CN102206645A

CN102206645A - Mediating method of RNAi (ribonucleic acid interference) utilizing lentiviral vector

Info

Publication number: CN102206645A
Application number: CN 201110110644
Authority: CN
Inventors: 胡康洪; 王薇薇; 彭洪泉
Original assignee: Wuhan Institute of Virology of CAS
Current assignee: Chengdu Luo Kang Biotechnology Co ltd
Priority date: 2011-04-29
Filing date: 2011-04-29
Publication date: 2011-10-05
Anticipated expiration: 2031-04-29
Also published as: CN102206645B

Abstract

The present invention relates to a mediating method of RNAi (ribonucleic acid interference) utilizing a lentiviral vector. The method comprises the following specific steps of: firstly carrying out homology analysis on the nucleic acid sequence of relevant viruses to find out conserved regions and designing siRNA (small interfering ribonucleic acid) corresponding to the conserved regions of the related viruses; and cloning the siRNA to an expression plasmid pLVTH, then co-transfecting 293T cells together with pCMV-dR8.91 and pMD2.G, collecting the supernatant of the transfected cells, carrying out ultracentrifugation, purification and concentration to obtain a high-titer lentiviral vector expressing the siRNA, then carrying out cotransduction into target cells together with LV-tTR-KRAB, and strictly controlling the acting time and dose of siRNA drugs utilizing tetracycline analogue DOX. Because of high transduction rate and a stringent control system, the mediating method can actually evaluate the in-vivo antiviral action of the siRNA and can track the whole process of drug interference action, thus having clinical application prospects.

Description

Utilize the method for lentiviral vectors mediate rna i

Technical field

The present invention relates to information biology and Molecular Virology technical field, be specifically related to a kind of RNAi that mediates based on the lentiviral vectors of doxycycline control and study antiviral method.

Background technology

A lot of in the world in recent years laboratories utilize the antiviral research of siRNA interference carrying out, and mutual contradiction of a lot of results or interference effect are not obvious.Crucial problem is that their employed working model mostly only limits to use cells transfected system.Because transfection efficiency is extremely limited, is difficult to the siRNA antiviral effect that enters in the born of the same parents is really estimated.Afterwards, RNAi usually utilized virus vector to express siRNA, wherein commonly retroviral vector and adenovirus carrier.But retrovirus only infects the division stage cell, and the dna fragmentation that holds foreign gene is no more than 8kb; During the adenovirus carrier cells infected, viral DNA is free in the nucleus, can not be incorporated in the host chromosome, can not realize stable long-term expression in vivo, and application causes immune response easily repeatedly, more and more is subject to people's attention so derive from the lentiviral vectors (Lentiviral vector) of human immunodeficiency virus-1 (HIV-1).

Lentiviral vectors both can infect somatoblast, also can infect Unseparated Cell such as neurocyte, liver cell, hemopoietic stem cell and muscle cell etc., the exogenous genetic fragment that shifts is big, host range is very wide, and reduced the chance of reorganization, most important character is that it can be incorporated in host's the genome, thus expression alien gene that can high-efficient and lasting, thereby become the carrier that the eukaryotic gene widely paid close attention to shifts.Modified lentiviral vectors later can be realized induction regulating controlling in eukaryotic cell, such as adding a multiple trip switch on lentiviral vectors, just can realize controlled expression to foreign gene by tsiklomitsin or tetracycline analogue.

The structure of lentiviral vectors is very simple, and principle is exactly that the cis-acting elements in the HIV-1 genome (as packaging signal, long terminal repeat) is separated with the proteic sequence of coding trans-acting.Make up slow virus at present two plasmid expression systems, three plasmid expression systems and four plasmid expression systems are arranged.The most frequently used is three plasmid expression systems (packaging plasmid, envelope protein plasmid and transferring plasmids): packaging plasmid is used for expressing HIV-1 and duplicates required whole trans-activators, but does not produce the envelope protein and the accessory protein vpu of virus; The plasmid-encoded vesicular stomatitis virus G of envelope protein albumen (VSV-G); Contain the H1 promotor in the transferring plasmid, can be in host cell the continuous expression foreign gene, express green fluorescent protein (GFP) simultaneously, the detection of the efficiency of infection of transfection efficiency and infection purpose cell when being used for the virus packing by EF1 (Elongation Factor1) promoters driven.The sharpest edges of three plasmid expression systems are that sequence eclipsed chance is reduced greatly, thereby have reduced the possibility that produces RCV in the carrier regrouping process.

The slow virus carrier system that has multiple trip switch can make transfection efficiency increase substantially more than 90%.For this reason, we will utilize this system deeply to estimate the antiviral effect of siRNA.Because high transfection efficiency will make the antiviral effect of medicine obtain more real evaluation, also more likely be used for intravital special target medicine in the future and discharge.In addition, the tsiklomitsin switch that this system had can not only make the interference effect of investigator's probe siRNA medicine, and can follow the trail of the process of drug intervention by on-off control, may for exploring that pharmacokinetics, metabolism and toxicology provides.Therefore, set up this system and will provide a very practical tool for antiviral research.

