CN102056889B - The manufacture method of five methylene diamine and the manufacture method of polyamide resin - Google Patents

The manufacture method of five methylene diamine and the manufacture method of polyamide resin Download PDF

Info

Publication number
CN102056889B
CN102056889B CN200980121108.3A CN200980121108A CN102056889B CN 102056889 B CN102056889 B CN 102056889B CN 200980121108 A CN200980121108 A CN 200980121108A CN 102056889 B CN102056889 B CN 102056889B
Authority
CN
China
Prior art keywords
methylene diamine
carbonate
methylene
manufacture method
aqueous solution
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN200980121108.3A
Other languages
Chinese (zh)
Other versions
CN102056889A (en
Inventor
人见达也
草野一直
横木正志
山本正规
浦嶋英俊
宫奥康平
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Mitsubishi Chemical Corp
Mitsubishi Rayon Co Ltd
Original Assignee
Mitsubishi Kasei Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mitsubishi Kasei Corp filed Critical Mitsubishi Kasei Corp
Publication of CN102056889A publication Critical patent/CN102056889A/en
Application granted granted Critical
Publication of CN102056889B publication Critical patent/CN102056889B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08G—MACROMOLECULAR COMPOUNDS OBTAINED OTHERWISE THAN BY REACTIONS ONLY INVOLVING UNSATURATED CARBON-TO-CARBON BONDS
    • C08G69/00—Macromolecular compounds obtained by reactions forming a carboxylic amide link in the main chain of the macromolecule
    • C08G69/02—Polyamides derived from amino-carboxylic acids or from polyamines and polycarboxylic acids
    • C08G69/26—Polyamides derived from amino-carboxylic acids or from polyamines and polycarboxylic acids derived from polyamines and polycarboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C209/00—Preparation of compounds containing amino groups bound to a carbon skeleton
    • C07C209/68—Preparation of compounds containing amino groups bound to a carbon skeleton from amines, by reactions not involving amino groups, e.g. reduction of unsaturated amines, aromatisation, or substitution of the carbon skeleton
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C209/00—Preparation of compounds containing amino groups bound to a carbon skeleton
    • C07C209/82—Purification; Separation; Stabilisation; Use of additives
    • C07C209/84—Purification
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08G—MACROMOLECULAR COMPOUNDS OBTAINED OTHERWISE THAN BY REACTIONS ONLY INVOLVING UNSATURATED CARBON-TO-CARBON BONDS
    • C08G69/00—Macromolecular compounds obtained by reactions forming a carboxylic amide link in the main chain of the macromolecule
    • C08G69/02—Polyamides derived from amino-carboxylic acids or from polyamines and polycarboxylic acids
    • C08G69/26—Polyamides derived from amino-carboxylic acids or from polyamines and polycarboxylic acids derived from polyamines and polycarboxylic acids
    • C08G69/28—Preparatory processes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Polyamides (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention provides a kind of manufacture method etc. of refining five methylene diamine, it can obtain high yield with simple manufacturing process.The feature of the manufacture method of this refining five methylene diamine is, it comprises: pyrolosis operation, in this pyrolosis operation, by heating five methylene diamine carbonate, obtains five methylene diamine crude product and carbonic acid gas; And distillation process, in this distillation process, by the five methylene diamine crude product distillation obtained by above-mentioned pyrolosis operation, obtain five methylene diamine, wherein, in above-mentioned five methylene diamine crude product, relative to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is more than 30mol%.

Description

The manufacture method of five methylene diamine and the manufacture method of polyamide resin
Technical field
The present invention relates to the manufacture method etc. of five methylene diamine, in more detail, relate to the manufacture method etc. comprising five methylene diamine five methylene diamine carbonate being carried out to disaggregating treatment.
Background technology
As plastic raw materials, mostly use so-called fossil feedstock.Except the situation of regeneration, during waste plastic, by the discarded discharge causing carbonic acid gas of burning etc., so become problem in recent years.So towards preventing global warming and forming Circular Society Construction, people wait in expectation and the manufacture raw material of plastics are replaced with the raw material deriving from biomass.Such demand is throughout many-sides such as the injection-molded articles such as film, trolley part, electrical and electronic parts, mechanical part, fiber, monofilament.
Under such background, for using the five methylene diamine (below sometimes referred to as cadaverine) that obtains from Methionin as 56 nylon of raw material and 56/66 nylon etc., its polymkeric substance as plant origin makes us expecting very much.Polyamide resin is excellent in physical strength, thermotolerance, chemical proofing etc., is just used to a lot of field as one of so-called engineering plastics.
In the past, as the manufacture method of five methylene diamine, following report (see patent documentation 1 ~ patent documentation 4) can be enumerated.
A kind of method is described in patent documentation 1, wherein, add the dicarboxylic acid that carbonatoms is 4 ~ 10, be suitable for pH4.0 ~ 8.0 of enzymatic decarboxylation reaction to make the pH of lysine solution maintain, carry out the enzymatic decarboxylation reaction of Methionin simultaneously, generate cadaverine dicarboxylate thus.
A kind of method is described in patent documentation 2, wherein, make the 1B dicarboxylate aqueous solution with imported 1B decarboxylase gene intestinal bacteria or with 1B decarboxylase be present in cell surface local intestinal bacteria contact, use by the 1B fermented liquid carrying out while dicarboxyl acid for adjusting pH fermenting to prepare 1B decarboxylase, thus manufacture cadaverine dicarboxylate.
A kind of method is described in patent documentation 3, wherein, the 1B decarboxylase gene being added with 6 Histidines on N-terminal aminoacid sequence is imported in colibacillary cytoclasis liquid, the colibacillary cytoclasis liquid of the L lysine HCL of high density and this is contacted or is present in cell surface intestinal bacteria locally with 1B decarboxylase to contact, do not need thus to regulate pH, and generate cadaverine with high density, high reaction yield, high production speed, this reaction solution is adjusted to more than pH13, extract with polar organic solvent, distill, manufacture cadaverine thus.
A kind of method is described in patent documentation 4, wherein, take lysine carbonate as substrate, after adding carbonic acid gas adjustment pH, utilize the enzymatic decarboxylation reaction of Methionin to generate cadaverine carbonate, in the cadaverine carbonate generated, add dicarboxylate, after carrying out the salt permutoid reaction with carbonic acid, through separation circuit, manufacture cadaverine dicarboxylate.
