CN102140442A - Recombinant lentivirus as well as preparation method and application thereof - Google Patents
Recombinant lentivirus as well as preparation method and application thereof Download PDFInfo
- Publication number
- CN102140442A CN102140442A CN2010191640269A CN201019164026A CN102140442A CN 102140442 A CN102140442 A CN 102140442A CN 2010191640269 A CN2010191640269 A CN 2010191640269A CN 201019164026 A CN201019164026 A CN 201019164026A CN 102140442 A CN102140442 A CN 102140442A
- Authority
- CN
- China
- Prior art keywords
- htert
- slow virus
- plasmid
- gene
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to a recombinant lentivirus as well as a preparation method and application thereof. The recombinant lentivirus contains a human telomerase reverse transcriptase (hTERT) gene, a cPPT element and a WPRE (Post-Transcriptional Regulation Element) and is packaged and formed by a four-plasmid system which comprises a packaging plasmid pLP1, a packaging plasmid pLP2, a coated plasmid pLP/VSVG and a vector plasmid. The preparation method of the recombinant lentivirus comprises the following steps of: establishing a recombinant lentivirus expression vector of the human telomerase reverse transcriptase (hTERT) gene; and packaging the recombinant lentivirus with the human telomerase reverse transcriptase (hTERT) gene by adopting the four-plasmid system. The recombinant lentivirus can be applied to human cell immortalization. The invention provides the recombinant lentivirus with the human telomerase reverse transcriptase (hTERT) gene as well as the preparation method and application thereof. The provided recombinant lentivirus is more beneficial to integrating target genes into host cell chromosomes, thereby having a wider host range, and the recombinant lentivirus has a plurality of key built-in safety properties and plays an important role on realizing immortalization of various types of cells.
Description
Technical field
The present invention relates to a kind of recombinant slow virus and its production and application, recombinant slow virus of particularly a kind of carrier's reverse transcriptase of telomere hTERT gene and preparation method thereof and the application in people's cell immortalityization.
Background technology
Telomere (telomere) is positioned at end of chromosome, is by short double chain DNA sequence of series connection multiple and the conjugated protein complex body that forms.Telomere protection tinction body end makes it to be different from general fracture end of chromosome and not by various enzyme liberating, vital role is arranged aspect genomic integrity and the functional stabilization keeping.During cell fission, DNA information passes to daughter cell by duplicating, because end of chromosome can not be replicated, telomere length in the cell proliferation process can shorten gradually, when telomere becomes too short, dna fragmentation can wreck when duplicating, and stops cell to continue propagation.A lot of scientist's conjectures, it may be one of organism aged reason that telomere shortens.
Discover, a kind of special reverse transcriptase---the Telomerase in the cell, the defective that can repair dna replication dna makes the telomere can be because of cell fission loss to some extent, and then increases fissional number of times.Human telomerase is made up of RNA subunit and two protein protomers at least, that is: Telomerase associated protein 1 (Telomerase associated protein, TEP1) and the human telomerase reverse transcriptase (human telomerasereverse transcriptase, hTERT).The activity of Telomerase can realize that wherein hTERT acts on the most important as catalytic subunit by the RNA composition and/or the protein component of regulation and control Telomerase.The catalytic subunit of Telomerase is a template with the RNA subunit of Telomerase oneself, goes out telomeric dna by the continuous repeat replication of transposition, and latent the contracting of the end of compensation in the chromosome duplication process guarantees chromosomally to duplicate fully.Telomerase in the cell is active more, and the length of telomere just can be kept more.In hemopoietic stem cell, sexual cell and most of tumour cell, reverse transcriptase of telomere is high expression level; Do not express or low the expression and in normal human body cell, be.Generally believe at present, express reverse transcriptase of telomere, help to keep telomerase activation in the cell, can make the broad variety cell immortalityization.
The mammalian cell expression foreign gene can adopt the method for plasmid transfection or viral vector infection.Utilize plasmid transfection to obtain stable transgenic cell and need several weeks even some months time; Utilize then cells infected fast of virus expression systems, exogenous origin gene integrator is only needed several days time in virus vector, virus vector is again in the mode of virion, and the interaction by virus envelope protein and host cell membrane enters in the cell foreign gene.Virus vector commonly used has retroviral vector, adenovirus carrier and lentiviral vectors etc.Lentiviral vectors is compared with other expression vector, maximum advantage is to infect division and Unseparated Cell, be incorporated into foreign gene on the host cell chromosome effectively, thereby realize the persistence expression, can infect polytype cells such as stem cell, neuronal cell, myocardial cell, endotheliocyte, tumour cell.