Summary of the invention

Technical problem to be solved by this invention is: the RNAi technology of the lentiviral vectors mediation of utilization doxycycline control, provide a kind of siRNA of utilization to study antiviral method, so that the interference effect to the siRNA medicine is carried out detailed assessment, and follow the trail of pharmaceutically-active whole process by on-off control, for the research of antiviral is made contributions.

The present invention solves its technical problem and adopts following technical scheme:

The present invention is to provide the method for a kind of lentiviral vectors mediate rna i based on doxycycline control, specifically: at first, the biological software that utilization is correlated with is carried out homology analysis to the nucleotide sequence of correlated virus, finds out conservative region, designs the siRNA at the correlated virus conservative region; Again synthetic siRNA is cloned among the expression plasmid pLVTH, then with in this expression plasmid and the common transfection 293T of pCMV-dR8.91, the pMD2.G cell, cell conditioned medium after the collection transfection, formed the lentiviral vectors of expressing the high titre of siRNA through ultracentrifugation, purifying, after concentrating, to express the lentiviral vectors LV-tTR-KRAB corotation importing target cell of lentiviral vectors with the control tsiklomitsin switch of siRNA at last, and utilize tetracycline analogue DOX to come strict control pharmaceutically-active time of siRNA and dosage.

The present invention can adopt the method that may further comprise the steps:

(1) screening siRNAs:

Elder generation is according to the gene order U95551 of HBV among the GeneBank, principle with reference to the siRNA design, selecting the length of gene coding region AA beginning at shRNA design website http://rnadesigner.classic.invitrogen.com/rnaiexpress/index.jsp is 21nt, the GC% conservative nucleotide sequence between 45%-55%, avoid the non-coding region of 5 ' and 3 ' end, again the sequence of selecting is carried out the analysis of BLAST homology, avoid having the homologous interference sequence with the people's gene group.

(2) to the evaluation of the siRNAs that filters out:

Different siRNAs is building up among the carrier for expression of eukaryon pSuper, and whether these several siRNAs are influential to virus for preliminary assessment, and its method is: utilize Lipofectamine2000 ^TM(available from American I nvitrogen company) advances the pSuper-shRNA transfection in the cell, and cell conditioned medium and cell after the collection transfection utilize Protocols in Molecular Biology to detect the variation of corresponding viral index;

(3) lentiviral vectors of construction expression shRNA:

Respectively these several shRNAs are cloned among the lentivirus transfer plasmid pLVTH, then with the transferring plasmid pLVTH-HBV-shRNA and the packaging plasmid pCMV-dr8.91 that build, coating plasmid pMD2.G is according to every 60mm Tissue Culture Dish 15 μ g: 10 μ g: it is in about 80% the 293T cell that the ratio of 5 μ g advances to converge rate with calcium phosphate transfection test kit (available from green skies company) cotransfection, collect the cell conditioned medium of transduction back 48h, the centrifugal 5-10min of 2500rpm, supernatant is removed cell debris with 0.45 μ m membrane filtration, the centrifugal 2hours of 24500rpm then, supernatant discarded is used the resuspended virus of Opti-MEM (available from U.S. Gibco company) at last;

(4) titre of survey lentiviral vectors:

According to 10 times of gradient dilutions, each that adds 96 orifice plates then respectively is aerial, cultivates to incubator with resuspended virus; After the overnight incubation, renew bright cell culture fluid and continue to cultivate; Observe fluorescence behind the 48h, number goes out the number of cell in the hole that fluorocyte accounts for 9-11%; Calculate virus titer according to following formula again:

Tilter (/ml)=10%GFP ⁺Cells * total cell count * viral dilution multiple,

(5) estimate the influence of the RNAi of the lentiviral vectors mediation that makes up to virus:

With the lentiviral vectors that builds according to the titre of the MOI=10 into target cell of transduceing, transduction can add the Polybrene (available from U.S. Sigma company) of 6 μ g/mL simultaneously to improve transduction efficiency, then detailed assessment transduction back different time viral replication in and changes of expression level;

(6) the RNAi system of the lentiviral vectors mediation of structure doxycycline control:

Expression plasmid and slow virus packaging plasmid pCMV-dr8.91, the coating plasmid pMD2.G cotransduction of expressing tsiklomitsin arrestin tTR-KRAB are advanced in the 293T cell, the centrifugal 5-10min of cell conditioned medium 2500rpm behind the collection 48h, with supernatant with 0.45 μ m membrane filtration, the centrifugal 2hours of 24500rpm then, supernatant discarded, use the resuspended virus of Opti-MEM at last, make the titre of virus reach consistent with the titre of the lentiviral vectors of expressing shRNA;

(7) observe the influence of the RNAi of DOX inductive lentiviral vectors mediation to virus replication and expression: the slow virus that will express shRNA advances in the target cell with the slow virus linked transduction of expressing tsiklomitsin modulin tTR-KRAB, cell was divided into 2 groups in second day, one group adds DOX and handles, another group does not add DOX and handles, collect this two groups of cells after 4 days respectively, the nucleocapsid of the intracellular HBV of extracting, half directly is used for being Western blotting, and purpose is to detect the variation of HBV core protein expression level; Second half comes out the HBV DNA extracting and purifying in the nucleocapsid, uses P ³²The probe of mark is Southern blotting and is detected, and its objective is the situation of duplicating of observing HBV in the born of the same parents.