Prior art document
Patent documentation
Patent documentation 1: Japanese Unexamined Patent Publication 2005-006650 publication
Patent documentation 2: Japanese Unexamined Patent Publication 2004-208646 publication
Patent documentation 3: Japanese Unexamined Patent Publication 2004-14 publication
Patent documentation 4: International Publication No. 2006/123778 brochure
Summary of the invention
In addition, can be separated from reaction solution by combination known method, generate and react (hereinafter sometimes referred to LDC reaction) cadaverine dicarboxylate of obtaining by the enzymatic decarboxylation of Methionin.Such as, by by the reaction solution cooling after concentrated, separate out cadaverine dicarboxylate, thereafter, utilize the common solid-liquid separating methods such as centrifugation to isolate the crystallization of cadaverine dicarboxylate.
But crystallization method is not only difficult to obtain cadaverine dicarboxylate with high yield, and, impurity can not be removed completely, so there is painted problem with its polymeric amide obtained for raw material.
Further, as obtaining the method for being reacted the cadaverine generated by LDC from reaction solution, known following method: add the alkali such as sodium hydroxide in reaction terminating liquid, after the pH of reaction solution is adjusted to 12 ~ 14, cadaverine is extracted with trichloromethane polar organic solvent.But organic solvent is harmful to mostly, particularly trichloromethane has acute toxicity, so its operability is not preferred.Further, if when extracting with an organic solvent, then greatly affect cost when not reclaiming organic solvent, when reclaiming organic solvent, there is the problem that manufacturing process complicates.And, when reclaiming organic solvent, need to carry out the operation that reclaims, there is not only technique and complicate, and the problem that energy aspect is also unfavorable and so on.
In addition, also consider following method: by cadaverine carbonate aqueous solution at about 40 DEG C concentrating under reduced pressure, make carbanion etc. as Carbon emission out, obtain the method for cadaverine thus.But, sometimes need the long period from separation of carbon acid ion cadaverine carbonate etc.
Further, known exist the macromolecule impurity such as impurity or protein that Methionin etc. has more than 3 functional groups in the five methylene diamine carbonate aqueous solution of biomass source.Therefore, if distilled the five methylene diamine carbonate aqueous solution containing such impurity, then the reaction product that generates of impurity or the such high-viscosity material of impurity concentrations are deposited at the bottom of the tower of distillation tower, become the reason of causing trouble.If the impurity that such high-viscosity material or above-mentioned Methionin etc. have more than 3 functional groups is mixed in the five methylene diamine obtained by distillation, be then that the polyamide membrane such as 56 nylon of raw material likely produce bad order with five methylene diamine.
The object of the present invention is to provide a kind of manufacture method etc. of refining five methylene diamine, it can obtain high yield with simple manufacturing process.
Present inventor has performed further investigation, found that, by implementing the disaggregating treatment under high temperature to five methylene diamine carbonate aqueous solution, five methylene diamine can be obtained with high yield, and by the five methylene diamine making the thermolysis of five methylene diamine carbonate obtain certain concentration, and distillation is refining, the five methylene diamine of high-quality can be obtained with high yield, thus complete the present invention.
According to the present invention, the manufacture method of refining five methylene diamine and the manufacture method of polyamide resin can be provided.
That is, main points of the present invention are as described below.
(1) manufacture method for refining five methylene diamine, is characterized in that, this manufacture method comprises: pyrolosis operation, in this pyrolosis operation, by adding five methylene diamine carbonate, obtains five methylene diamine crude product and carbonic acid gas; With
Distillation process, in this distillation process, by the five methylene diamine crude product distillation obtained by above-mentioned pyrolosis operation, obtains five methylene diamine,
In above-mentioned five methylene diamine crude product, relative to the summation 100mol% of five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is more than 30mol%.
The manufacture method of the refining five methylene diamine (2) as described in above-mentioned (1), is characterized in that, in described pyrolosis operation, the top temperature of heating is 40 DEG C ~ 300 DEG C.
The manufacture method of the refining five methylene diamine (3) as described in above-mentioned (1) or (2), is characterized in that, the condition of described distillation process is following (1) and (2).
(1) distillation temperature: 40 DEG C ~ 300 DEG C
(2) pressure: 0.2kPa ~ 1200kPa (absolute pressure) is distilled
(4) manufacture method for refining five methylene diamine, is characterized in that, this manufacture method comprises: pyrolosis operation, in this pyrolosis operation, by heating five methylene diamine carbonate, obtains five methylene diamine crude product and carbonic acid gas; With
Distillation process, in this distillation process, by the five methylene diamine crude product distillation obtained by above-mentioned pyrolosis operation, obtains five methylene diamine,
The top temperature of the heating in above-mentioned pyrolosis operation is 110 DEG C ~ 300 DEG C.
The manufacture method of the refining five methylene diamine (5) as described in any one of above-mentioned (1) ~ (4), it is characterized in that, in described pyrolosis operation, five methylene diamine carbonate is the aqueous solution of five methylene diamine carbonate, by heating, obtain five methylene diamine crude product, carbonic acid gas and water.
The manufacture method of the refining five methylene diamine (6) as described in any one of above-mentioned (1) ~ (5), is characterized in that, the pressure in described pyrolosis operation is 2kPa ~ 1200kPa.
The manufacture method of the refining five methylene diamine (7) as described in any one of above-mentioned (1) ~ (6), is characterized in that, in described pyrolosis operation, be blown into gas, while heating five methylene diamine carbonate.
The manufacture method of the refining five methylene diamine (8) as described in above-mentioned (7), is characterized in that, described gas is rare gas element.
The manufacture method of the refining five methylene diamine (9) as described in any one of above-mentioned (1) ~ (8), it is characterized in that, there is enzymatic decarboxylation reaction process before described pyrolosis operation, in described enzymatic decarboxylation reaction process, use at least one in the group being selected from and being made up of lysine decarboxylase, the recombinant microorganism that improve lysine decarboxylase activity, the generation cell of lysine decarboxylase and the handled thing of this cell, produce five methylene diamine carbonate by Methionin and/or lysine carbonate.
The manufacture method of the refining five methylene diamine (10) as described in above-mentioned (9), is characterized in that, in described enzymatic decarboxylation reaction process, described Methionin and/or lysine carbonate are the aqueous solution of this Methionin and/or the aqueous solution of this lysine carbonate.
The manufacture method of the refining five methylene diamine (11) as described in above-mentioned (9) or (10), is characterized in that, carries out described enzymatic decarboxylation reaction process under carbon dioxide atmosphere.
The manufacture method of the refining five methylene diamine (12) as described in any one of above-mentioned (9) ~ (11), it is characterized in that there is the lysine carbonate generation process being obtained lysine carbonate by Methionin and carbonic acid gas before described enzymatic decarboxylation reaction process.
The manufacture method of the refining five methylene diamine (13) as described in above-mentioned (12), is characterized in that, in described lysine carbonate generation process, Methionin is the aqueous solution.
