) utilization high resolution melting curve analytical procedure detects the Tm value of the back goal gene that increases;
C) according to ADSL and lpl gene somatotype standard, filter out the mutational site.
Further, the quantitative fluorescent PCR reaction system is among the step b:
Further, the quantitative fluorescent PCR response procedures comprises pcr amplification program and product fusion program among the step b.The pcr amplification program is preferably: 98 ℃ of pre-sex change 3 minutes; 98 ℃ of sex change 5 seconds, 62 ℃ of annealing/extensions 5 seconds, 40 circulations.Product fusion program is preferably: 75 ℃ of initial melting temperature (Tm)s, start the fusion that heats up to 95 ℃, and rose 0.2 ℃ the omnidistance fluorescent signal that detects in real time of fusion in per 10 seconds.
ADSL gene type standard is among the step c: 84.5 ℃ of CC wild-type Tm values; 81.2 ℃ of CT mutant Tm values; 79.4 ℃ of TT mutant Tm values; Lpl gene somatotype standard is: 84.2 ℃ of CC wild-type Tm values; 82.8 ℃ of CT mutant Tm values; 80.4 ℃ of TT mutant Tm values.
The present invention is directed to the continuous nucleotide sequences Design screening Auele Specific Primer of at least 2 target area of goal gene, the ADSL gene extron 2 that obtains and lpl gene 5 ' control region primer sequence are seen step a.
The present invention adopts poba gene group DNA to extract test kit (Axygen company) in a small amount, extracts the chicken blood genomic dna, and the ratio of A260/A280 is at 1.6-1.8.In CFX 96 quantitative PCR instrument (Bio-Rad), go up sample, carry out the fusion of pcr amplification and product, adopt Precision Melt Analysis
TMSoftware carries out HRM to be analyzed, different according to the Tm value difference, the ADSL of analysis and judgement sample and lpl gene type.
The present invention finds that according to Chinese scholars and my result of study to chicken flavor substances content, molecular genetics mark the C3484T sudden change of ADSL gene extron 2 is influential to imp content, and the individual imp content of CT genotype is minimum; The C235T of lpl gene 5 ' control region, C278T, C298T suddenly change influential to intramuscular fat content, and the individual intramuscular fat content of CC genotype is minimum, shows that ADSL and lpl gene all play regulating and controlling effect in the chicken flavor substances forming process.By the polymorphism of these two genes of HRM joint-detection, reject the individuality of CT (ADSL) or CC (LPL) genotype combination; Keep the individuality of CC (ADSL) TT (LPL), the combination of TT (ADSL) TT (LPL) genotype, can specific aim select the higher good chicken kind of flavour substances content.
Description of drawings
Fig. 1 is a chicken blood sample template DNA electrophorogram.
Fig. 2 is the melting curve figure (the ADSL gene that increases separately, difference curve) after the amplification of chicken blood sample template DNA.
Fig. 3 is the melting curve figure (the ADSL gene that increases separately, fusing point peak) after the amplification of chicken blood sample template DNA.
Fig. 4 is the melting curve figure (lpl gene that increases separately, difference curve) after the amplification of chicken blood sample template DNA.
Fig. 5 is the melting curve figure (lpl gene that increases separately, fusing point peak) after the amplification of chicken blood sample template DNA.
Fig. 6 is the melting curve figure (uniting amplification ADSL and lpl gene, difference curve) after the amplification of chicken blood sample template DNA.
Fig. 7 is the melting curve figure (uniting amplification ADSL and lpl gene, the fusing point peak) after the amplification of chicken blood sample template DNA.
Fig. 8 is the melting curve figure (uniting amplification ADSL and lpl gene, difference curve) that increases behind the chicken blood sample template DNA gradient dilution.
Fig. 9 is the melting curve figure (uniting amplification ADSL and lpl gene, the fusing point peak) that increases behind the chicken blood sample template DNA gradient dilution.