The present invention can adopt following method screening siRNAs:

Elder generation is according to the gene order U95551 of HBV among the GeneBank, principle with reference to the siRNA design, selecting the length of gene coding region AA beginning at shRNA design website http://rnadesigner.classic.invitrogen.com/rnaiexpress/index.jsp is 21nt, the GC% conservative nucleotide sequence between 45%-55%, avoid the non-coding region of 5 ' and 3 ' end, again the sequence of selecting is carried out the analysis of BLAST homology, avoid having the homologous interference sequence with the people's gene group; According to the requirement of pSuper carrier, the two ends of design 60-64nt comprise respectively designs an irrelevant interference sequence simultaneously as negative control by the oligonucleotide chain of the restriction enzyme site of Bgl II and Hind III then.

The described method of utilizing Protocols in Molecular Biology to detect the variation of corresponding viral index is: utilize the Protocols in Molecular Biology comprise ELISA, real-time PCR, RT-PCR, Western blotting, Southern blotting to detect in the copy number, born of the same parents of the HBsAg of virus and HBeAg, supernatant HBV the variation of hbv replication level in the variation of HBV core protein expression level in HBV mRNA expression, the born of the same parents and the born of the same parents respectively.

Described method with the resuspended virus of Opti-MEM is: lentiviral vectors is with after the 24500rpm ultracentrifugation 2hours, the resuspended virus of Opti-MEM with the ice of 100 μ l, the advantage that adopts Opti-MEM is the condition in the time of can optimizing the virus vector transduction, improves the level of virus transduction.In with the resuspended virus of Opti-MEM, virus be placed on ice 2hours at least, and operation gently, can not produce bubble.

The present invention can adopt following method detailed assessment virus replication and expression levels:

Lentiviral vectors is transduceed into behind the target cell, at following different time point: and collecting cell supernatant when 24h, 48h, 72h, 96h and 1week, and then collect cell behind the 1week, be used to detect the variation of different viral indexs.The variation of the HBsAg of HBV and HBeAg level is to detect with section's China ELISA test kit in the cell conditioned medium; The variation of viral copy number is to utilize real-time PCR to detect in the supernatant, and wherein the extracting of supernatant HBV DNA is extracted the operation of test kit operation instructions according to TIANGEN virus genom DNA/RNA, analyzes in Aligent Technology software at last; The variation of born of the same parents' inner virus rna level is to adopt real-time fluorescent RT-PCR method for detecting (with cell house-keeping gene β-actin as internal control gene), analyzes in Aligent Technology software then; And the variation of the levels of replication of born of the same parents' inner virus is to utilize P ³²The Southern blotting of mark detects the content of HBVDNA in the intracellular nucleic capsid; The proteic changes of expression level of born of the same parents' inner virus is to utilize Western blotting to detect in the born of the same parents the proteic content of core in the nucleocapsid, and with GAPDH content in the born of the same parents as confidential reference items.

The present invention can adopt following method to observe virus replication and changes of expression level under the situation that DOX adds or DOX does not add: the slow virus that will express shRNA advances target cell with the slow virus linked transduction of expressing tsiklomitsin modulin tTR-KRAB, cell was divided into 2 groups in second day, one group adds DOX and handles, another group does not add DOX and handles, collect this two groups of cells after 4 days respectively, the nucleocapsid of the intracellular HBV of extracting, half directly is used for being Western blotting, and purpose is to detect the variation of HBV core protein expression level; Second half comes out the HBV DNA extracting and purifying in the nucleocapsid, uses P ³²The probe of mark is Southern blotting and is detected, and its objective is the situation of duplicating of observing HBV in the born of the same parents.

The present invention has following major technology advantage and effect:

One. utilize bioinformatics technique to design three couples of siRNAs at the hepatitis B viruses (HBV) conserved regions, be respectively DR1 district (1826nt-1845nt), CP district (1775nt-1795nt) and RT district (672nt-692nt) of HBV, siRNAs is building up to respectively in the lentiviral vectors with synthetic good this is several, transduction is advanced among the hepatoma cell line HepG2.2.15.The variation of HBsAg, HBeAg and HBV virus copy number in the cell conditioned medium when detecting transduction back 24h, 48h, 72h, 96h, 1week then, and the intracellular virus situation of duplicating and expressing.Discovery based on the RNAi of doxycycline control lentiviral vectors mediation down not only strongly inhibited hbv replication and expression, and this restraining effect is that the strictness that is subjected to doxycycline is controlled.This provides very important using value for antiviral therapy.