The manufacture method of the refining five methylene diamine (14) as described in above-mentioned (11), is characterized in that, using the carbonic acid gas generated in described pyrolosis operation as enzymatic decarboxylation reaction process carbon dioxide recovery, re-use.
The manufacture method of the refining five methylene diamine (15) as described in above-mentioned (12), is characterized in that, using the carbonic acid gas generated in described pyrolosis operation as be used for described lysine carbonate generation process carbon dioxide recovery, re-use.
The manufacture method of the refining five methylene diamine (16) as described in above-mentioned (10), is characterized in that, using the water generated in described pyrolosis operation as described enzymatic decarboxylation reaction process Water Sproading, re-use.
The manufacture method of the refining five methylene diamine (17) as described in above-mentioned (13), is characterized in that, using the water generated in described pyrolosis operation as described lysine carbonate generation process Water Sproading, re-use.
The manufacture method of the refining five methylene diamine (18) as described in any one of above-mentioned (5) ~ (17), it is characterized in that, the organic total content with more than 3 functional groups contained in five methylene diamine carbonate is less than 0.01 relative to the weight ratio of five methylene diamine contained in the described aqueous solution of five methylene diamine carbonate.
The manufacture method of the refining five methylene diamine (19) as described in above-mentioned (18), is characterized in that, the organism with more than 3 functional groups contained in the described aqueous solution of five methylene diamine carbonate is Methionin.
The manufacture method of the refining five methylene diamine (20) as described in any one of above-mentioned (5) ~ (19), is characterized in that, after being removed by macromolecule impurity contained in the aqueous solution of five methylene diamine carbonate, heats.
The manufacture method of the refining five methylene diamine (21) as described in above-mentioned (20), is characterized in that, uses ultra-filtration membrane to remove macromolecule impurity contained in five methylene diamine carbonate aqueous solution.
(22) manufacture method for polyamide resin, is characterized in that, this manufacture method comprises:
Enzymatic decarboxylation reaction process, in this enzymatic decarboxylation reaction process, use at least one in the group being selected from and being made up of lysine decarboxylase, the recombinant microorganism that improve lysine decarboxylase activity, the generation cell of lysine decarboxylase and the handled thing of this cell, produce five methylene diamine carbonate by Methionin and/or lysine carbonate;
Pyrolosis operation, in this pyrolosis operation, by heating the five methylene diamine carbonate obtained by above-mentioned enzymatic decarboxylation reaction process, obtains five methylene diamine crude product and carbonic acid gas;
Distillation process, in this distillation process, by the five methylene diamine crude product distillation obtained by above-mentioned pyrolosis operation, obtains five methylene diamine; With
Polycondensation operation, in this polycondensation operation, carries out polycondensation using dicarboxylic acid and the five methylene diamine that obtained by above-mentioned distillation process as monomer component,
In the five methylene diamine crude product obtained in above-mentioned pyrolosis operation, relative to the summation 100mol% of five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is more than 30mol%.
(23) manufacture method for polyamide resin, is characterized in that, this manufacture method comprises:
Enzymatic decarboxylation reaction process, in this enzymatic decarboxylation reaction process, use at least one in the group be made up of lysine decarboxylase, the recombinant microorganism that improve lysine decarboxylase activity, the generation cell of lysine decarboxylase or the handled thing of this cell, produce five methylene diamine carbonate by Methionin and/or lysine carbonate;
Pyrolosis operation, in this pyrolosis operation, by heating the five methylene diamine carbonate obtained by above-mentioned enzymatic decarboxylation reaction process, obtains five methylene diamine crude product and carbonic acid gas;
Distillation process, in this distillation process, by the five methylene diamine crude product distillation obtained by above-mentioned pyrolosis operation, obtains five methylene diamine; With
Polycondensation operation, in this polycondensation operation, carries out polycondensation using the five methylene diamine obtained by dicarboxylic acid and above-mentioned distillation process as monomer component,
The top temperature of the heating in above-mentioned pyrolysis operation is 110 DEG C ~ 300 DEG C.
The manufacture method of the polyamide resin (24) as described in above-mentioned (22) or (23), it is characterized in that, before described polycondensation operation, there is enrichment process, in this enrichment process, after utilizing described five methylene diamine, dicarboxylic acid and water to make the five methylene diamine dicarboxylate aqueous solution, water is removed in distillation.
The manufacture method of the polyamide resin (25) as described in any one of above-mentioned (22) ~ (24), it is characterized in that, in described enzymatic decarboxylation reaction process, described Methionin and/or lysine carbonate are this lysine solution and/or this lysine carbonate aqueous solution.
The manufacture method of the polyamide resin (26) as described in any one of above-mentioned (22) ~ (25), is characterized in that, before described enzymatic decarboxylation reaction process, has the lysine carbonate generation process being obtained lysine carbonate by Methionin and carbonic acid gas.
The manufacture method of the polyamide resin (27) as described in above-mentioned (26), is characterized in that, in described lysine carbonate generation process, Methionin is the aqueous solution.
The manufacture method of the polyamide resin (28) as described in above-mentioned (25), is characterized in that, using the water generated in described polycondensation operation and/or enrichment process as described enzymatic decarboxylation reaction process Water Sproading, re-use.
The manufacture method of the polyamide resin (29) as described in above-mentioned (27), is characterized in that, using the water generated in described polycondensation operation and/or enrichment process as described lysine carbonate generation process Water Sproading, re-use.
According to the present invention, compared with the past, can simple manufacturing process be passed through, manufacture five methylene diamine with high yield.And then, by part or all carbon dioxide recovery will generated in pyrolosis operation, and re-used, can reduce and manufacture the energy expenditure that carbonic acid gas accompanies and the Carbon emission of accompanying with energy expenditure.And, by part or all Water Sproading will generated in pyrolosis operation, polycondensation step and/or enrichment process, and re-used, the discharge of the supply energy that consumes of water and water can be reduced.
Accompanying drawing explanation
Fig. 1 is an example of the result utilizing automatic titration device to measure.
Fig. 2 is the figure of the process that clone cadA is described.
Embodiment
Below, embodiments of the present invention are described in detail.It should be noted that, the invention is not restricted to following embodiment, various distortion can be carried out implement in the scope of its main points.Further, accompanying drawing used, in order to present embodiment is described, does not represent physical size.
(five methylene diamine carbonate)
The five methylene diamine carbonate that present embodiment uses reacts (LDC reaction) preferably by the enzymatic decarboxylation of Methionin and obtains.Use Methionin or lysine carbonate and be selected from by lysine decarboxylase, improve lysine decarboxylase activity recombinant microorganism, produce at least one in group that the cell of lysine decarboxylase and the handled thing of this cell form to carry out the LDC reaction of Methionin.The LDC reaction of Methionin as described later.