Figure 10 is the melting curve figure of 14 CT (ADSL) CC (LPL) genotype combination that filters out of certain chicken kind.
Embodiment
Further specify the present invention below in conjunction with drawings and Examples.Goal gene of the present invention is ADSL gene in the ncbi database (sequence number AY665559) and lpl gene (sequence number X60547).Described primer is at goal gene target area (ADSL gene extron 2 and lpl gene a 5 ' control region) 21-25 successive nucleotide sequence.Described amplification condition comprise template processing, application of sample reagent composition, the reaction density and the PCR of each composition go up machine amplification and melting temperature (Tm) program.
The primer of design ADSL gene is as follows to sequence:
ADSL-F：5′GAAGAAGCTGCGCCATGATGTG?3′
ADSL-R：5′CCAGCTCTGCAGGCAGGAAAATGA?3′
The length of amplified production is 153bp.
The primer of design lpl gene is as follows to sequence:
LPL-F：5′GTGAAGGATGGGAGGGACAGC?3′
LPL-R：5′CCCTACAAATCAACCTGGCTCCATC?3′
The length of amplified production is 203bp.
The PCR reaction system of optimizing (15 μ L) is as follows:
DNase-free?water：5.5μL
SsoFast?EvaGreen?supermix：7.5μL
Goal gene upstream and downstream primer: totally 1.0 μ L
Template DNA: 1.0 μ L
Pcr amplification and the fusion program optimized are as follows:
98 ℃ of pre-sex change 3 minutes
98 ℃ of sex change 5 seconds, 62 ℃ of annealing/extensions 5 seconds, 40 circulations
75 ℃ of initial melting temperature (Tm)s start the fusion that heats up to 95 ℃, rose 0.2 ℃ in per 10 seconds,
Embodiment 1: the extraction of genomic dna
(1) blood sample collection
Chicken Baoding, wing venous blood collection 1.5-2.0mL, adding fills in the centrifuge tube of 8mL 70% dehydrated alcohol mixing postposition-20 ℃ preservation.
(2) DNA extraction
Blood sampling adopts poba gene group DNA to extract test kit (Axygen company) in a small amount, extracts DNA according to the test kit operation instructions.
(3) DNA purity and mass analysis
The DNA that extracts meets following condition and can be considered qualified: 1. use spectrophotometric determination DNA concentration, the ratio of A260/A280 is at 1.6-1.8.2. 1% agarose gel electrophoresis (going up sample 6 μ L, 120V pressurization, 25 minutes), main band is clear.Chicken blood sample template DNA electrophorogram is seen Fig. 1.
If meet above condition, DNA is put-20 ℃ of preservations, wait until template DNA as the PCR reaction.
The detection of embodiment 2:ADSL gene pleiomorphism
ADSL gene by fluorescence quantitative PCR reaction system is as follows:
DNase-free?water：5.5μL
SsoFast?EvaGreen?supermix：7.5μL
ADSL upstream region of gene primer: 0.5 μ L
ADSL gene downstream primer: 0.5 μ L
Template DNA: 1.0 μ L
The careful 15 μ L reaction systems that add each sample to be tested in 0.2mL 8-tube strips (Bio-Rad), 2000rpm is following centrifugal 5 seconds behind the mixing, CFX 96 quantitative PCR instrument (Bio-Rad) are gone up sample, carry out the fusion of pcr amplification and product, adopt Precision Melt Analysis
TMSoftware carries out HRM and analyzes.
Melting curve figure (the ADSL gene increases separately) after 5 chicken blood sample template DNAs increase sees Fig. 2, Fig. 3.As seen from Figure 3, the Tm value of 5 samples is 81.2 ℃, according to the somatotype standard of ADSL gene: 84.5 ℃ of CC wild-type Tm values; 81.2 ℃ of CT mutant Tm values; 79.4 ℃ of TT mutant Tm values judge that 5 samples are the CT mutant of ADSL gene.