They are two years old. the RNAi technology that the lentiviral vectors that utilizes a kind of novel doxycycline to control mediates, set up a kind of antiviral novel method.Because this carrier has efficiently, safety, high degree of specificity, can effectively control duplicating and expression of virus, thereby for the control virus infection and treat virus disease and make contributions.

They are three years old. and in view of the siRNA expression vector of present use such as carrier for expression of eukaryon or adenovirus carrier have separately defective, based on above-mentioned effectiveness, the present invention also has following advantage and effect:

Utilize the RNAi of doxycycline control lentiviral vectors mediation at first to solve the low difficult problem of siRNA transfer efficiency, utilize the lentiviral vectors into various cells of siRNA can being transduceed efficiently, comprise somatoblast and Unseparated Cell; Secondly lentiviral vectors can be incorporated in the genome of target cell, has realized the continuous expression to siRNA, and the RNAi that the present invention detects the lentiviral vectors mediation can keep the time in 1 week to the strong restraining effect of HBV; The most important thing is the present invention show add DOX after, the RNAi of lentiviral vectors mediation is the strongly inhibited hbv replication not only, and pair cell do not cause damage, and in case remove DOX, this interference effect disappears immediately.This shows that this interference effect is that the strictness that is subjected to doxycycline is controlled, this has more security than other carriers, the cellulotoxic side effect of having avoided continuous expression external source siRNA and may having caused, simultaneously can pharmaceutically-active time of strict control siRNA and dosage by the DOX switch, more help the research of pharmacokinetics; And the lentiviral vectors that utilizes three plasmid expression systems (expression plasmid, coating plasmid, transferring plasmid) to make up, to compare with other virus vector, its structure is more simple and convenient, more can not produce recombinant virus.Therefore, this invention has safety, efficient, characteristics such as cost is low, is suitable for very much antiviral treatment research.This also provides more wide prospect for developing the antiviral therapy more efficient methods.

Description of drawings

Fig. 1 be in the RNAi pair cell supernatant of slow virus mediation the HBsAg secretion level influence synoptic diagram.

Fig. 2 be in the RNAi pair cell supernatant of slow virus mediation the HBeAg secretion level influence synoptic diagram.

Fig. 3 be in the RNAi pair cell of slow virus mediation HBV mRNA level influence synoptic diagram.

Fig. 4 is the regulating effect synoptic diagram of the RNAi of DOX inductive slow virus mediation to the HBVCore protein expression.

Fig. 5 is the regulating effect synoptic diagram of the RNAi of DOX inductive slow virus mediation to hbv replication.

Fig. 6 is the packing synoptic diagram of DOX inductive lentiviral vectors.

Embodiment

The invention will be further described below in conjunction with example and accompanying drawing:

The method of utilizing the slow virus carrier system mediate rna i of doxycycline control provided by the invention may further comprise the steps:

1. utilize information biology to filter out siRNAs at the different conserved regions of HBV, elder generation is according to the gene order U95551 of HBV among the GeneBank, principle with reference to the siRNA design, selecting the length of gene coding region AA beginning at shRNA design website http://rnadesigner.classic.invitrogen.com/rnaiexpress/index.jsp is 21nt, the GC% conservative nucleotide sequence between 45%-55%, avoid the non-coding region of 5 ' and 3 ' end, again the sequence of selecting is carried out the analysis of BLAST homology, avoid having the homologous interference sequence with the people's gene group; Then according to the requirement of pSuper carrier, the two ends of design 60-64nt comprise the oligonucleotide chain of the restriction enzyme site of Bgl II and Hind III (available from Takara company) respectively, design an irrelevant interference sequence simultaneously as negative control, its process sees Table 1, the synthetic then interference sequence that designs.(Invitrogen company is synthetic)

2. different siRNAs is building up among the carrier for expression of eukaryon pSuper, whether this several influential to HBV to siRNAs for preliminary assessment: carry the day before yesterday with hepatoma cell line HepG2.2.15 cell that can continuous expression HBV according to 5 * 10 ⁵The density in/hole is inoculated in 6 orifice plates, and the cytogamy degree will reach 80-90% during transfection.Utilized Lipofectamine2000 in second day ^TMWith pSuper-shRNA (according to plasmid: Lipofectamine2000 ^TM=4 μ g: the ratio of 10 μ l) transfection is advanced in the HepG2.2.15 cell, renewing the bright cell culture fluid that contains 10%FBS after 6 hours continues to cultivate, collect the cell conditioned medium and the cell of different time points after the transfection then, ELISA (the ELISA test kit is available from Shanghai Xiamen Kehua), RT-PCR and real-time PCR (relevant primer is synthetic by Invitrogen company) detect the variation of HBsAg and HBeAg, HBV mRNA and HBV copy number respectively.The result shows that all there is certain restraining effect in this several interference site to hbv replication and expression.

