CN103740830A - Molecular marking method for indicating Qinchuan cattle meat tenderness and water-holding capacity by utilizing THRSP (thyroid hormone responsive spot) genes - Google Patents
Molecular marking method for indicating Qinchuan cattle meat tenderness and water-holding capacity by utilizing THRSP (thyroid hormone responsive spot) genes Download PDFInfo
- Publication number
- CN103740830A CN103740830A CN201410014627.2A CN201410014627A CN103740830A CN 103740830 A CN103740830 A CN 103740830A CN 201410014627 A CN201410014627 A CN 201410014627A CN 103740830 A CN103740830 A CN 103740830A
- Authority
- CN
- China
- Prior art keywords
- thrsp
- qinchuan cattle
- genes
- qinchuan
- waterpower
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention relates to a molecular marking method for indicating Qinchuan cattle meat tenderness and water-holding capacity by utilizing THRSP (thyroid hormone responsive spot) genes. The method comprises the steps of designing a pair of primers according to a cattle THRSP gene sequence, executing the SSCP (single strand conformation polymorphism) band type detection on Qinchuan cattle whole-blood genomic group DNA (deoxyribonucleic acid) after PCR proliferation, and determining the Qinchuan cattle meat tenderness and the water-holding capacity by analyzing the band type. By adopting the PCR-SSCP technology and analyzing and comparing the variation point gene type, the meat quality of the cattle can be predicted and determined; the molecular marking method is simple to operate, low in expense, high in precision and capable of realizing rapid detection.
Description
Technical field
The invention belongs to Animal molecular biology and genetic engineering field, it is related to a kind of with THRSP genes indication Qinchuan Cattle Meat Tenderness and the molecule labelling method for being waterpower.
Background technology
Qinchuan Cattle has the advantages that body body is tall and big, working capacity is strong, Meat Performance good, inheritance stability, adaptability are good.Its origin can trace back to the B.C. Neolithic Age of 8000~6000 years, and its wild ancestor may be exactly the Asia aurochs of short angle-style.The formation of Qinchuan Cattle, the alfalfa for having " King of Pasture " laudatory title with Long-term Feeding has important relationship.At present, the number of animals raised of Guanzhong Region, Shaanxi Province, China Qinchuan Cattle and its Crossbred Cattle about 1,500,000 or so, the prosperity of development and rural economy to local agricultural production has important facilitation.In recent years, Qinchuan Cattle quality and quantity all has increased significantly.Especially implement《Province-norm》With《GB》Since, the constitution appearance of Qinchuan Cattle there occurs significant change, and physique generally increases, plump and sturdy; structure is well-balanced, it is purplish red and it is red dramatically increased by hair, still; Qinchuan Cattle also has growth relatively slowly, and muscle fat deposition capability is poor, cow mammary development is poor, the not high defect of the output of milk.The developing direction of Qinchuan Cattle should adhere to this breed breeding, retain original local flavor feature, the shortcomings of improving meat, correct buttocks portion point tiltedly, improve meat production, develop to meat direction.This breed breeding, is not all features of simple holding original seed, either with or without shortcoming, but on the basis of its intrinsic advantages is retained, corrects its shortcoming, be allowed to attain a yet higher goal, as the higher kind of economic worth.
Meat Quality is to evaluate good and bad and production performance height the important indicator of yellow cattle breed, and on the emphasis and Hot Contents of ox product Quality Research current world wide Genetic Improvement of Beef Cattle worker.In long-term Breeding Process, use meat from labour with Qinchuan Cattle and use as a servant dual-purpose, until being bred as final meat breed, the Meat Performance of Qinchuan Cattle is just progressively improved.Utilize Protocols in Molecular Biology, polymorphic Journal of Sex Research is carried out to the gene for influenceing Meat Quality, purpose is to explore the influence of the gene pairs beef cattle Meat Quality, the effective gene available for Meat Quality molecular marker assisted selection is found, the meat improvement for the local breeding ox of China provides certain theoretical foundation.