The detection of embodiment 3:LPL gene pleiomorphism
Lpl gene quantitative fluorescent PCR reaction system is as follows:
DNase-free?water：5.5μL
SsoFast?EvaGreen?supermix：7.5μL
Lpl gene upstream primer: 0.5 μ L
Lpl gene downstream primer: 0.5 μ L
Template DNA: 1.0 μ L
The careful 15 μ L reaction systems that add each sample to be tested in 0.2mL 8-tube strips (Bio-Rad), 2000rpm is following centrifugal 5 seconds behind the mixing, CFX 96 quantitative PCR instrument (Bio-Rad) are gone up sample, carry out the fusion of pcr amplification and product, adopt Precision Melt Analysis
TMSoftware carries out HRM and analyzes.
Melting curve figure (lpl gene increases separately) after 5 chicken blood sample template DNAs increase sees Fig. 4, Fig. 5.As seen from Figure 5, the Tm value of 5 samples is 84.2 ℃, according to the somatotype standard of lpl gene: 84.2 ℃ of CC wild-type Tm values; 82.8 ℃ of CT mutant Tm values; 80.4 ℃ of TT mutant Tm values judge that 5 samples are the CC wild-type of lpl gene.
The joint-detection of embodiment 4:ADSL and lpl gene polymorphism
ADSL and lpl gene quantitative fluorescent PCR reaction system are as follows:
DNase-free?water：5.5μL
SsoFast?EvaGreen?supermix：7.5μL
ADSL upstream region of gene primer: 0.25 μ L
ADSL gene downstream primer: 0.25 μ L
Lpl gene upstream primer: 0.25 μ L
Lpl gene downstream primer: 0.25 μ L
Template DNA: 1.0 μ L
The careful 15 μ L reaction systems that add each sample to be tested in 0.2mL 8-tube strips (Bio-Rad), 2000rpm is following centrifugal 5 seconds behind the mixing, CFX 96 quantitative PCR instrument (Bio-Rad) are gone up sample, carry out the fusion of pcr amplification and product, adopt Precision Melt Analysis
TMSoftware carries out HRM and analyzes.
Melting curve figure after 5 chicken blood sample template DNAs increase (uniting amplification ADSL and lpl gene) sees Fig. 6, Fig. 7.As seen from Figure 7,2 apparent in view fusion peaks appear in 5 sample standard deviations, and the Tm value is respectively 81.2 ℃, 84.2 ℃, according to the somatotype standard of ADSL and lpl gene, judge that 5 samples are the combination of CT (ADSL) CC (LPL) genotype.
Embodiment 2, example 3, example 4 show that the result of ADSL and lpl gene joint-detection is consistent with monogenic detected result.
Embodiment 5: the sensitivity experiment of associated detecting method
Choose 2 chicken blood sample template DNAs in the example 4,, be diluted to 200ng/ μ L, 100ng/ μ L, 50ng/ μ L, 10ng/ μ L, 5ng/ μ L totally 5 concentration gradients respectively with SmartSpec plus nucleic acid-protein instrument (Bio-Rad) working sample DNA concentration.
The melting curve figure that increases behind 2 chicken blood sample template DNA gradient dilutions (uniting amplification ADSL and lpl gene) sees Fig. 8, Fig. 9.As seen from Figure 9, along with template DNA gradient dilution degree strengthens, the fusion dual peak height of appearance reduces gradually; Bimodal distinguishing during 10ng/ μ L concentration; Bimodal not obvious during 5ng/ μ L concentration.This experimental result shows that the sensitivity of ADSL and lpl gene joint-detection can reach 10ng/ μ L.
Embodiment 6: associated detecting method is used for certain chicken kind seed selection
(1) butcher performance, muscle flavour substances content and the ADSL genotype tests of certain chicken kind the results are shown in following table.