Summary of the invention
The object of the present invention is to provide a kind of recombinant slow virus, its carrier's reverse transcriptase of telomere hTERT gene is as foreign gene.
Another purpose of the present invention is to provide a kind of preparation method of above-mentioned recombinant slow virus.
A further object of the present invention is above-mentioned recombinant slow virus is applied to people's cell immortalityization.
The invention provides a kind of recombinant slow virus, it contains human telomerase reverse transcriptase hTERT gene, cPPT element and WPRE element.
Wherein, described recombinant slow virus is formed by four pUC pUCs, these four kinds of plasmids comprise: packaging plasmid pLP1, packaging plasmid pLP2, coating plasmid pLP/VSVG and vector plasmid, described vector plasmid carry the hTERT gene and contain WPRE element and cPPT element at least.
Wherein, described vector plasmid also carries blasticidin screening-gene Blasticidin.
Wherein, described vector plasmid is generated via the LR reaction by cloning vector pENTR221-hTERT and slow virus expression vector pLenti6.3/V5-DEST.
The present invention also provides a kind of preparation method of above-mentioned recombinant slow virus, comprising:
The present invention also comprises above-mentioned recombinant slow virus is applied to can infect polytype cells such as stem cell, neuronal cell, myocardial cell, endotheliocyte, tumour cell in people's cell immortalityization.By making up the recombined lentivirus vector of carrier's reverse transcriptase of telomere hTERT gene, utilize the slow virus system to infect the purpose cell, with the hTERT gene integration to the purpose cell chromosome, strengthen the expression of reverse transcriptase of telomere in the cell, have vital role for the immortalization of realizing the broad variety cell.
The present invention adopts lambda particles phage site-specific recombination system that hTERT is gene constructed to the slow virus expression vector plasmid that contains cPPT and WPRE element; and with resultant recombinant plasmid called after pLenti6.3/V5-hTERT; with this transfer vector plasmid and virus packing plasmid mixture cotransfection human embryo kidney (HEK) 293FT cell; the collecting cell culture supernatant; concentrate through virus; pcr amplification detects; recombinant slow virus is finally successfully packed out the recombinant slow virus that carries the hTERT gene to the infection Performance Detection and the detection of expression of hTERT gene in the HeLa cell of HeLa cell in the 293FT cell.Recombinant slow virus provided by the invention is for realizing that the broad variety cell immortalityization has vital role.
Recombinant slow virus involved in the present invention is formed by four pUC pUCs, and these four kinds of plasmids comprise: pLP1, pLP2, pLP/VSVG and pLenti6.3/V5-hTERT.The pLP1 plasmid expression forms the necessary gag gene of slow virus structure and virus replication and the essential pol gene of integration; PLP2 plasmid expression Rev albumen, it can induce Gag/Pol to express with response element (PRE) acting in conjunction on the pLP1, and guides the nuclear transportation of viral RNA; PLP/VSVG expresses the scorching viral G glycoprotein (VSV-G) of bubble, makes host range wider; Carry the recombinant plasmid pLenti6.3/V5-hTERT of hTERT gene, contain WPRE, cPPT element and blasticidin screening-gene Blasticidin, Ψ packaging signal and PRSV/5 ' LTR and Δ U3/3 ' LTR are provided simultaneously, be convenient to the virus packing.These four plasmids must acting in conjunction, could produce the virion of infection ability.
Slow virus expression system involved in the present invention has the built-in security feature of a plurality of keys, comprising: provide the packaging function of HIV in trans mode, avoid unexpected reorganization; Package carrier in slow virus packing mixt (pLP1, pLP2, pLP/VSVG), do not contain LTR, so can not be packaged into virion; The virion that produces in the system is reproducible not, can only be used for loading goal gene, can not produce other virion; Lentiviral vectors is through modifying, and by from deactivation, can not produce the viral genome that can pack again when transfection with after integrating.
The constructed recombinant slow virus expression vector plasmid pLenti6.3/V5-hTERT of the present invention derives from slow virus expression vector pLenti6.3/V5-DEST, compare with the pLenti6/V5-DEST with similar functions, pLenti6.3/V5-DEST has increased by two new elements---WPRE and cPPT.WPRE can strengthen genetically modified expression from woodchuck hepatitis virus; CPPT can increase the copy number of slow virus in host genome from the HIV-1 integrase gene.These two element actings in conjunction can make the expressing quantity in the most cells increase by 4 times at least.Therefore, recombinant slow virus provided by the present invention more helps goal gene and is integrated into host cell chromosome.