THRSP genes, i.e. thyroid hormone response protein Spot14 (thyroid hormone responsive Spot14, THRSP) are found when studying reaction of the thyroxine in adipose tissue.THRSP genes are main to express in fat generation tissue such as liver, abdominal fat and mammary gland.Chromosomal region where stimulation and high glucose level due to the albumen to thyroxine produce responsing reaction, and the gene is relevant with obesity, therefore is considered as having important effect to fat generation.Result of study on people shows, the THRSP assignments of genes gene mapping are in the chromosomal region relevant with obesity, the research such as Zhu is found, after mouse THRSP is knocked out, the content of triglyceride is substantially reduced in its breast, mainly due to caused by mammary gland lipid material de novo formation rate reduction, the Medium chain fatty acid content being embodied in triglycerides pond is significantly reduced, Cogburn etc. details chicken liver metabolic pathway in 2003, disclose the FAS in fatty constructive ways, LFABP, the expression quantity of the Major Enzymes such as C/EBPa is improved with the enhancing that THRSP is expressed, and THRSP may be identical to mammal and the activation mechanism that chicken liver fat generates enzyme.The THRSP genes of ox are located on No. 29 chromosome, comprising two extrons, an introne, and only First Exon encoding proteins.
Given this, it is contemplated that regarding THRSP genes as candidate gene, study its indication and detection Chinese Cattle Slaughter weight, carcass weight, trunk length, the thickness of backfat, eye muscle area, be the Meat Qualities such as waterpower, marbling, tenderness method, provide theoretical foundation for the meat improvement of China ox.
The content of the invention
It is combined with THRSP genes indication Qinchuan Cattle Meat Tenderness and the molecule labelling method for being waterpower it is an object of the invention to provide a kind of, by the analysis of variant sites genotype, is compared using PCR-SSCP technologies, so as to predicts and determine that the meat of the ox is good and bad.
The present invention is achieved through the following technical solutions：A kind of to indicate Qinchuan Cattle Meat Tenderness and the molecule labelling method for being waterpower with THRSP genes, this method comprises the following steps：
（1）The acquisition of Qinchuan Cattle Whole Blood Genomic DNA；
（2）Pair of primers THRSP-F and THRSP-R are designed according to ox THRSP gene orders, wherein：
THRSP-F：5’-3’：CGCCTCCGATCTCTACAACT（SEQ ID No.1）
THRSP-R：5’-3’：CCAGCTTCAGTCTCAGCTCC（SEQ ID No.2）
（3）Enter performing PCR amplification using this pair of primer pair Qinchuan Cattle Whole Blood Genomic DNA；
（4）The PCR primer of gained carries out SSCP banding pattern detections.
Step（4）In SSCP banding patterns be divided into tri- kinds of AA, AB and BB, AA types indication Qinchuan Cattle Meat Tenderness is significantly higher than AB types, BB types indication Qinchuan Cattle muscular system waterpower is significantly higher than AB types, Qinchuan Cattle Slaughter weight, carcass weight, the thickness of backfat, eye muscle area, is that waterpower size variation is BB>AA>AB.
The nucleotide sequence that described AA banding patterns are represented is as shown in SEQ ID No.3.
The mutational site for the nucleotide sequence that described BB banding patterns are represented is mutated for C → T, at First Exon 184bp.
Using the good effect of above-mentioned technical proposal：The present invention is detected by THRSP gene pairs Qinchuan Cattle Meat Qualities, so as to the Meat Tenderness of Qinchuan Cattle and be that waterpower makes a distinction, it is a kind of examination on DNA level and detection and the closely related molecular genetic marker of Qinchuan Cattle Meat Quality, for the assisted Selection and molecular breeding of Qinchuan Cattle, accelerate Qinchuan Cattle meat improved speed；This method is simple to operate, expense is low, accuracy is high, it can be used for quickly detecting, therefore, a great advantage is undoubtedly for cultivating meat ox, and significant economic benefit can be brought, vast potential for future development and profit margin will be brought for Chinese cattle-raising.