In present embodiment, the five methylene diamine carbonate be obtained by reacting by the LDC of Methionin is obtained usually in form of an aqueous solutions.In addition, five methylene diamine carbonate also can be solid state, but is preferably the aqueous solution or is dissolved in the state of solution of other solvents.The concentration of five methylene diamine carbonate of the aqueous solution or the solution that is dissolved in other solvents is generally 1 % by weight ~ 80 % by weight, is preferably 30 % by weight ~ 70 % by weight.
In addition, after the LDC reaction of Methionin, when the concentration of the five methylene diamine carbonate obtained is lower than above-mentioned scope, preferably concentration operation is carried out as required.
The five methylene diamine carbonate be obtained by reacting by the LDC of Methionin is usually containing impurity, and described impurity comprises the polymer substance such as organism, protein with more than 3 functional groups.
Herein, the organism with more than 3 functional groups can be enumerated in molecule has the organism that more than 3 can cause the functional group of cross linked gel.As such functional group, such as amino, carboxyl, sulfuryl, phosphate, hydroxyl, hydrazide group, epoxy group(ing), sulfydryl, nitro, alkoxyl group etc. can be enumerated.
As the organism with more than 3 functional groups, amino acid, oligosaccharides, oxysuccinic acid, citric acid etc. can be enumerated.As amino acid whose concrete example, such as aspartic acid, L-glutamic acid, l-asparagine, glutamine, Methionin, ornithine, oxylysine, arginine, Histidine etc. can be enumerated.Wherein, there is a large amount of Methionin.It should be noted that, these amino acid can be left-handed (L) body, also can be dextrorotation (D) body.
(pyrolosis operation)
In present embodiment, the five methylene diamine carbonate heating that LDC by Methionin is obtained by reacting, be five methylene diamine crude product containing impurity and carbonic acid gas at the temperature thermal decomposition preset, next, five methylene diamine crude product is distilled, obtains the refining five methylene diamine eliminating impurity.
First, illustrate the operation of five methylene diamine carbonate thermolysis.
By heating, by the thermolysis of five methylene diamine carbonate.So, in the arbitrary stroke such as concentrated, backflow, dehydration distillation, distillation being attended by heating, all can there is thermolysis.Therefore, the top temperature of the heat decomposition temperature in the present invention equals to be attended by the top temperature in whole strokes of heating.
The top temperature of the heat decomposition temperature of the five methylene diamine carbonate be obtained by reacting by the LDC of Methionin is generally more than 40 DEG C, is preferably more than 110 DEG C, is more preferably more than 120 DEG C, more preferably more than 130 DEG C, is particularly preferably more than 150 DEG C.Further, be generally less than 300 DEG C, be preferably less than 250 DEG C, be more preferably less than 230 DEG C, more preferably less than 220 DEG C, especially preferably less than 210 DEG C, be particularly preferably less than 200 DEG C.
If the temperature of heating five methylene diamine carbonate is too low, then five methylene diamine carbonate does not decompose, and the yield of the distillation procedure carried out thereafter reduces, and has the tendency causing pentamethylene carbonate to separate out.And if the temperature of heating is too high, then likely five methylene diamine decomposes.
The heat-up time of five methylene diamine carbonate is not particularly limited, but is generally more than 1 hour, preferably more than 2 hours, more preferably more than 3 hours.
As mentioned above, the five methylene diamine carbonate be obtained by reacting by the LDC of Methionin obtains usually in form of an aqueous solutions.In this case, due to the evaporation of water latent heat evaporated because of heat treated, thus when direct heating, the temperature of the aqueous solution not easily raises.Therefore, five methylene diamine carbonate does not carry out thermolysis, after dehydration, likely separates out five methylene diamine carbonate.
Therefore, in present embodiment, preferably as required concentration operation is implemented to the five methylene diamine carbonate aqueous solution that the LDC by Methionin is obtained by reacting, after being adjusted to the concentration preset, by by operations such as aqueous solution backflows, by most of five methylene diamine carbonate decomposition contained in the aqueous solution, carry out thereafter dehydration distillation etc.
Reflux temperature is different according to the moisture in the aqueous solution, when moisture concentration is low, can reflux at comparatively high temps.Reflux temperature is generally 40 DEG C ~ 300 DEG C, is preferably the scope of 100 DEG C ~ 180 DEG C, and return time is generally more than 1 hour, preferably more than 2 hours, more preferably more than 3 hours.
Further, as the operation that can obtain effect same, under the condition preferably do not separated out at the five methylene diamine carbonate contained by the aqueous solution, dehydration distillation is carried out by most of five methylene diamine carbonate decomposition.Now, in batch-wise situation, first, dehydration distillation is carried out at 100 DEG C ~ 120 DEG C.Interior temperature rise while amount of moisture reduces, temperature close near 160 DEG C ~ 180 DEG C time, start to distill out five methylene diamine, substantially complete dehydration.Further, temperature now reaches the temperature of enough five methylene diamine carbonate decomposition, obtains five methylene diamine crude product.As additive method, have and add the method that dehydration distillation Sum decomposition is carried out in pressure.By being set as pressurized state, the elevation of boiling point of water, decomposes and effectively carries out.
In addition, when using continuous working unit to carry out the thermolysis of five methylene diamine carbonate aqueous solution, in the reactive tank being held in the necessary temperature of thermolysis, preferably supply the five methylene diamine carbonate aqueous solution of specified amount, the method for decomposing of dewatering.
Further, when using continuous working unit, in order to effectively carry out the decomposition of five methylene diamine carbonate, following two steps are considered.
As the 1st step, first, by under reduced pressure heating with distillation tower, the dehydration of five methylene diamine carbonate aqueous solution is carried out.Solution at the bottom of tower is delivered to ensuing 2nd step, in solution at the bottom of this tower, moisture is few, and the heating under dehydration conditions makes a part of five methylene diamine carbonate decomposition.
As the 2nd step, regulate various condition, make the solution thermal degradation from the 1st step conveying.Now, preferably five methylene diamine carbonate is decomposed substantially completely.Secondly, by five methylene diamine crude product (preferably under reduced pressure) distillation obtained at the bottom of tower, five methylene diamine is obtained.
And then, in addition to the method described above, the sequence of operations such as distillation carrying out the dehydration of five methylene diamine carbonate aqueous solution, decomposition, five methylene diamine with a device also can be considered.Such as, use multistage distillation tower etc., by supplying five methylene diamine carbonate aqueous solution near the central authorities of distillation tower, high temperature at the bottom of the tower of distillation tower, will be arranged to, thus five methylene diamine carbonate is decomposed substantially completely.From recovered overhead water and the carbonic acid gas of distillation tower, reclaim the five methylene diamine distilled from distillation tower stage casing, at the bottom of tower, take out still residue.