To sum up, the invention provides recombinant slow virus of a kind of carrier's reverse transcriptase of telomere hTERT gene and its production and application, the recombinant slow virus that is provided more helps goal gene and is integrated into host cell chromosome, host range is wider, the built-in security feature that has a plurality of keys is for realizing that the broad variety cell immortalityization has vital role.
Description of drawings
Below in conjunction with accompanying drawing,, will make technical scheme of the present invention and other beneficial effects apparent by the specific embodiment of the present invention is described in detail.
In the accompanying drawing,
Figure 1 shows that pENTR221-hTERT cloning vector (available from Invitrogen company), it contains the hTERT gene;
Figure 2 shows that pLenti6.3/V5-DEST expression vector (available from Invitrogen company), it contains WPRE, cPPT element and blasticidin screening-gene Blasticidin;
Figure 3 shows that recombinant slow virus expression vector pLenti6.3/V5-hTERT building process figure;
Figure 4 shows that EcoR I and the BamH I single endonuclease digestion electrophorogram of plasmid pENTR221-hTERT and pLenti6.3/V5-hTERT;
Figure 5 shows that Pst I and the Apa I single endonuclease digestion electrophorogram of plasmid pENTR221-hTERT and pLenti6.3/V5-hTERT;
The hTERT gene PCR that Figure 6 shows that recombinant slow virus particle genomic dna is identified electrophorogram;
Fig. 7 is the microphotogram (100 *) of reorganization slow virus infection HeLa cell through the blasticidin screening;
Fig. 8 is that the hTERT gene detects electrophorogram at the RT-PCR of HeLa cell expressing.
Embodiment
In a preferred embodiment of the present invention, prepared the recombinant slow virus that contains human telomerase reverse transcriptase hTERT gene, cPPT element and WPRE element as follows.
One, the structure of human telomerase reverse transcriptase hTERT gene recombination slow virus expression vector
1, hTERT gene orientation is connected to slow virus expression vector plasmid
Buy cloning vector pENTR221-hTERT (plasmid map is seen Fig. 1) and the slow virus expression vector pLenti6.3/V5-DEST (plasmid map is seen Fig. 2) that contains the hTERT gene from Invitrogen company.Plasmid pENTR 221-hTERT carries attL1 and attL2 site, is positioned at hTERT gene order two ends; Plasmid pLenti6.3/V5-DEST carries attR1 and attR2 site, is positioned at necrocytosis controlling gene ccdB sequence two ends.Adopt the LR reaction, make attR1 and attL1 on attR2 sequence and the pENTR221-hTERT and attL2 sequence generation homologous recombination on the pLenti6.3/V5-DEST, necrocytosis controlling gene ccdB is replaced by goal gene hTERT, can obtain recombinant plasmid, and with its called after pLenti6.3/V5-hTERT.The structure schema of this plasmid as shown in Figure 3.Concrete implementation step is as follows:
In the 1.5ml centrifuge tube, add following composition: 1 μ l pENTR221-hTERT (360ng/ μ l) under the room temperature, 1 μ l pLenti6.3/V5-DEST (150ng/ μ l), 6 μ l TE buffer (pH 8.0), 2 μ l LRClonase II enzyme mix (available from Invitrogen company) mix with pipettor; Hatch 1～2h for 25 ℃; Add 1 μ l Proteinase K solution termination reaction then, instantaneous vortex is hatched sample 10min for 37 ℃.With the above-mentioned reaction mixture transformed into escherichia coli of 2～3 μ l Stbl3 cell (available from Invitrogen company), containing screening positive clone on the antibiotic LB solid medium of Amp.
2, the enzyme of recombinant plasmid is cut evaluation
Plasmid pENTR221-hTERT total length 5943bp, recombinant plasmid pLenti6.3/V5-hTERT total length 11131bp, two kinds of plasmids estimate that after different restriction enzyme effects the dna fragmentation that forms is as follows:
The EcoR I of plasmid pENTR221-hTERT and pLenti6.3/V5-hTERT and BamH I single endonuclease digestion electrophoresis result are seen Fig. 4, and among the figure, M is DNA Marker DL10000; 1 is that plasmid pENTR221-hTERT is through BamH I single endonuclease digestion; 2 is that plasmid pLenti6.3/V5-hTERT is through EcoR
I is single; 3 is that plasmid pLenti6.3/V5-hTERT is through BamH I single endonuclease digestion.Fig. 4 electrophoresis result shows that endonuclease bamhi is consistent with predicated value.The Pst I of plasmid pENTR221-hTERT and pLenti6.3/V5-hTERT and Apa I single endonuclease digestion electrophoresis result are seen Fig. 5, and among the figure, M is DNA Marker DL10000; 1 is that plasmid pENTR221-hTERT is through Pst I single endonuclease digestion; 2 is that plasmid pLenti6.3/V5-hTERT is through Pst I single endonuclease digestion; 3 is that plasmid pENTR221-hTERT is through Apa I single endonuclease digestion; 4 is that plasmid pLenti6.3/V5-hTERT is through Apa I single endonuclease digestion.Fig. 5 electrophoresis result shows that enzyme is cut a little less than the small segment brightness of formation, and big fragment is consistent with predicated value.Above result proves that hTERT gene orientation is connected to the slow virus expression vector, and recombinant plasmid pLenti6.3/V5-hTERT makes up correct.