Brief description of the drawings
Fig. 1 is Qinchuan Cattle THRSP gene First Exon PCR amplification figures；
Fig. 2 is Qinchuan Cattle THRSP gene First Exon SSCP parting figures；
Fig. 3 is Qinchuan Cattle THRSP genetic mutation Sequencing chromatograms；
Fig. 4 is amino acid change collection of illustrative plates caused by Qinchuan Cattle THRSP genetic mutations.
Embodiment
The source of biomaterial used in the present invention：
1st, the primer is designed, designed and entrusts Shanghai Sheng Gong biotechnologies Co., Ltd to synthesize.
Technical scheme is described further with reference to embodiment, but be should not be construed as limiting the invention：
The present embodiment is used for the acquisition for illustrating Qinchuan Cattle Whole Blood Genomic DNA.
（1）Frozen blood specimen chamber temperature is melted, and about 3mL whole bloods are added in 7mL centrifuge tubes, isometric PBS is added, and is mixed 10min, 12000rpm centrifugation 5min, is abandoned supernatant, be repeated 2 times；
（2）2mL STE are added, 5-10min, 37 DEG C of water-bath 1h is mixed；
（3）Add Proteinase K（20mg/mL）To final concentration of 100 μ g/ μ L, fully mix；
（4）70 μ L SDS are added, are gently vibrated in 56 DEG C of water-baths, digestion is overnight to invisible sticky clot；
（5）Isometric Tris saturated phenols are added, lid is covered tightly, slowly overturns mixing at least 10min, 12000rpm, 4 DEG C of centrifugation 10min back and forth；
（6）Supernatant is transferred in a new sterile centrifugation tube, extracting is repeated once with Tris saturated phenols；
（7）Isometric phenol is added into supernatant again：Chloroform：Isoamyl alcohol (25:24:1) mixed liquor, slowly reverse centrifuge tube 10min, makes solution two-phase fully mix, 12000rpm, 4 DEG C of centrifugation 10min；
（8）Supernatant is shifted into another sterile centrifugation tube, isometric chloroform is added：Isoamyl alcohol（24:1）, ibid extract again once；
（9）The isopropanol (pH5.2) that 3mL is added into collected supernatant covers tightly lid, and horizontal shaken several times are it can be seen that cotton-shaped DNA precipitations；
（10）DNA precipitations are chosen, are placed in 1.5mL sterile centrifugation tubes, the ethanol washing DNA for adding 1mL75% is precipitated twice, 12000rpm, 4 DEG C of centrifugation 10min；
（11）Ethanol carefully is outwelled, centrifuge tube back-off is dried into 15min on paper handkerchief, being placed in 37 DEG C of incubators；
（12）Treat ethanol volatilization completely to the greatest extent, add 100-200 Μ l TE solution, 4 DEG C overnight with dissolving DNA.
The present embodiment is used to illustrate that PCR-SSCP is analyzed.
With reference to the sequence (accession number of the ox THRSP genes provided in GeneBank：No.AY656814), Primer5.0 software Design primers are utilized.Primer sequence is as follows：
THRSP-F：5’-3’：CGCCTCCGATCTCTACAACT（SEQ ID No.1）
THRSP-R：5’-3’：CCAGCTTCAGTCTCAGCTCC（SEQ ID No.2）
Qinchuan Cattle Whole Blood Genomic DNA will be obtained in embodiment 1, enter performing PCR using above-mentioned primer and react.Reaction condition is 95 DEG C, pre-degeneration 5min；95 DEG C, it is denatured 30sec, 56.5 DEG C, renaturation 30sec, 72 DEG C of extension 30sec, totally 35 circulations；72 DEG C of extension 10min.
After reaction terminates, PCR reaction solutions are taken（5μL）Enter row agarose gel electrophoresis, detect PCR primer.