In present embodiment, by above-mentioned pyrolosis operation, the five methylene diamine carbonate decomposition in five methylene diamine carbonate aqueous solution becomes five methylene diamine crude product and carbonic acid gas.If the summation of five methylene diamine and undecomposed and remaining five methylene diamine carbonate is set to 100mol%, then the concentration of the five methylene diamine contained by above-mentioned five methylene diamine crude product is generally more than 30mol%, is preferably more than 75mol%, is more preferably more than 85mol%, more preferably more than 90mol%, is especially preferably more than 95mol%, is particularly preferably more than 99mol%.In addition, when carrying out pyrolosis operation continuously, owing to supplying five methylene diamine carbonate aqueous solution while carry out thermolysis, so be difficult to obtain five methylene diamine carbonate decompose completely after five methylene diamine crude product, the concentration of the five methylene diamine contained by above-mentioned crude product is generally below 99.9mol%, is preferably below 99.5mol%, more preferably below 99.0mol%.
If five methylene diamine carbonate amount undecomposed and remaining in the aqueous solution is too much, when then passing through the fractionation by distillation five methylene diamine as subsequent handling, likely separate out with the form of carbonate at the bottom of the tower of distillation tower, yield reduces, or causes reboiler blocking, thermo-efficiency reduction.
Pressure during thermolysis is generally more than 2kPa, is preferably more than 10kPa, is particularly preferably more than 100kPa.Further, be generally below 1200kPa, be preferably below 800kPa, be particularly preferably below 500kPa.If hypotony, then because interior temperature does not raise, so the decomposition of five methylene diamine carbonate is not carried out, the yield of the distillation procedure carried out thereafter reduces, or at the bottom of the tower of distillation tower, separates out carbonate and cause trouble.Further, if hypertonia, then partial pressure of carbon dioxide is large, and need at high temperature to make decomposition carry out, the too high five methylene diamine that likely causes of temperature decomposes.
In addition, pressure herein refers to absolute pressure, the pressure that relevant elsewhere is recorded, and also all represents absolute pressure when representing as kPa.Further, distinguish therewith, when adding G to represent in pressure unit as kPaG, represent gauge pressure.
In pyrolosis operation, the decomposition that gas carries out five methylene diamine carbonate can be blown into.As the kind of gas, preferred rare gas element, usually, uses nitrogen or argon.By being blown into gas, reducing the dividing potential drop of carbonic acid gas, decomposing and carrying out further.
And then, in the five methylene diamine crude product obtained in pyrolosis operation except five methylene diamine, five methylene diamine carbonate, water also containing derive from Methionin or enzymatic decarboxylation reaction in generate impurity etc.The Methionin that the kind of the Methionin used comprises the medical-grade through refining and the lysine solution obtained by the fermentation of glucose, the impurity level contained by it is different.Therefore, according to the difference of the kind of used Methionin, impurity level contained in five methylene diamine crude product is different, total five methylene diamine concentration in five methylene diamine crude product is generally less than 99 % by weight, when the Methionin of some kind, impurity level is many, so total five methylene diamine concentration is also less than 95 % by weight sometimes.Total five methylene diamine herein represents the five methylene diamine of both the five methylene diamine compositions comprised in five methylene diamine and five methylene diamine carbonate.Further, usually, when being denoted as five methylene diamine, represent free five methylene diamine, distinguish with total five methylene diamine and use.
(reducing the method for the impurity in the aqueous solution)
As mentioned above, the five methylene diamine carbonate be obtained by reacting by the LDC of Methionin is usually containing impurity, and this impurity comprises the polymer substances such as the organism with more than 3 functional groups and protein.If carry out the heating of five methylene diamine carbonate aqueous solution, distillation procedure, then causing trouble under the state that such impurity is remaining, such as, high-viscosity material is piled up and is present at the bottom of the tower of distillation tower, and impurity is considered to the reason forming high-viscosity material; Etc..
Therefore, in present embodiment, preferably, at least before distillation process described later, preferably in pyrolosis operation, carry out thermal decomposition process before, make the impurity in five methylene diamine carbonate aqueous solution reduce in advance.
(minimizing has the organic method of more than 3 functional groups)
What exist in five methylene diamine carbonate aqueous solution has in the organism of more than 3 functional groups, and the origin of amino acid such as Methionin are in the microorganism (thalline) of the use with lysine decarboxylase (hereinafter sometimes referred to LDC).Therefore, the biomass used during by being reacted by the LDC of Methionin suppresses in specialized range, can reduce the amino acid such as Methionin.In addition, Methionin until the transformation efficiency of LDC reaction reaches about 100%, can make lysine concentration by carrying out LDC reaction below detectability.
Pass through aforesaid operations, thus in the present embodiment, in the part by weight relative to five methylene diamine contained in the aqueous solution, the organic total content with more than 3 functional groups contained in the aqueous solution of five methylene diamine carbonate is reduced to usual less than 0.01, preferably less than 0.009, further preferably less than 0.008, particularly preferably less than 0.007.
(Transformatin of macromolecule impurity)
For the aqueous solution of the five methylene diamine carbonate used in present embodiment, preferably before the thermal decomposition process of being undertaken by heating, in advance macromolecule impurity contained in the aqueous solution is removed.Particularly when five methylene diamine carbonate be use lysine decarboxylase described later by Methionin or lysine carbonate produce obtain, in aqueous containing such as protein, nucleic acid, polyose etc. as macromolecule impurity.If carry out heat treated under the state in aqueous containing such macromolecule impurity, then can cause the heat transfer reduction etc. of heat treatment apparatus.
Method for removing macromolecule impurity can enumerate following method usually: make macromolecule impurity be adsorbed in the method for interpolation sorbent material in aqueous; Utilize the method etc. of the membrane filtration aqueous solution of the size preset.Wherein, from the view point of simplicity and removal effect, preferably use the method that ultra-filtration membrane (UF film) processes the aqueous solution.
By using UF film to process the aqueous solution, thus be 12, more than 000 by molecular weight contained in the aqueous solution, preferred molecular weight is 5, more than 000, particularly preferably molecular weight be 1, more than 000 macromolecule impurity remove.
The material of UF film can enumerate such as rhodia, polyethersulfone, polysulfones, poly(vinylidene fluoride), polyvinyl benzyl trimethyl ammonium chloride, sodium polystyrene sulfonate, acrylonitrile copolymer, polymeric amide 12 etc.Wherein, preferred acrylonitrile copolymer.
The shape of UF film can enumerate flat film, tubular fibre, plate, pipe, helical coil etc.Wherein, preferred tubular fibre.Further, various UF film module by each sold, from the UF film of easiness preferred module of operation.
(distillation process)
Secondly, distillation process is described.