Two, four pUC pUCs packing is carried the recombinant slow virus of hTERT gene
Slow virus packaging plasmid mixture pLP1, pLP2, pLP/VSVG, package cell line 293FT cell, plasmid transfection reagent Lipofectamine
TM2000 grades are available from Invitrogen company.Adopt the liposome transfection method, the slow virus expression plasmid pLenti6.3/V5-hTERT that carries the hTERT gene and packaging plasmid mixture pLP 1, pLP2 and pLP/VSVG cotransfection to the 293FT cell, are packed the recombinant slow virus that carries the hTERT gene.Concrete implementation step is as follows:
(1) adopts PureLink
TMHiPure Plasmid Midiprep Kit (available from Invitrogen company) extracts plasmid pLenti6.3/V5-hTERT, measures plasmid DNA content.
(2) transfection the day before yesterday, with the 293FT cell inoculation to 10cm Tissue Culture Plate (5 * 10
6Individual cell), put 37 ℃, 5%CO
2Incubator in spend the night.
(3) transfection same day, the 293FT cell reaches 90～95% degrees of fusion.Remove cell culture medium, be replaced by the Opti-MEM I substratum that the 5ml antibiotic-free contains serum.
(4) in the 5ml pipe of sterilization, the packaging plasmid mixture of 9 μ g and the pLenti6.3/V5-hTERT of 3 μ g are joined 1.5ml serum-free Opti-MEM I substratum, mixing gently.
(5) in the 5ml of another sterilization pipe, with 36 μ l Lipofectamine
TM2000 join 1.5ml serum-free Opti-MEM I substratum, mixing gently.Incubated at room 5min.
(6) hatch after, the dilution DNA mixture in the step (4) is added dilution Lipofectamine in the step (5)
TMIn 2000, mix gently.Incubated at room 20min is to form DNA-Lipofectamine
TM2000 mixtures.
(7) in containing the culture plate of 293FT cell, step (3) dropwise adds DNA-Lipofectamine
TM2000 mixtures, the cell mixing gently that rocks back and forth is put 37 ℃, 5%CO
2Incubator in incubated overnight.
(8) second days, remove the 293FT cell culture medium, be replaced by 10ml and do not contain antibiotic perfect medium.37 ℃, 5%CO
2Incubator incubated cell 48～72h.
(9) the 5th days, the substratum supernatant is transferred in the 15ml centrifuge tube, 4 ℃, the centrifugal 15min of 2000 * g, shard, it is standby to use Millex-HV 0.45 μ m PVDF filter to filter the substratum supernatant.
Three, the pcr amplification that reaches the hTERT gene that concentrates of recombinant slow virus is identified
1, recombinant slow virus concentrates
Use test kit PEG-it Virus Precipitation Solution (available from SBI company) to carry out slow virus and concentrate, concrete operations reference reagent box specification sheets slightly modified, step is as follows:
(1) 4 ℃ of precooling PEG-itVirus Precipitation Solution of 1 times of volume of adding in 4 times of filtered substratum supernatants of volume mix, and 4 ℃ of refrigerators are placed 2d.
(2) viral supernatant/PEG-it Virus Precipitation Solution mixture is in 4 ℃, the centrifugal 30min of 1500 * g.Supernatant is removed in suction, and the centrifugal 5min of 1500 * g absorbs all micro liquids.
(3) with the resuspended slow virus precipitation of the sterilization 1 * PBS of 4 ℃ of precoolings of 1/50 protovirus supernatant volume.
(4) branch is filled in the frozen pipe, and-70 ℃ of refrigerators are preserved standby.