3. the lentiviral vectors of construction expression shRNA: respectively these several shRNAs are cloned among the lentivirus transfer plasmid pLVTH, then with the transferring plasmid pLVTH-HBV-shRNA and the packaging plasmid pCMV-dr8.91 that build, coating plasmid pMD2.G is according to every 60mm Tissue Culture Dish 15 μ g: 10 μ g: the ratio of 5 μ g is advanced in the 293T cell with calcium phosphate transfection test kit (available from green skies company) cotransfection, collect the cell conditioned medium of transduction back 48h, the centrifugal 5-10min of 2500rpm, with supernatant with 0.45 μ m membrane filtration, use ultracentrifuge (Beckman company) at 24500rpm then, 4 ℃ of ultracentrifugation 2hours, careful supernatant discarded, ice bath at least 2 hours uses Opti-MEM resuspended and packing is viral at last.

4. survey the titre of lentiviral vectors: measure the day before yesterday with the HepG2.2.15 cell with 5 * 10 ⁴The density in/hole is inoculated in 96 orifice plates.Prepare 6-9 aseptic EP pipe, add the fresh medium of 90 μ l.Virus stock solution used to be determined 10 μ l are added in first EP pipe, and mixing is got 10 μ l and is joined in second EP pipe, by that analogy until last pipe.With the original cell culture fluid of sucking-off in the selected cell hole, the viral liquid that dilution is good adds respectively in each hole, as for cultivating in the incubator.After the overnight incubation, renew bright cell culture fluid 100 μ l, continue to cultivate.Observe fluorescence behind the 48h.Number goes out the number that fluorocyte accounts for cell in the hole about 10%.Calculate virus titer according to following formula:

Tilter (/ml)=%GFP ⁺Cells * total cell count * viral dilution multiple.

5. the RNAi of the lentiviral vectors mediation that estimate to make up is to the influence of hbv replication and expression: carry the day before yesterday with the HepG2.2.15 cell with 5 * 10 ⁵The density in/hole is inoculated in 6 orifice plates, second day with in the titre transduction HepG2.2.15 cell of lentiviral vectors according to MOI=10 that builds, transduction can add the Polybrene (available from U.S. Sigma company) of 6 μ g/mL simultaneously to improve transduction efficiency, after virus is hatched 12h, renewing the bright nutrient solution that contains 10%FBS continues to cultivate, collect the cell conditioned medium of transduction back different time points then, last collecting cell utilizes ELISA, RT-PCR, real-time PCR, Western blotting and Southern blotting detect HBsAg and the HBeAg of HBV respectively, HBV mRNA, viral loads, the situation of HBV core albumen and hbv replication.

6. make up the RNAi system of the lentiviral vectors mediation of doxycycline control: the expression plasmid and the slow virus packaging plasmid pCMV-dr8.91 that will express tsiklomitsin arrestin tTR-KRAB, coating plasmid pMD2.G is according to every 60mm Tissue Culture Dish 15 μ g: 10 μ g: the ratio of 5 μ g is advanced in the 293T cell with calcium phosphate transfection test kit (available from green skies company) cotransfection, renewing the bright nutrient solution that contains 10%FBS after 8 hours continues to cultivate, cell conditioned medium behind the collection 48h, the centrifugal 5-10min of 2500rpm, with supernatant with 0.45 μ m membrane filtration, use ultracentrifuge (Beckman company) at 24500rpm then, 4 ℃ of ultracentrifugation 2hours, careful supernatant discarded, ice bath at least 2 hours, use Opti-MEM resuspended and packing is viral at last, make the titre of virus reach consistent with the titre of the lentiviral vectors of expression shRNA.

7. the slow virus that will express shRNA advances in the target cell with the slow virus linked transduction of expressing tsiklomitsin modulin tTR-KRAB, observes then that DOX adds or does not add influence to hbv replication and expression: carry the day before yesterday with the HepG2.2.15 cell with 5 * 10 ⁵The density in/hole is inoculated in 6 orifice plates, the slow virus of just expressing shRNA in second day and the slow virus of expressing tsiklomitsin modulin tTR-KRAB are all with the titre of the MOI=10 into HepG2.2.15 cell of transduceing, the Polybrene (available from U.S. Sigma company) that adds 6 μ g/mL simultaneously, after virus is hatched 12h, cell is divided into two, and half adding contains the fresh medium of 5 μ g/mLDOX (available from U.S. Sigma company); Second half adds the fresh medium that does not contain DOX, continues to cultivate; Collecting cell after 4 days, HBV nucleocapsid in the extracting born of the same parents, half is used for doing the variation that Western blotting detects HBV Core protein expression level, second half extracts the HBV DNA in the nucleocapsid, is Southern blotting to detect the variation of HBV dna replication dna level with the probe of P32 mark then.