The μ L of PCR primer 5 are taken, with 8 μ L sample-loading buffers（The deionized formamide of volume fraction 98%, mass concentration 0.025g/L bromophenol blue, mass concentration 0.025g/L dimethylbenzene cyanines, 10mmol/L EDTA（pH8.0））Mixing, 98 DEG C of denaturation 10min, takes out rapidly and inserts 5~10min of ice bath in mixture of ice and water, and it is electrophoresis, silver staining and colour developing in 20% polyacrylamide gel that volume fraction is then loaded onto respectively.After sscp analysis, the PCR primer of different banding pattern individuals is purified, Nanjing Genscript Biotechnology Co., Ltd.'s sequencing is delivered, sequencing result is compared with DNAMAN softwares.
PCR amplifications show unique band at 86bp（Fig. 1）；There are three kinds of banding patterns in SSCP results（Fig. 2）, SSCP difference banding patterns are classified, AA, AB and BB is respectively designated as.Then the individual for selecting different banding patterns send company to be sequenced, sequencing result be the nucleotide sequence of AA banding patterns as shown in SEQ ID No.3, BB banding patterns（Fig. 3）A variant sites are found with the sequence alignment that NCBI is submitted, positioned at being C → T mutation First Exon 184bp at, the mutation has triggered on THRSP gene First Exons the 51st amino acid generation missense mutation, by valine（GTG）→ alanine（GCG）（Fig. 4）, AB banding patterns are heterozygous.
Test example 1
Experimental animal comes from Shaanxi Province Qinchuan cattle stock breeding center, the 18-24 monthly ages being under identical feeding and management condition healthy ox, totally 405.To every bovine jugular vein blood sampling 10mL, ACD anti-freezings（ACD：Blood=1：6）, it is quick under low temperature to send laboratory back to and saved backup under the conditions of -80 DEG C.Randomly select 93 oxen altogether and carry out slaughter determining and meat measure.The character of measure includes：Slaughter weight, carcass weight, trunk length, the thickness of backfat, eye muscle area, it is waterpower, marbling, tenderness.
Experiment ox determine character includes：
a：Meat Tenderness analysis determines muscle shearing force using C-LM3 types digital display muscle tenderness instrument.
b：It is waterpower：State the water holding capacity of muscle or meat under given conditions.It is 5cm that one piece of 1cm thickness, area are removed with standard sampling container2Meat sample, be clipped in the middle of two layers of gauze, up and down the qualitative Medium speed filter paper of Ge Dian18Ceng Xinhua, then be sandwiched between two layers of duroplasts, being placed in soil allows to be forced into 35kg on expansion compressometer platform, and pressure keeps 5min, calculates percentage of water loss.
c：The evaluation of the indexs such as marbling, eye muscle area, the thickness of backfat, with reference to GB and pertinent texts.
Utilize the primer of the present invention（THRSP-F and THRSP-R）93 individual genomic DNAs of Qinchuan Cattle colony are entered with performing PCR amplification, obtained amplified fragments are located at the First Exon area for the primer amplification that THRSP-F and THRSP-R are represented, length is 86bp, through analyzing the noncoding region for the gene；After amplified fragments denaturation, the electrophoresis in 20% polyacrylamide gel, silver staining and colour developing.
Three kinds of banding patterns are analyzed with Qinchuan Cattle Meat Quality trait associations respectively.According to colony's feature, linear model is built as follows：Y ijkl=μ+Gi+Sj+Bpk+Mal+εijkl,
In formula, Yijkl：Character observation value, μ：Community average, Gi：Genotype fixed effect, Sj：Sex fixed effect, Bpk：Plant field group's fixed effect, Mal：Measure age effect, εijkl：Random error.
Using the GLM programs in statistical software SAS, the degree of correlation between genotype and character is examined using least square method, as a result as shown in table 1.