Annotate: AFW: abdomen fat is heavy; EP: complete clean thorax rate; AFP: abdomen fat rate; LMP: leg flesh rate; BMP: chest muscle rate; FFA: free fatty acids; LPL: lipoproteinesterase; IMF: intramuscular fat; IMP: t-inosinic acid.Shoulder mark lowercase different table differential different significantly (P＜0.05); Capitalization different table differential heteropole is (P＜0.01) significantly.
As seen from the above table, complete clean thorax rate, chest muscle rate are the highest with the TT genotype; Leg flesh rate is the highest with the CC genotype; Imp content is minimum with the CT genotype.
(2) butcher performance, muscle flavour substances content and the lpl gene somatotype detected result of certain chicken kind see the following form.
Annotate: AFW: abdomen fat is heavy; EP: complete clean thorax rate; AFP: abdomen fat rate; LMP: leg flesh rate; BMP: chest muscle rate; FFA: free fatty acids; LPL: lipoproteinesterase; IMF: intramuscular fat; IMP: t-inosinic acid.Shoulder mark lowercase different table differential different significantly (P＜0.05); Capitalization different table differential heteropole is (P＜0.01) significantly.
As seen from the above table, abdomen fat is heavy, abdomen fat rate is the highest with the CC genotype; Lipoproteinesterase, free fatty acids, intramuscular fat content are minimum with the CC type.
(3) as seen, ADSL and lpl gene produce remarkably influenced to the content of chicken flavor substances such as t-inosinic acid, intramuscular fat by above result.Two gene genotype combinations have 9 kinds---CCCC, CCCT, CCTT, CTCC, CTCT, CTTT, TTCC, TTCT, TTTT, and wherein, the performance of CT (ADSL) CC (LPL) genotype combination meat flavor is relatively poor; CC (ADSL) TT (LPL), the performance of TT (ADSL) TT (LPL) genotype combination meat flavor are better.
(4) adopt above-mentioned HRM associated detecting method that 192 samples of certain chicken kind are detected, the melting curve figure of 14 CT (ADSL) CC (LPL) genotype combination that filters out sees Figure 10.
SEQUENCE?LISTING
＜110〉Hangzhou City Agricultural Science Research Inst.
＜120〉ADSL relevant and the HRM associated detecting method of lpl gene with chicken matter local flavor
<130>
<160> 4
<170> PatentIn?version?3.3
<210> 1
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 1
gaagaagctg?cgccatgatg?tg 22
<210> 2
<211> 24
<212> DNA
＜213〉artificial sequence
<400> 2
ccagctctgc?aggcaggaaa?atga 24
<210> 3
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 3
gtgaaggatg?ggagggacag?c 21
<210> 4
<211> 25
<212> DNA
＜213〉artificial sequence
<400> 4
ccctacaaat?caacctggct?ccatc 25
Claims (6)
1. the ADSL relevant with chicken matter local flavor and the HRM associated detecting method of lpl gene is characterized in that may further comprise the steps:
A) extract chicken blood genomic templates DNA, utilize the quantitative fluorescent PCR response procedures to carry out the amplification of ADSL and lpl gene simultaneously, wherein, specific primer sequence is:
ADSL upstream region of gene primer: 5'GAAGAAGCTGCGCCATGATGTG 3'
ADSL gene downstream primer: 5'CCAGCTCTGCAGGCAGGAAAATGA 3'
Lpl gene upstream primer: 5'GTGAAGGATGGGAGGGACAGC 3'
Lpl gene downstream primer: 5'CCCTACAAATCAACCTGGCTCCATC 3';
B) utilization high resolution melting curve analytical procedure detects the Tm value of the back goal gene that increases;
C) according to ADSL and lpl gene somatotype standard, filter out the mutational site.
2. detection method as claimed in claim 1 is characterized in that, the quantitative fluorescent PCR reaction system is among the step b:
Sterile purified water 5.5 μ L
Fluorescent reagent 7.5 μ L
ADSL upstream primer 0.25 μ L
ADSL downstream primer 0.25 μ L
LPL upstream primer 0.25 μ L
LPL downstream primer 0.25 μ L
Template DNA 1.0 μ L.