8. interpretation of result:

(1) slow virus mediation all has in various degree inhibition at the shRNA of the different conserved regions of HBV to HBV, referring to Fig. 1, Fig. 2, Fig. 3 and table 2.Presentation of results is as follows:

Each sample is got the mean value of three experiments, HBeAg and HBsAg value in the untreated fish group HepG2.2.15 cell conditioned medium are made as 100, and visible LV-HBV-shRNA2 (1775-1795i) and LV-HBV-shRNA3 (1826-1845i) have significant inhibitory effect on the level of HBsAg and HBeAg.Wherein, during 72h, LV-HBV-shRNA3 (1826-1845i) reaches maximum to the inhibition of HBsAg after transduction, and inhibiting rate is 98.5%; Corresponding LV-HBV-shRNA2 (1775-1795i) then reaches 90.9% to the inhibition of HBsAg.The trend of this inhibition is embodied on the HBeAg equally: during 96h, LV-HBV-shRNA3 (1826-1845i) reaches maximum to the inhibition of HBeAg after transduction, and inhibiting rate is 73.5%; LV-HBV-shRNA2 (1775-1795i) then reaches 44.9% (as Fig. 1 and Fig. 2) to the inhibiting rate of HBeAg.

After transduction during 96h, LV-HBV-shRNA3 has reduced more than 10 times the DNA copy number of HBV in the supernatant, and LV-HBV-shRNA2 can reduce the DNA copy number of HBV in the supernatant about 9 times, and the LV-HBV-shRNA1 that suppresses the efficient minimum also can reduce about 4 times (table 2) with the DNA copy number of HBV.

The variation of HBV mRNA level is to draw according to the amount of the HBV Auele Specific Primer level amount divided by internal control gene β-actin in the born of the same parents.Each sample all is to get average.The ratio of untreated fish group is made as 100, and ratio is higher than untreated fish group greater than 100 expression HBVmRNA levels, and promptly the mRNA level rises; On the contrary, if ratio is less than 100, represent that then HBV mRNA level reduces, it is good more to be worth more little expression interference effect.The result shows: compare with untreated fish group, LV-HBV-shRNA3 (1826-1845i) can reduce by 98.1% with the mRNA level of HBV; And LV-HBV-shRNA2 (1775-1795i) makes HBV mRNA level reduce by 82.8% (Fig. 3); This ELISA and real time PCR result same and front are consistent, and illustrate that LV-HBV-shRNA3 (1826-1845i) and LV-HBV-shRNA2 (1775-1795i) have very strong restraining effect equally to the transcription product of HBV.

(2) utilize the slow virus carrier system of DOX control not only can control duplicating and expressing of HBV strongly, and this restraining effect is (Fig. 4 and the Fig. 5) that is subjected to the strictness control of DOX.

Fig. 4 does not have under the situation of DOX, even LV-HBV-shRNA3 and LV-tTR-KRAB infect simultaneously, the core albumen of the HBV normal expression that remains unchanged, but in case add DOX (5 μ g mL-1), the RNAi of slow virus mediation demonstrates very strong interference effect immediately, and the proteic expression amount of the core of HBV descends immediately.And iff being that LV-HBV-shRNA3 infects the HepG2.2.15 cell, no matter whether the existence of DOX is arranged, all showing intensive and suppress effect.And the expression level of confidential reference items GAPDH without any variation.

Fig. 5 does not have under the situation of DOX, LV-HBV-shRNA3 and LV-tTR-KRAB infect simultaneously, duplicating of HBV still normally carried out, but in case add DOX (5 μ g mL-1), the RNAi of slow virus mediation demonstrates very strong interference effect immediately, duplicating of HBV is suppressed, the content of RC-DNA, DL-DNA and ssDNA all significantly reduces, and iff being LV-HBV-shRNA3 infection HepG2.2.15 cell, no matter whether the existence of DOX is arranged, all shown intensive and suppressed effect, this result with Western blotting is consistent.HBV finishes its reproduction process in the nucleocapsid in born of the same parents, the replicative intermediate of HBV comprises that in a single day the content of RC-DNA, DL-DNA and ssDNA be lowered, and its process of duplicating just can't be finished.

Present embodiment provides the packing synoptic diagram of DOX inductive lentiviral vectors as shown in Figure 6, and its process is: the lentiviral vectors LV-shRNA of construction expression siRNA and express the lentiviral vectors LV-tTR-KRAB of tsiklomitsin arrestin in the 293T cell at first; Its process is to utilize calcium phosphate transfection test kit (available from green skies company) according to pLVTH-shRNA: pCMV-dr8.91: pMD2.G=15 μ g: 10 μ g: 5 μ g and pLV-tTR-KRAB: pCMV-dr8.91: pMD2.G=15 μ g: 10 μ g: the ratio of 5 μ g joins respectively in the cell ware (available from U.S. Corning company) of the 60mm that has inoculated the 293T cell the day before yesterday, collect the cell conditioned medium of 48h after the transfection then respectively, the centrifugal 5-10min of 2500rpm, with supernatant with 0.45 μ m membrane filtration, use ultracentrifuge (Beckman company) at 24500rpm then, 4 ℃ of ultracentrifugation 2hours, careful supernatant discarded, ice bath at least 2 hours is used the resuspended virus of Opti-MEM at last; Secondly, these two virus vector are transduceed in the target cell with same virus titer, in a single day lentiviral vectors enters target cell, its genome can be incorporated on host's the genome, yet, after the lentiviral vectors of expression tsiklomitsin arrestin enters target cell, express tTR-KRAB albumen, this albumen is attached on the tetO of the lentiviral vectors of expressing shRNA by the DNA binding domains, thereby closes Expression of Related Genes; At this moment, if add tetracycline analogue doxycycline (DOX), then DOX can be attached on the tTR-KRAB albumen at once, changes its structural domain, thereby makes it can not be in conjunction with tetO, and then unlatching relevant interference expression of gene, enter in the tenuigenin after shRNA transcribes in nucleus, cut into the siRNA of 19-21nt then by the Dicer enzyme in the tenuigenin, then the albumen polymerization shape RNA silencing complex (RISC) in siRNA and the born of the same parents, the homologous said target mrna with it of degrading at last reaches its restraining effect.