2, the pcr amplification of recombinant slow virus hTERT gene is identified
Get and concentrate slow virus 10 μ l, boiling water bath 15min, ice bath 15min extracts virus genom DNA rapidly.Adopt the PCR method to identify in the recombinant slow virus whether contain goal gene hTERT.Pcr amplification product is a hTERT Gene Partial fragment, and length is 117bp, and the PCR primer sequence is as follows:
Primer1 (upstream primer): 5 '-GGTGGATGATTTCTTGTTGGTG-3 ' (SEQ IDNo.1)
Primer2 (downstream primer): 5 '-ACCACTGTCTTCCGCAAGTTC-3 ' (SEQ IDNo.2)
Contain in the 25 μ l PCR reaction systems: 12.5 μ l EmeraldAmp PCR Master Mix (available from TAKARA company), 0.5 μ l upstream and downstream primer mixture, 1.5 μ l slow virus DNA extraction liquid and 10.5 μ l ultrapure waters.The PCR reaction conditions is: 94 ℃ of pre-sex change 2min; 98 ℃ of sex change 10s, 55 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 30 circulations; 72 ℃ are extended 5min.The negative contrast of sterilized water, the positive contrast of plasmid pENTR221-hTERT are established in experiment.
Adopt 1.5% agarose gel electrophoresis to detect pcr amplification product, the results are shown in Figure 6, among the figure, M is DNA Marker DL500; 1 negative contrast is the amplified production of template with the sterilized water; 2 positive contrasts are the amplified production of template with plasmid pENTR221-hTERT; 3 for being the amplified production of template with recombinant virus particle extracting genome DNA liquid.As seen from Figure 6, negative control does not have amplified fragments, in positive control and the recombinant slow virus DNA extraction liquid amplified fragments is arranged all, and clip size is consistent with predicated value, illustrates to contain the hTERT gene DNA sequence in recombinant slow virus.
Four, recombinant slow virus is to the infection Performance Testing of HeLa cell
1, recombinant slow virus infects the HeLa cell, screening blasticidin resistant cell
Recombinant slow virus carry the blasticidin screening-gene (Blasticidin, BSD), can whether pair cell has the infection performance by BSD Screening and Identification recombinant slow virus.Concrete steps are as follows:
(1) infect the day before yesterday, with the trysinization of HeLa cell, counting is seeded to 6 orifice plates.37 ℃, 5%CO
2The incubator incubated overnight.
(2) infect the same day, cell grows to about 50% degrees of fusion.Take out the slow virus stock solutions from-70 ℃ of refrigerators, in 37 ℃ of water-baths, melt fast, with fresh perfect medium with 100 times of viral dilution.6 orifice plate cell culture mediums are removed in suction, are replaced by viral dilution liquid, contrast to not containing the perfect medium of virus.It is the Polybrene (available from Sigma company) of 6 μ g/ml that every hole adds final concentration.The light culture plate that changes mixes 37 ℃, 5%CO
2The incubator incubated overnight.
(3) infected second day, inhale the substratum that goes to contain virus, be replaced by fresh perfect medium.37 ℃, 5%CO
2The incubator incubated overnight.
(4) infected the 3rd day, inhale and remove substratum, be replaced by the perfect medium that contains 10 μ g/ml BSD, screening sense of stability transfect cell.
(5) per 4～5 days, change the fresh antibiotic substratum that contains.
(6) antibiotic-screening is after 10～12 days, the observation of cell upgrowth situation.Experimental result is seen Fig. 7, and (A) is that the HeLa cell was handled 5 days through blasticidin (BSD) among the figure, and the arrow indication is a dead cell; (B) handled 5 days through BSD for the HeLa cell that infects slow virus, the arrow indication is a viable cell; (C) be that the HeLa cell was handled 12 days through BSD, the arrow indication is a dead cell; (D) handled 12 days through BSD for the HeLa cell that infects slow virus, the arrow indication is the HeLa cell clone with BSD resistance.
As seen from Figure 7, do not infect the HeLa cell of recombinant slow virus, handled 5 days through BSD, and cell shrinkage death (Fig. 7-A); Handled 12 days through BSD, most of dead cell is removed (Fig. 7-C), illustrate that the HeLa cell that does not infect slow virus does not have the BSD resistance when changing substratum.Infect the HeLa cell of recombinant slow virus, handled 5 days through BSD, the viable cell (Fig. 7-B arrow indication) that has the BSD resistance on a small quantity appears in most of necrocytosis simultaneously; Handled 12 days through BSD, the viable cell with BSD resistance forms cell clone (Fig. 7-D arrow indication), illustrates that the Blasticidin resistant gene expresses in the HeLa cell, and the constructed recombinant slow virus that obtains of the present invention has the infection performance to the HeLa cell.