3. detection method as claimed in claim 1 is characterized in that, the quantitative fluorescent PCR response procedures comprises pcr amplification program and product fusion program among the step b.
4. detection method as claimed in claim 3 is characterized in that, the pcr amplification program is: 98 ℃ of pre-sex change 3 minutes; 98 ℃ of sex change 5 seconds, 62 ℃ of annealing/extensions 5 seconds, 40 circulations; Product fusion program is: 75 ℃ of initial melting temperature (Tm)s, start the fusion that heats up to 95 ℃, and rose 0.2 ℃ the omnidistance fluorescent signal that detects in real time of fusion in per 10 seconds.
5.. detection method as claimed in claim 1 is characterized in that, ADSL gene type standard is among the step c: 84.5 ℃ of CC wild-type Tm values; 81.2 ℃ of CT mutant Tm values; 79.4 ℃ of TT mutant Tm values; Lpl gene somatotype standard is: 84.2 ℃ of CC wild-type Tm values; 82.8 ℃ of CT mutant Tm values; 80.4 ℃ of TT mutant Tm values.
6. detection method as claimed in claim 1 is characterized in that template DNA extracts among the step a from the peripheral blood sample of chicken.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110099362 CN102154504B (en) | 2011-04-20 | 2011-04-20 | HRM (high resolution melting) joint detection method for ADSL (adenylosuccinate lyase) and LPL (lipoprotein lipase) genes related to meat quality and flavor of chicken |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110099362 CN102154504B (en) | 2011-04-20 | 2011-04-20 | HRM (high resolution melting) joint detection method for ADSL (adenylosuccinate lyase) and LPL (lipoprotein lipase) genes related to meat quality and flavor of chicken |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102154504A true CN102154504A (en) | 2011-08-17 |
| CN102154504B CN102154504B (en) | 2012-10-17 |
Family
ID=44436173
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110099362 Expired - Fee Related CN102154504B (en) | 2011-04-20 | 2011-04-20 | HRM (high resolution melting) joint detection method for ADSL (adenylosuccinate lyase) and LPL (lipoprotein lipase) genes related to meat quality and flavor of chicken |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102154504B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894120A (en) * | 2015-06-08 | 2015-09-09 | 中国农业科学院兰州畜牧与兽药研究所 | Specific primers for detecting mRNA expression level of bovine LPL (lipoprotein lipase) genes and fluorescent quantitative detecting kit |
| CN106755334A (en) * | 2016-11-29 | 2017-05-31 | 吉林省农业科学院 | A kind of detection primer of gene of meat of a sheep qualitative correlation and method and its application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1730666A (en) * | 2004-08-06 | 2006-02-08 | 张沅 | Method for detecting chicken fat property using mononucleotide polymorphism |
| CN101691612A (en) * | 2009-08-05 | 2010-04-07 | 江苏省家禽科学研究所 | Gene diagnostic kit for chicken flavor substances and using method thereof |
| CN101838704A (en) * | 2010-06-22 | 2010-09-22 | 扬州大学 | Kit for multiple gene polymerization detection of chicken meat |
| CN101962646A (en) * | 2010-12-09 | 2011-02-02 | 华南农业大学 | Chicken meat quality-related gene IGFBR-1 and application thereof |
-
2011
- 2011-04-20 CN CN 201110099362 patent/CN102154504B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1730666A (en) * | 2004-08-06 | 2006-02-08 | 张沅 | Method for detecting chicken fat property using mononucleotide polymorphism |
| CN101691612A (en) * | 2009-08-05 | 2010-04-07 | 江苏省家禽科学研究所 | Gene diagnostic kit for chicken flavor substances and using method thereof |
| CN101838704A (en) * | 2010-06-22 | 2010-09-22 | 扬州大学 | Kit for multiple gene polymerization detection of chicken meat |