Table 1：THRSP gene polymorphics site and the association analysis of Qinchuan Cattle Meat Quality
Note：Different lowercase letter indication differences are notable in colleague（p<0.05).
Association analysis result is shown（Table 1）, the tenderness significant difference (P of AA types and AB types<0.05), AA types are significantly higher than AB types.BB types and AB types are waterpower significant difference (P<0.05), BB types are significantly higher than AB types.Slaughter weight, carcass weight, the thickness of backfat, eye muscle area size variation is：BB>AA>AB.Trunk is long, and marbling is AB>AA>BB, but all do not reach the level of signifiance.
To sum up, it can be seen that Qinchuan Cattle Meat Quality can be detected using THRSP genes, to the Meat Tenderness of Qinchuan Cattle and be that waterpower makes a distinction, this method is simple to operate, expense is low, accuracy is high, can be used for quickly detecting.
Claims (4)
1. a kind of indicate Qinchuan Cattle Meat Tenderness and the molecule labelling method for being waterpower with THRSP genes, it is characterised in that：This method comprises the following steps：
（1）The acquisition of Qinchuan Cattle Whole Blood Genomic DNA；
（2）Pair of primers THRSP-F and THRSP-R are designed according to ox THRSP gene orders, wherein：
THRSP-F：5’-3’：CGCCTCCGATCTCTACAACT（SEQ ID No.1）
THRSP-R：5’-3’：CCAGCTTCAGTCTCAGCTCC（SEQ ID No.2）
（3）Enter performing PCR amplification using this pair of primer pair Qinchuan Cattle Whole Blood Genomic DNA；
（4）The PCR primer of gained carries out SSCP banding pattern detections.
2. according to claim 1 indicate Qinchuan Cattle Meat Tenderness and the molecule labelling method for being waterpower with THRSP genes, it is characterised in that：Step（4）In SSCP banding patterns be divided into tri- kinds of AA, AB and BB, AA types indication Qinchuan Cattle Meat Tenderness is significantly higher than AB types, BB types indication Qinchuan Cattle muscular system waterpower is significantly higher than AB types, Qinchuan Cattle Slaughter weight, carcass weight, the thickness of backfat, eye muscle area, is that waterpower size variation is BB>AA>AB.
3. according to claim 2 indicate Qinchuan Cattle Meat Tenderness and the molecule labelling method for being waterpower with THRSP genes, it is characterised in that：The nucleotide sequence that described AA banding patterns are represented is as shown in SEQ ID No.3.
4. according to claim 2 indicate Qinchuan Cattle Meat Tenderness and the molecule labelling method for being waterpower with THRSP genes, it is characterised in that：The mutational site for the nucleotide sequence that described BB banding patterns are represented is mutated for C → T, at First Exon 184bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410014627.2A CN103740830A (en) | 2014-01-13 | 2014-01-13 | Molecular marking method for indicating Qinchuan cattle meat tenderness and water-holding capacity by utilizing THRSP (thyroid hormone responsive spot) genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410014627.2A CN103740830A (en) | 2014-01-13 | 2014-01-13 | Molecular marking method for indicating Qinchuan cattle meat tenderness and water-holding capacity by utilizing THRSP (thyroid hormone responsive spot) genes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103740830A true CN103740830A (en) | 2014-04-23 |
Family
ID=50497895
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410014627.2A Pending CN103740830A (en) | 2014-01-13 | 2014-01-13 | Molecular marking method for indicating Qinchuan cattle meat tenderness and water-holding capacity by utilizing THRSP (thyroid hormone responsive spot) genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103740830A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087582A (en) * | 2015-07-28 | 2015-11-25 | 南京农业大学 | Mutation site of UBXN1 [UBX (ultrabithorax) domain-containing protein 1] gene promoter region and application of mutation site to detecting water-holding capacity of pork |
| CN105349674A (en) * | 2015-11-30 | 2016-02-24 | 西北农林科技大学 | Detection method of CNV mark related to qinchuan cattlegrowth and application |
-
2014
- 2014-01-13 CN CN201410014627.2A patent/CN103740830A/en active Pending