2, recombinant slow virus strengthens the RT-PCR detection of HeLa cell hTERT genetic expression
Recombinant slow virus also carries goal gene hTERT except carrying the Blasticidin gene, adopts the method for sxemiquantitative RT-PCR to detect the influence of recombinant slow virus to HeLa cell hTERT genetic expression.Concrete steps are as follows:
Utilize TRIzol reagent (available from Invitrogen company) to extract the HeLa cell total rna of HeLa cell and infection recombinant slow virus respectively, obtain cDNA, carry out pcr amplification as template through reverse transcription.With Primer1 and Primer2 is upstream and downstream primer amplification hTERT gene, and expanding fragment length is 117bp; With Primer3 and Primer4 is upstream and downstream primer amplification internal reference GAPDH gene, and expanding fragment length is 138bp.Because the amplified fragments size of hTERT gene and GAPDH gene is approaching, the PCR of these two kinds of genes is reflected in the different systems and carries out.The upstream and downstream primer of amplification GAPDH gene is as follows:
Primer3 (upstream primer): 5 '-GCACCGTCAAGGCTGAGAAC-3 ' (SEQ IDNo.3)
Primer4 (downstream primer): 5 '-TGGTGAAGACGCCAGTGGA-3 ' (SEQ IDNo.4)
Contain in the 20 μ l PCR reaction systems: 10 μ l EmeraldAmp PCR Master Mix (available from TAKARA company), 0.4 μ l upstream and downstream primer mixture, 1 μ l cDNA and 8.6 μ l ultrapure waters.The PCR reaction conditions is: 94 ℃ of pre-sex change 2min; 98 ℃ of sex change 10s, 55 ℃ of annealing 30s, 72 ℃ are extended 30s, totally 30 circulations; 72 ℃ are extended 5min.
Adopt 1.8% agarose gel electrophoresis to detect pcr amplification product, the results are shown in Figure 8, among the figure, M is DNAMarker DL2000; 1,2 for not infecting the amplified production of recombinant slow virus HeLa cell; 3,4 for infecting the amplified production of recombinant slow virus HeLa cell.As seen from Figure 8, the expression amount of hTERT gene in the HeLa cell that infects recombinant slow virus illustrates at the entrained hTERT gene of recombinant slow virus and can obtain high expression level in infected cell far above the control cells that does not infect recombinant slow virus.
Five, the recombinant slow virus of carrier's reverse transcriptase of telomere hTERT gene is applied to cell immortalityization
Retrieve the pertinent literature that hTERT gene in recent years is applied to cell immortalityization, as can be seen, the hTERT gene has been widely used in making up immortalized cell line.Studies show that the hTERT gene can the immortal human cell, comprising: kidney proximal tubule epithelial cell (Am J Physiol Renal Physiol, 2008,295:F1365-F1375), cord vessels endotheliocyte (Chinese cardiovascular diseases magazine, 2005,33:166-169), keratinocyte (PNAS, 2006,103:1792-1797), cell trophoblastic cell (Mol HumReprod, 2006,12:451-460), one-tenth dental cement progenitor cell (J Bone Miner Res, 2005,20:50-57), tooth enameloblast (Oral Oncol, 2009,45:e239-244), hair papilla cell (Chinese skin cypridology magazine, 2009,472-474), marrow stromal cell (Chinese microinvasion Neurological Surgery magazine, 2005,10:313-316), optimum meningioma cell (Lab Invest, 2005,85:1163-1171) etc.In addition, the hTERT gene also is used for other mammalian cell immortalization, as rhesus monkey bone marrow interstital stem cell (Transplant Proc, 2008,40:634-637), the ox capillary endothelium (J Cell Biochem, 2006,98:267-286) and pig cord vessels endotheliocyte (Mol Cells, 2007,24:358-363) etc.In conjunction with previous experiments result of the present invention, it will be appreciated by those skilled in the art that, the recombinant slow virus of the hTERT of carrying gene provided by the present invention comprises that for realizing the broad variety cell immortalityization of people's cell has vital role equally, the recombinant slow virus of carrier's reverse transcriptase of telomere hTERT gene of the present invention can be applied to comprise the immortalization of the broad variety cell of people's cell.
The above; for the person of ordinary skill of the art; can make other various corresponding changes and distortion according to technical scheme of the present invention and technical conceive, and all these changes and distortion all should belong to the protection domain of accompanying Claim of the present invention.