| CN101962646A (en) * | 2010-12-09 | 2011-02-02 | 华南农业大学 | Chicken meat quality-related gene IGFBR-1 and application thereof |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894120A (en) * | 2015-06-08 | 2015-09-09 | 中国农业科学院兰州畜牧与兽药研究所 | Specific primers for detecting mRNA expression level of bovine LPL (lipoprotein lipase) genes and fluorescent quantitative detecting kit |
| CN106755334A (en) * | 2016-11-29 | 2017-05-31 | 吉林省农业科学院 | A kind of detection primer of gene of meat of a sheep qualitative correlation and method and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102154504B (en) | 2012-10-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108486231A (en) | Primer combination of probe object, kit and application for detecting mankind's CYP2C19 gene pleiomorphisms | |
| CN110195123B (en) | Physalis angulata cpPSSR (plasmid-vector-sequence-derived sequence) labeled primer developed based on chloroplast genome sequence and application thereof | |
| CN103849681A (en) | Primer composition for guiding nitroglycerin medication and healthy drinking, multiple gene detection kit and use method of kit | |
| CN104017859A (en) | Method for identifying sugarcane germplasm resources based on SSR (Simple Sequence Repeats) and CE (capillary electrophoresis) technique | |
| CN110317880A (en) | Molecular labeling relevant to pannage conversion ratio, identification and its application | |
| CN110643716B (en) | Molecular marker related to sheep tail fat weight and application thereof | |
| CN102776286A (en) | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation | |
| CN102154504B (en) | HRM (high resolution melting) joint detection method for ADSL (adenylosuccinate lyase) and LPL (lipoprotein lipase) genes related to meat quality and flavor of chicken | |
| CN107475413B (en) | Method for screening crassostrea gigas parent shellfish with high content of unsaturated fatty acid C20:3 omega 6 | |
| CN108165635B (en) | KIAA1462 gene promoter region variant site and application thereof in improving egg laying performance of geese | |
| CN104988240B (en) | Differentiate the method for bee colony Higher production royal jelly character using SNP marker rs16287910 | |
| CN103320429A (en) | Method for detecting Qinchuan cattle Wnt7a gene single nucleotide polymorphism, and application thereof | |
| JPWO2019240073A1 (en) | Quantitative PCR probe | |
| CN102776184B (en) | Genetic marker using pig CKM (creatine kinase muscle) 5' flanking promoter region SNP (single nucleotide polymorphism) as pig carcass traits and application | |
| CN114592073A (en) | SNP (Single nucleotide polymorphism) affecting duck fatty acid composition related gene ELOVL3 | |
| CN110592237A (en) | Primer, probe, kit and detection method for detecting weight traits of white geese in east Zhejiang province | |
| CN103031376A (en) | Genetic diagnosis method for detecting different cattle groups at home and abroad | |
| CN109486957A (en) | Pig multiple groups integrate accurate breeding method | |
| CN109055578A (en) | A kind of PLAG1 gene SNP label auxiliary quickly detects the method and its application of ox growth traits | |
| CN103740830A (en) | Molecular marking method for indicating Qinchuan cattle meat tenderness and water-holding capacity by utilizing THRSP (thyroid hormone responsive spot) genes | |
| CN114457180B (en) | MNP core primer combination for molecular identification of kiwi variety and application thereof | |
| CN108342473A (en) | It is a kind of to be used to detect the kit that blood lipid metabolism related gene ABCG1 methylates | |
| CN113943791B (en) | Application of UC002yug.2-rs2246640 as female obesity biomarker | |
| CN113718039B (en) | SNP (Single nucleotide polymorphism) marker primer pair related to pig rib number character and application thereof | |
| CN113373240A (en) | Method for identifying gene locus related to duck muscle development |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20121017 Termination date: 20180420 |