In distillation process, by five methylene diamine crude product (containing five methylene diamine and the impurity) distillation will obtained by above-mentioned pyrolosis operation, obtain five methylene diamine contained in five methylene diamine crude product.
Preferably before distillation process, the carbonic acid gas produced in pyrolosis operation is got rid of in reactive tank or distillation tower.When carbonic acid gas is got rid of, owing to there is carbonic acid gas at reactive tank or distillation tower top, so carbonic acid gas reacts with the five methylene diamine distilled out, generate five methylene diamine carbonate, be attached to inner wall of tower and cause blocking etc.
In addition, likely five methylene diamine carbonate is being contained by distillation in isolated five methylene diamine, even if the temperature more than the fusing point of five methylene diamine also can be solidified and be difficult to extract out.Now, by adding water distilling in the refining five methylene diamine that obtains, can the aqueous solution be obtained and five methylene diamine can not be made to solidify.Now, total five methylene diamine concentration in the aqueous solution is generally more than 20 % by weight, is preferably more than 30 % by weight, more preferably more than 40 % by weight, and is generally less than 99 % by weight, preferably less than 95 % by weight, more preferably less than 90 % by weight.
As the method removing carbonic acid gas, have by being blown into rare gas element and the method for inert gas atmosphere will be set as in tower.As the kind of rare gas element, nitrogen or argon can be used.Further, by the distillation tower used in the reactive tank used in pyrolosis operation or distillation tower and distillation process is arranged respectively, can prevent from generating five methylene diamine carbonate in distillation process.
Further, compared with the condition of pyrolosis operation, the condition optimization of the temperature and pressure in distillation process is the condition that five methylene diamine carbonate is difficult to decompose.When five methylene diamine carbonate undecomposed and residual in pyrolosis operation occurs to decompose in distillation process, as mentioned above, owing to there is carbonic acid gas on distillation tower top, so generate five methylene diamine carbonate, thus cause solidifying of the five methylene diamine blocking and obtained by distillation.
As mentioned above, if the summation of five methylene diamine and undecomposed and remaining five methylene diamine carbonate is set to 100mol%, then the concentration of contained in aqueous solution during distillation five methylene diamine is generally more than 30mol%, is preferably more than 75mol%, is more preferably more than 85mol%, more preferably more than 90mol%, is especially preferably more than 95mol%, is particularly preferably more than 99mol%.
During distillation, distillation temperature is generally 40 DEG C ~ 300 DEG C, be preferably 50 DEG C ~ 200 DEG C, be more preferably 60 DEG C ~ 180 DEG C, more preferably 70 DEG C ~ 150 DEG C, be particularly preferably 70 DEG C ~ 120 DEG C.Distillation pressure is generally 0.2kPa ~ 1200kPa, is preferably 0.5kPa ~ 800kPa, more preferably 1.0kPa ~ 500kPa.
In addition, likely containing some five methylene diamine carbonate in the refining five methylene diamine obtained by distillation.But, because this carbonate is easy and dicarboxylic acid carries out salt exchange, so the monomer for polyamide resin polymerization can be used as no problemly.
And, the weight of distilling the refining five methylene diamine obtained is different because of the kind of Methionin used, in batch-wise situation, relative to the weight of five methylene diamine crude product, and when continous way, be supplied in the weight of the five methylene diamine crude product of water distilling apparatus relative to the unit time, the weight of refining five methylene diamine is generally less than 99 % by weight, is preferably less than 97 % by weight, more preferably less than 95 % by weight.Further, be generally more than 40 % by weight, be preferably more than 45 % by weight, more preferably more than 50 % by weight.If distillation amount is too much, then, at the bottom of the tower of distillation tower, the high-viscosity material that the enriched material of the reaction product that impurity is formed or impurity is such is piled up, causing trouble.Further, if distillation amount is very few, then in batch-wise situation, involve the reduction of yield in a criminal case, when continous way, production efficiency reduces, so be not preferred.
The recovery of the carbonic acid gas (and re-use)
Secondly, the recovery of the carbonic acid gas generated in the pyrolosis operation of five methylene diamine carbonate and re-using is described.Can carbonic acid gas be used in the arbitrary operation manufactured during five methylene diamine from starting raw material, this is not particularly limited.In present embodiment, particularly preferably obtained the lysine carbonate generation process of lysine carbonate by Methionin and carbonic acid gas, generated the enzymatic decarboxylation reaction process of five methylene diamine carbonate by lysine carbonate.In a rear operation, if enzymatic decarboxylation reaction is carried out, then pH raises, so preferably adjustment pH is neutral, in its pH adjusts, uses carbonic acid gas.
The recovery of carbonic acid gas and the method that re-uses are not particularly limited, after the water conservancy water cooler reclaimed can being separated, the carbonic acid gas of discharge are directly re-used in lysine carbonate generation process or enzymatic decarboxylation reaction process in pyrolosis operation.Now, compressor also can be used to use after carbonic acid gas compression.
(recovery of water re-uses)
And then, the water reclaimed in the pyrolosis operation of the concentrated of five methylene diamine carbonate aqueous solution and five methylene diamine carbonate, the re-using of water of reclaiming in the enrichment process and polycondensation operation of five methylene diamine described later and dicarboxylic acid are described.Being manufactured by starting raw material in the arbitrary operation during five methylene diamine and can both using water, this is not particularly limited.In present embodiment, particularly preferably obtained the lysine carbonate generation process of lysine carbonate by Methionin and carbonic acid gas, produced the enzymatic decarboxylation reaction process of five methylene diamine carbonate by lysine carbonate.
And then, due to heat tracing in the enrichment process of the thermolysis of concentrated, the five methylene diamine carbonate at five methylene diamine carbonate aqueous solution, five methylene diamine and dicarboxylic acid and/or polycondensation operation, so the part likely containing five methylene diamine in the water reclaimed occurs to decompose and the impurity of generation.Although the water of recovery directly can be re-used, re-use after preferably five methylene diamine being decomposed the Impurity removal generated.The minimizing technology of impurity is not particularly limited, the absorption method such as ion-exchange-resin process, activated carbon treatment method can be enumerated, deimpurity method etc. of being made a return journey by the film process of reverse osmosis membrane etc., distillation.
(generation of lysine carbonate, the enzymatic decarboxylation reaction of Methionin)
Secondly, the generation of the lysine carbonate for the preparation of the five methylene diamine carbonate used in present embodiment and the enzymatic decarboxylation reaction of Methionin are described.
In present embodiment, it is the pH that the enzymatic decarboxylation being suitable for Methionin reacts (LDC reaction) that the enzymatic decarboxylation reaction of Methionin such as can add carbonic acid gas on one side to maintain the pH of this solution in the lysine solution that obtains of being dissolved in the water by Methionin, while react, or react under carbon dioxide atmosphere.