SEQUENCE?LISTING
＜110〉BeiJing University ShenZhen Hospital
＜120〉recombinant slow virus and its production and application
<130>PCN1100113
<160>4
<170>PatentIn?version?3.3
<210>1
<211>22
<212>DNA
＜213〉artificial sequence
<400>1
ggtggatgat?ttcttgttgg?tg 22
<210>2
<211>21
<212>DNA
＜213〉artificial sequence
<400>2
accactgtcttccgcaagtt?c 21
<210>3
<211>20
<212>DNA
＜213〉artificial sequence
<400>3
gcaccgtcaa?ggctgagaac 20
<210>4
<211>19
<212>DNA
＜213〉artificial sequence
<400>4
tggtgaagac?gccagtgga 19
Claims (6)
1. a recombinant slow virus is characterized in that containing human telomerase reverse transcriptase hTERT gene, cPPT element and WPRE element.
2. recombinant slow virus according to claim 1, it is characterized in that, described recombinant slow virus is formed by four pUC pUCs, these four kinds of plasmids comprise: packaging plasmid pLP1, packaging plasmid pLP2, coating plasmid pLP/VSVG and vector plasmid, described vector plasmid carry the hTERT gene and contain WPRE element and cPPT element at least.
3. recombinant slow virus according to claim 2 is characterized in that, described vector plasmid also carries blasticidin screening-gene Blasticidin.
4. recombinant slow virus according to claim 3 is characterized in that, described vector plasmid is generated via the LR reaction by cloning vector pENTR221-hTERT and slow virus expression vector pLenti6.3/V5-DEST.
5. the preparation method of recombinant slow virus as claimed in claim 1 is characterized in that, comprising:
Step 1, structure human telomerase reverse transcriptase hTERT gene recombination slow virus expression vector: hTERT gene orientation is connected to slow virus expression vector plasmid, thereby obtains recombinant plasmid pLenti6.3/V5-hTERT;
Step 2, employing four pUC pUCs packing are carried the recombinant slow virus of hTERT gene: adopt the liposome transfection method; to carry the slow virus expression plasmid pLenti6.3/V5-hTERT of hTERT gene and packaging plasmid mixture pLP1, pLP2 and pLP/VSVG cotransfection to the 293FT cell, packing is carried the recombinant slow virus of hTERT gene.
6. the application of recombinant slow virus as claimed in claim 1 in people's cell immortalityization.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010191640269A CN102140442A (en) | 2010-02-01 | 2010-02-01 | Recombinant lentivirus as well as preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010191640269A CN102140442A (en) | 2010-02-01 | 2010-02-01 | Recombinant lentivirus as well as preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102140442A true CN102140442A (en) | 2011-08-03 |
Family
ID=44408239
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010191640269A Pending CN102140442A (en) | 2010-02-01 | 2010-02-01 | Recombinant lentivirus as well as preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102140442A (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103290056A (en) * | 2012-02-27 | 2013-09-11 | 上海诺百生物科技有限公司 | Lentivirus vector, preparation and application of and virus particle thereof |
| CN103952443A (en) * | 2013-05-20 | 2014-07-30 | 中国人民解放军军事医学科学院基础医学研究所 | Tumor-treatment adenovirus vaccine taking hTERT (human telomerase reverse transcriptase) as target point |
| CN107190024A (en) * | 2017-06-07 | 2017-09-22 | 辽宁大学 | A kind of construction method of stable expression NS1 albuminous cells strain |
| CN107937442A (en) * | 2017-11-13 | 2018-04-20 | 北京多赢时代科技有限公司 | A kind of immortal human fat mesenchymal stem cell system and its method for building up |
| CN108611326A (en) * | 2018-04-24 | 2018-10-02 | 高山 | A kind of efficient lentivirus production system and its production method |
| CN109295103A (en) * | 2018-10-30 | 2019-02-01 | 湖南丰晖生物科技有限公司 | A kind of slow virus carrier and its application in building immortalized cells |
| CN109477119A (en) * | 2016-02-04 | 2019-03-15 | 斯比根公司 | Express the mescenchymal stem cell and application thereof of hepatocyte growth factor |
| CN110699381A (en) * | 2019-09-17 | 2020-01-17 | 合肥瑞灵生物科技有限公司 | Mediterranean anemia gene therapy vector construction method and application thereof |
| CN114807236A (en) * | 2022-04-20 | 2022-07-29 | 北京艺妙神州医药科技有限公司 | Virus shuttle plasmid and application thereof |
-
2010
- 2010-02-01 CN CN2010191640269A patent/CN102140442A/en active Pending