Subordinate list

Table 1 utilizes information biology to filter out siRNAs at the different conserved regions of HBV

The influence of HBV virion secretion level in the RNAi pair cell supernatant of table 2 slow virus mediation

Time(HBV?DNA?copy×10 ⁴mL ^-1)

Sequence table

＜110〉Wuhan Virology Institute,Chinan academy of Sciences

＜120〉utilize the method for lentiviral vectors mediate rna i

<140>

<141>

<160>1

<170>

<210>1

<211>21

<212>DNA

＜213〉at the target sequence of the siRNA (N) of HBV conserved regions

<220>

<221>

<222>

<223>

<400>1

CTAGTGAAGGGCGTATGATTA

<210>2

<211>19

<212>DNA

＜213〉at the target sequence of the siRNA1 of HBV conserved regions

<220>

<221>

<222>

<223>

<400>2

GCTCAGTTTACTAGTGCCA

<210>3

<211>21

<212>DNA

＜213〉at the target sequence of the siRNA2 of HBV conserved regions

<220>

<221>

<222>

<223>

<400>3

CTAGGAGGCTGTAGGCATAAA

<210>4

<211>19

<212>DNA

＜213〉at the target sequence of the siRNA3 of HBV conserved regions

<220>

<221>

<222>

<223>

<400>4

TTCACCTCTGCCTAATCAT

Claims

1. method of utilizing lentiviral vectors mediate rna i, the method that it is characterized in that a kind of lentiviral vectors mediate rna i based on doxycycline control, specifically: at first, the biological software that utilization is correlated with is carried out homology analysis to the nucleotide sequence of correlated virus, find out conservative region, design siRNA at the correlated virus conservative region; Again synthetic siRNA is cloned among the expression plasmid pLVTH, then with in this expression plasmid and the common transfection 293T of pCMV-dR8.91, the pMD2.G cell, cell conditioned medium after the collection transfection, formed the lentiviral vectors of expressing the high titre of siRNA through ultracentrifugation, purifying, after concentrating, to express the lentiviral vectors LV-tTR-KRAB corotation importing target cell of lentiviral vectors with the control tsiklomitsin switch of siRNA at last, and utilize tetracycline analogue DOX to come strict control pharmaceutically-active time of siRNA and dosage.

2. method according to claim 1 is characterized in that adopting the method that may further comprise the steps:

(1) screening siRNAs:

Utilize information biology to filter out several siRNAs: earlier according to the gene order of correlated virus among the GeneBank at corresponding virus, principle with reference to the siRNA design, selecting the length of gene coding region AA beginning at shRNA design website http://rnadesigner.classic.invitrogen.com/rnaiexpress/index.jsp is 21nt, the GC% conservative nucleotide sequence between 45%-55%, avoid the non-coding region of 5 ' and 3 ' end, again the sequence of selecting is carried out the analysis of BLAST homology, avoid having the homologous interference sequence with the people's gene group;

(2) to the evaluation of the siRNAs that filters out:

Different siRNAs is building up among the carrier for expression of eukaryon pSuper, and whether these several siRNAs are influential to virus for preliminary assessment, and its method is: utilize Lipofectamine2000 ^TMThe pSuper-shRNA transfection is advanced in the cell, and cell conditioned medium and cell after the collection transfection utilize Protocols in Molecular Biology to detect the variation of corresponding viral index;

(3) lentiviral vectors of construction expression shRNA:

Respectively these several shRNAs are cloned among the lentivirus transfer plasmid pLVTH, then the transferring plasmid pLVTH-HBV-shRNA and packaging plasmid pCMV-dr8.91, the coating plasmid pMD2.G cotransduction that build are advanced in the 293T cell, collect the cell conditioned medium of transduction back 48h, the centrifugal 5-10min of 2500rpm, with supernatant with 0.45 μ m membrane filtration, centrifugal 2 hours of 24500rpm then, supernatant discarded is used the resuspended virus of Opti-MEM at last;