Below be described in detail.
Methionin as raw material is preferably free alkali (Methionin alkali, i.e. free lysine) usually.Further, can be the carbonate of Methionin.Methionin can enumerate 1B, D-Lys.Usually, from the easiness obtained, preferred 1B.Further, Methionin can be through refining Methionin, also can for the fermented liquid containing Methionin.
The solvent preparing lysine solution preferably uses water.The pH that can carry out the reaction solution of LDC reaction utilizes carbonic acid gas to regulate, and does not usually use other pH adjusting agent, buffer reagent.In addition, when using such as sodium acetate buffer etc. in the solvent dissolving Methionin, from the aspect forming five methylene diamine carbonate, preferably lysine concentration is suppressed for lower concentration.
When using free lysine, while adding carbonic acid gas in the lysine solution obtained being such as dissolved in water or under carbon dioxide atmosphere, be the pH being suitable for LDC reaction by the pH regulator of reaction solution.Concrete pH is generally more than 4.0, is preferably more than 5.0, and is generally less than 12.0, preferably less than 9.0.Below, sometimes claiming is being operating as " neutralization " of pH being suitable for LDC reaction like this by the pH regulator of reaction solution.In addition, the state that gas phase portion is almost full of with carbonic acid gas is referred under the carbon dioxide atmosphere in the present invention.
During LDC reaction, in order to improve production rate and reaction yield, preferably add vitamin B6.As vitamin B6, pyridoxol, Pyridoxylamine, pyridoxal, pyridoxal phosphate etc. can be enumerated.Wherein, preferably phosphoric acid pyridoxal.The addition means of vitamin B6, interpolation are not particularly limited period, are suitable for being added in LDC reaction.
By in as above and lysine solution in add lysine decarboxylase (LDC), carry out LDC reaction.As LDC, as long as act on Methionin, generate five methylene diamine, be just not particularly limited.As LDC, the cells such as refining enzyme, the microorganism producing LDC, vegetable cell or zooblast can be enumerated.Two or more kinds may be used for the cell of LDC or generation LDC.Further, directly can use cell, also can use the cell handled thing containing LDC.As cell handled thing, cytoclasis liquid or its fraction can be enumerated.
As the microorganism producing LDC, the eukaryotic cells such as the bacteriums such as Serratia bacteria such as Bacillus species, serratia marcescens (Serratiamarcescens), cereuisiae fermentum (Saccharomycescerevisiae) such as the bar shaped bacteria such as the Escherichia bacteria such as colon bacillus (E.coli), Brevibacterium lactofermentus (Brevibacteriumlactofermentum), Bacillus subtilus (Bacillussubtilis) can be enumerated.Preferred bacterium in these, particularly preferably E.coli.
As long as above-mentioned microorganism produces LDC, can be wild strain, also can be variant.Further, also can for the recombinant strain raised to make LDC activity through transformation.Vegetable cell or zooblast also can use the reconstitution cell raised to make LDC activity through transformation.Detailed content is recorded in such as No. 2008-4759, Japanese Patent Application.
In LDC reaction, in lysine solution, add LDC initiation reaction.After reaction starts, discharged from reaction solution from the Methionin carbonic acid gas that dissociates with the carrying out of reaction, pH is raised.Therefore, carbonic acid gas is added in (being blown into) reaction solution, is suitable for the scope of the pH of LDC reaction to make the pH of reaction solution reach.Carbonic acid gas can be added in reaction solution continuously, also can portion-wise addition.Further, also can by under carbon dioxide atmosphere, be arranged to the carbonic acid gas that the modes such as enclosed system dissociating from Methionin and be used for pH adjustment.The temperature of reaction of LDC reaction is not particularly limited, is generally more than 20 DEG C, is preferably more than 30 DEG C, and be generally less than 60 DEG C, preferably less than 40 DEG C.
In addition, raw material Methionin full dose can be added in reaction solution when reacting beginning, also can according to the progress portion-wise addition of LDC reaction.
When carrying out LDC reaction, in reaction solution, easily can add carbonic acid gas in batches.Further, also can be reacted by moving-bed column chromatography, this moving-bed column chromatography comprises and is fixed with LDC, produces the cell of LDC or the carrier of its handled thing.Now, the suitable position of Methionin and carbon dioxide injection post is reacted to make the pH of reaction system maintain in predetermined scope.
Further, also can not carry out the interpolation of carbonic acid gas, be used for neutralization by being reacted all or part of released carbonic acid gas by LDC.
The pH raised by using carbonic acid gas successively to neutralize the generation with five methylene diamine as mentioned above, thus LDC reaction is carried out well.To be reacted by LDC and the five methylene diamine generated is accumulated in reaction solution with the form of dicovalent carbon hydrochlorate or monovalence supercarbonate.
(polyamide resin)
Below, be described the manufacture method of polyamide resin, the manufacture method of this polyamide resin uses the five methylene diamine and dicarboxylic acid that are obtained by above-mentioned five methylene diamine carbonate as monomer component.
In present embodiment, using the five methylene diamine that obtained by five methylene diamine carbonate and dicarboxylic acid as monomer component, use polycondensation catalyst, manufacture polyamide resin by polycondensation.
For the polycondensation with five methylene diamine, can enumerate as the concrete example of the dicarboxylic acid of monomer component, the aliphatic dicarboxylic acids such as such as oxalic acid, propanedioic acid, succsinic acid, pentanedioic acid, hexanodioic acid, pimelic acid, suberic acid, nonane diacid, sebacic acid, undecane diacid, dodecanedioic acid, undecane dicarboxylic acid, tetradecane diacid, pentadecane diacid, Thapsic acid, heptadecane diacid, octadecane diacid, nonadecen diacid, octadecane dicarboxylic acid; The ester ring type dicarboxylic acid such as cyclohexane dicarboxylic acid; The aromatic dicarboxylic acids such as phthalic acid, m-phthalic acid, terephthalic acid, naphthalene dicarboxylic acids.
In these dicarboxylic acid, preferred aliphat dicarboxylic acid, particularly preferably hexanodioic acid.Further, when using hexanodioic acid as dicarboxylic acid, the concentration of the hexanodioic acid in dicarboxylic acid is generally more than 90 % by weight, is preferably more than 95 % by weight, more preferably 100 % by weight.