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103290056A (en) * | 2012-02-27 | 2013-09-11 | 上海诺百生物科技有限公司 | Lentivirus vector, preparation and application of and virus particle thereof |
| CN103952443A (en) * | 2013-05-20 | 2014-07-30 | 中国人民解放军军事医学科学院基础医学研究所 | Tumor-treatment adenovirus vaccine taking hTERT (human telomerase reverse transcriptase) as target point |
| CN109477119A (en) * | 2016-02-04 | 2019-03-15 | 斯比根公司 | Express the mescenchymal stem cell and application thereof of hepatocyte growth factor |
| CN107190024A (en) * | 2017-06-07 | 2017-09-22 | 辽宁大学 | A kind of construction method of stable expression NS1 albuminous cells strain |
| CN107937442A (en) * | 2017-11-13 | 2018-04-20 | 北京多赢时代科技有限公司 | A kind of immortal human fat mesenchymal stem cell system and its method for building up |
| CN108611326A (en) * | 2018-04-24 | 2018-10-02 | 高山 | A kind of efficient lentivirus production system and its production method |
| CN108611326B (en) * | 2018-04-24 | 2019-07-19 | 高山 | A kind of efficient lentivirus production system and its production method |
| CN109295103A (en) * | 2018-10-30 | 2019-02-01 | 湖南丰晖生物科技有限公司 | A kind of slow virus carrier and its application in building immortalized cells |
| CN110699381A (en) * | 2019-09-17 | 2020-01-17 | 合肥瑞灵生物科技有限公司 | Mediterranean anemia gene therapy vector construction method and application thereof |
| CN114807236A (en) * | 2022-04-20 | 2022-07-29 | 北京艺妙神州医药科技有限公司 | Virus shuttle plasmid and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102140442A (en) | Recombinant lentivirus as well as preparation method and application thereof | |
| WO2016197360A1 (en) | Method for specific knockout of swine gfra1 gene using crispr-cas9 specificity, and sgrna used for specifically targeting gfra1 gene | |
| US11920147B2 (en) | Genomic RNA packaging enhancer element | |
| Rethwilm | Foamy virus vectors: an awaited alternative to gammaretro-and lentiviral vectors | |
| CN104480144A (en) | CRISPR/Cas9 recombinant lentiviral vector for human immunodeficiency virus gene therapy and lentivirus of CRISPR/Cas9 recombinant lentiviral vector | |
| CN112410376B (en) | Construction method of functional exosome for efficiently loading specific miRNA | |
| McLaren et al. | Modulating HIV-1 RNA processing and utilization | |
| Knoepfel et al. | Selection of RNAi-based inhibitors for anti-HIV gene therapy | |
| CN101302537B (en) | Site-specific integration retroviral vector system and preparation thereof | |
| RU2426788C1 (en) | Genetic make-ups for anti-hiv therapy | |
| CN109022436A (en) | The special shRNA construction of recombinant vector for inhibiting 3 β-HSD gene expressions and application | |
| CN102206645A (en) | Mediating method of RNAi (ribonucleic acid interference) utilizing lentiviral vector | |
| CN104762322A (en) | Retrovirus gene transfer system for prawn cell | |
| Li et al. | Expression of YB-1 enhances production of murine leukemia virus vectors by stabilizing genomic viral RNA | |
| CN102352360B (en) | Construction and function test of double-long-hairpin RNA (Ribonucleic Acid) expression element for inhibiting HIV-1 (Human Immunodeficiency Virus-1) | |
| CN108373997B (en) | pMKRN1 gene knockout pig somatic cell and preparation method and application thereof | |
| CN112063620A (en) | shRNA for inhibiting expression of porcine epidemic diarrhea virus M gene | |
| CN102643860A (en) | Recombinant lentiviral vector aiming at hUHRF1 gene RNA (Ribonucleic Acid) interference and preparation thereof | |
| CN113717990B (en) | Novel vesicular stomatitis pseudovirus system based on double reporter genes and application thereof | |
| Al Abbar et al. | Production of lentiviral vector with polycistronic transcripts for reprogramming of mouse fibroblast cells | |
| EP1582591A2 (en) | Sirna and their use for knock down expression of porcine endogenous retrovirus | |
| CN108611326A (en) | A kind of efficient lentivirus production system and its production method | |
| CN102643859A (en) | Recombinant lentiviral vector aiming at hNINL gene RNA (Ribonucleic Acid) interference and preparation thereof | |
| US20220193266A1 (en) | A novel chromatin-opening element for stable long term gene expression | |
| NL2030366B1 (en) | Construction method of functional exosome for efficiently loading specific mirnas |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20110803 |