Non-Patent Citations (1)
| Title |
|---|
| 张小白等: ""THRSP基因C184T突变与秦川牛肉质性状相关性的研究"，", 《中国农业科学》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087582A (en) * | 2015-07-28 | 2015-11-25 | 南京农业大学 | Mutation site of UBXN1 [UBX (ultrabithorax) domain-containing protein 1] gene promoter region and application of mutation site to detecting water-holding capacity of pork |
| CN105349674A (en) * | 2015-11-30 | 2016-02-24 | 西北农林科技大学 | Detection method of CNV mark related to qinchuan cattlegrowth and application |
| CN105349674B (en) * | 2015-11-30 | 2019-05-17 | 西北农林科技大学 | A kind of detection method and application growing relevant CNV label to Qinchuan Cattle |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102250889B (en) | SNP (Single Nucleotide Polymorphism) related to chick carcass trait and application thereof | |
| CN106434931B (en) | A kind of structure variation SV177 and its detection technique distinguishing Large White and place of china pig variety | |
| CN105296647B (en) | The detection kit of several species kind derived components in sheep derived material identification and its product | |
| CN103966209B (en) | The SNP marker relevant to pig intramuscular fat content proterties and application | |
| CN103451180B (en) | Molecular marker related to sedimentary character of pork fat, and application thereof | |
| De Vries et al. | The use of gene technology for optimal development of pork meat quality | |
| CN105063021B (en) | The SNP marker related to label of pig fat deposition description and its application | |
| CN113913538A (en) | SNP molecular marker related to chicken carcass traits and application | |
| CN111154762B (en) | lncRNA related to chicken fat metabolism, regulation target spot thereof and application thereof | |
| CN101899527B (en) | Molecular marking method of A-FABP gene predicted Qinchuan cattle meat quality | |
| CN104911273B (en) | A kind of chicken FABP1 gene molecule genetic marker related to the excellent production traits of chicken and its application | |
| CN104480212B (en) | The detection method in cattle PLIN2 gene mononucleotide polymorphism site and detection kit | |
| CN104131097B (en) | A kind of method detecting beef cattle UCP3 gene mononucleotide polymorphism and application thereof | |
| Amaral et al. | Combining genome-wide association analyses and gene interaction networks to reveal new genes associated with carcass traits, meat quality and fatty acid profiles in pigs | |
| CN108588235A (en) | Highly relevant genetic marker and its application with the velour yield and pile layer of Characteristics in Ziwuling black goat | |
| CN104593363A (en) | Excellent slaughter trait molecular genetic marker of broiler chicken and application of excellent slaughter trait molecular genetic marker | |
| CN103937791A (en) | Molecular marker related to rabbit important economic characters, and detection method and application thereof | |
| CN103740830A (en) | Molecular marking method for indicating Qinchuan cattle meat tenderness and water-holding capacity by utilizing THRSP (thyroid hormone responsive spot) genes | |
| CN114921568B (en) | SNP molecular marker related to Qinchuan cattle body ruler and meat quality traits and application thereof | |
| KR100774849B1 (en) | Development of molecular marker of fatty acid-binding proteinFABP gene associated with longissimus muscle area and backfat thickness in Korean cattle | |
| CN110643716A (en) | Molecular marker related to sheep tail fat weight and application thereof | |
| CN112176073B (en) | PROS1 gene molecular marker related to chicken carcass traits and application | |
| CN113528675A (en) | Molecular marker for identifying duck slaughter traits based on myostatin gene MSTN, and identification method and application thereof | |
| CN109055578B (en) | Method for auxiliary rapid detection of cattle growth traits through SNP (Single nucleotide polymorphism) marker of PLAG1 gene and application of method | |
| CN111961732A (en) | Molecular marker influencing full bore weight of chicken and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C05 | Deemed withdrawal (patent law before 1993) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140423 |