(4) titre of survey lentiviral vectors:

Resuspended virus according to 10 times of dilutions, is added respectively in each hole then, to incubator, cultivate; After the overnight incubation, renew bright cell culture fluid and continue to cultivate; Observe fluorescence behind the 48h, number goes out the number of cell in the hole that fluorocyte accounts for 9-11%; Calculate virus titer according to following formula again:

Tilter (/ml)=10% GFP ⁺Cells * total cell count * viral dilution multiple,

With the lentiviral vectors that builds according to the titre of MOI=10 transduce into cell, detailed assessment virus replication and expression levels then;

Expression plasmid and slow virus packaging plasmid pCMV-dr8.91, the coating plasmid pMD2.G cotransduction of expressing tsiklomitsin arrestin tTR-KRAB are advanced in the 293T cell, cell conditioned medium behind the collection 48h, the centrifugal 5-10min of 2500rpm, with supernatant with 0.45 μ m membrane filtration, centrifugal 2 hours of 24500rpm then, supernatant discarded is used the resuspended virus of Opti-MEM at last, makes the titre of virus reach consistent with the titre of the lentiviral vectors of expressing shRNA;

(7) slow virus that will express shRNA advances in the target cell with the slow virus linked transduction of expressing tsiklomitsin modulin tTR-KRAB, observes virus replication and changes of expression level under the situation that DOX adds or do not add then.

3. method according to claim 2 is characterized in that adopting following method screening siRNAs:

Elder generation is according to the gene order U95551 of HBV among the GeneBank, principle with reference to the siRNA design, selecting the length of gene coding region AA beginning at shRNA design website http://rnadesigner.classic.invitrogen.com/rnaiexpress/index.jsp is 21nt, the GC% conservative nucleotide sequence between 45%-55%, avoid the non-coding region of 5 ' and 3 ' end, again the sequence of selecting is carried out the analysis of BLAST homology, avoid having the homologous interference sequence with the people's gene group; According to the requirement of pSuper carrier, the two ends of design 60-64nt comprise B respectively then GlII and H IndThe oligonucleotide chain of the restriction enzyme site of III designs an irrelevant interference sequence simultaneously as negative control.

4. method according to claim 2 is characterized in that the method for utilizing Protocols in Molecular Biology to detect the variation of corresponding viral index is:

Utilization comprises that the Protocols in Molecular Biology of ELISA, real-time PCR, RT-PCR, Western blotting, Southern blotting detects in the HBsAg of virus and the copy number of HBeAg, supernatant HBV, the born of the same parents variation of hbv replication level in the variation of HBV core protein expression level in HBV mRNA expression, the born of the same parents and the born of the same parents respectively.

5. method according to claim 2 is characterized in that with the method for the resuspended virus of Opti-MEM being:

Lentiviral vectors is with after 24500rpm ultracentrifugation 2 hours, and with the resuspended virus of Opti-MEM of the ice of 100 μ l, will place virus on ice 2h at least this moment, and operation gently, can not produce bubble.

6. method according to claim 2 is characterized in that adopting following method detailed assessment virus replication and expression levels:

Lentiviral vectors is transduceed into behind the target cell, at the time point of 24h, 48h, 72h, 96h and 1week collecting cell supernatant respectively, collects the cell behind 1 week then, is used to detect the variation of different viral indexs; The variation of the HBsAg of HBV and HBeAg level is to detect with section's China ELISA test kit in the cell conditioned medium; The variation of viral copy number is to utilize real-time PCR to detect in the cell conditioned medium, wherein the extracting of supernatant HBV DNA is extracted the operation of test kit operation instructions according to TIANGEN virus genom DNA/RNA, analyzes in Aligent Technology software at last; The variation of intracellular virus rna level is to adopt real-time fluorescent RT-PCR method for detecting, during detection with cell house-keeping gene β-actin as internal control gene, in Aligent Technology software, analyze then; And the variation of the levels of replication of intracellular virus is to utilize P ³²The probe of mark is done the content that Southern blotting detects HBV DNA in the intracellular nucleic capsid; The proteic changes of expression level of intracellular virus is to utilize Western blotting to detect in the born of the same parents the proteic content of core in the nucleocapsid, and with GAPDH content in the cell as confidential reference items.

7. method according to claim 1 is characterized in that adopting following method to observe virus replication and changes of expression level under the situation that DOX adds or DOX does not add:

The slow virus of expressing shRNA is advanced target cell with the slow virus linked transduction of expressing tsiklomitsin modulin tTR-KRAB, cell was divided into 2 groups in second day, one group adds DOX and handles, another group does not add DOX and handles, collect this two groups of cells after 4 days respectively, the nucleocapsid of the intracellular HBV of extracting, half directly is used for being Western blotting, and purpose is to detect the variation of HBV core protein expression level; Second half comes out the HBV DNA extracting and purifying in the nucleocapsid, uses P ³²The probe of mark is Southern blotting and is detected, and its objective is the situation of duplicating of observing HBV in the born of the same parents.