And then, do not damaging the degree of the effect obtained by the present invention, other monomer components can used.As other such monomer components, the amino acid such as such as 6-aminocaprolc acid, 11-aminoundecanoic acid, amino 12 (alkane) the sour PAMBA of 12-can be enumerated, the lactan such as ε-caprolactam, omega-lauric lactam, quadrol, 1, 3-diaminopropanes, 1, 4-diaminobutane, 1, 6-diamino hexane, 1, 7-diaminoheptane, 1, 8-diamino-octane, 1, 9-diamino nonane, 1, 10-diamino decane, 1, 11-diamino undecane, 1, 12-diamino dodecane, 1, 13-diamino tridecane, 1, the 14-diamino tetradecane, 1, 15-diamino pentadecane, 1, 16-diamino n-Hexadecane, 1, 17-diamino heptadecane, 1, 18-diamino octadecane, 1, 19-diamino nonadecane, 1, 20-diamino eicosane, 2-methyl isophthalic acid, the aliphatie diamines such as 5-1,5-DAP, the ester ring type diamines such as cyclohexane diamine, two-(4-Aminohexyl) methane, the aromatic diamines such as benzene dimethylamine.Also these monomer components two or more can be share.
(polycondensation method)
In present embodiment, the polycondensation method of five methylene diamine and dicarboxylic acid is not particularly limited, can be suitable for selecting from existing known method.Further, polycondensation catalyst can be suitable for choice for use from existing known polycondensation catalyst, and there is no particular limitation as to it.As the manufacture method of general polyamide resin, be disclosed in such as in " Port リ ァ ミ De Trees fat Ha Application De Block ッ Network " (Nikkan Kogyo Shimbun: Fu Benxiu compile, 1987 annual versions) etc.
As an example of polycondensation method, can enumerate and such as add thermal polycondensation process by what carry out dehydration reaction at high temperature under high pressure containing five methylene diamine and dicarboxyl aqueous acid., add in thermal polycondensation process herein, the top temperature of polycondensation is more than 200 DEG C, is preferably more than 220 DEG C, is generally less than 300 DEG C.Polycondensation mode is not particularly limited, batch-type or continuous mode can be adopted.
It should be noted that, by by by adding polyamide resin that thermal polycondensation process obtains in such as vacuum or in rare gas element with the heating temperatures of less than more than 100 DEG C to fusing point, the molecular weight (solid state polymerization) of polyamide resin can be increased.
Further, can enumerate: make the method that rudimentary condenses (oligopolymer) polymer that five methylene diamine and dicarboxylic acid polycondensation obtain under High Temperature High Pressure quantizes; Aqueous solution five methylene diamine being dissolved obtain with dicarboxylate or dicarboxylic acid dihalide be dissolved in the solution obtained in aqueous solvent or organic solvent contact, carry out the interface polycondensation etc. of polycondensation at their interface.
In addition, in present embodiment, before polycondensation, also can insert the enrichment process containing five methylene diamine and dicarboxyl aqueous acid.By inserting enrichment process, the shortening of above-mentioned polycondensation time can be realized.In enrichment process, usually at 140 DEG C ~ 160 DEG C, the concentration that is preferably concentrated into the salt of five methylene diamine and dicarboxylic acid is under elevated pressure 70 % by weight ~ 90 % by weight, and do not make salting out of five methylene diamine and dicarboxylic acid.
In present embodiment, the molecular weight of the polyamide resin that the polycondensation by five methylene diamine and dicarboxylic acid obtains is not particularly limited, can selects according to object is suitable.From the view point of practicality, usually, the lower limit of the relative viscosity of 98% sulphuric acid soln (polyamide resin lipid concentration: 0.01g/mL) of 25 DEG C of polyamide resin is generally 1.5, is preferably 1.8, is particularly preferably 2.2, and the upper limit is generally 8.0, is preferably 5.5, is particularly preferably 3.5.If relative viscosity is too small, then there is the tendency that can not get practical intensity.If relative viscosity is excessive, then the mobility of polyamide resin reduces, and has the tendency that molding processibility is impaired.
(additive)
Various additive can be mixed as required in the polyamide resin that present embodiment is suitable for.As additive, such as antioxidant, thermo-stabilizer, weather resisting agent, release agent, lubricant, pigment, dyestuff, crystallization nucleating agent, softening agent, static inhibitor, fire retardant, weighting agent, other polycondensates etc. can be enumerated.
Specifically, as antioxidant or thermo-stabilizer, hindered phenol based compound, Resorcinol based compound, phosphorous acid ester based compound and their substituent etc. can be enumerated.
As weather resisting agent, Resorcinol based compound, salicylate based compound, benzotriazole based compound, benzophenone based compound, hindered amine based compound etc. can be enumerated.
As release agent or lubricant, fatty alcohol, aliphatic amide, aliphatics bisamide, allophanamide, polyethylene wax etc. can be enumerated.
As pigment, Cadmium Sulfide, phthalocyanine, carbon black etc. can be enumerated.As dyestuff, nigrosine, nigrosine etc. can be enumerated.
As crystallization nucleating agent, talcum, silicon-dioxide, kaolin, clay etc. can be enumerated.As softening agent, P-hydroxybenzoic acid monooctyl ester, N-butylbenzenesulfonamide etc. can be enumerated.
As static inhibitor, nonionic system static inhibitor, the trimethyl-glycine system both sexes static inhibitor etc. such as alkyl sulphate type negatively charged ion system static inhibitor, quaternary ammonium salt cationic system static inhibitor, Tween-60 can be enumerated.
As fire retardant, the combination etc. of melamine cyanurate, oxyhydroxide (such as magnesium hydroxide, aluminium hydroxide etc.), ammonium polyphosphate, brominated Polystyrene, brominated polyphenylether, brominated polycarbonate, brominated epoxy resin or these bromide fire retardants and ANTIMONY TRIOXIDE SB 203 99.8 PCT can be enumerated.
As weighting agent, particulate state, needle-like, the tabular packing materials such as glass fibre, carbon fiber, carbon black, graphite, barium sulfate, magnesium sulfate, calcium carbonate, magnesiumcarbonate, weisspiessglanz, titanium dioxide, aluminum oxide, zinc oxide, ferric oxide, zinc sulphide, zinc, lead, nickel, aluminium, copper, iron, stainless steel, wilkinite, polynite, synthetic mica can be enumerated.
As other polycondensates, other polymeric amide, polyethylene, polypropylene, polyester, polycarbonate, polyphenylene oxide, polyphenylene sulfide, liquid crystalline polymers, polysulfones, polyethersulfone, ABS resin, AS resin, polystyrene etc. can be enumerated.
In the operation manufacturing polyamide resin, the suitable addition of these materials, the interpolation operation etc. selected carries out adding.
In present embodiment, in the polycondensation of polyamide resin to shaping any stage, additive and strongthener can be blended in polyamide resin.Wherein, preferably polyamide resin and additive and strongthener are dropped in forcing machine, melting mixing is carried out to them, thus prepares Amilan polyamide resin composition.
Further, the arbitrary forming methods such as injection molding, film are shaping, melt-spinning, blow molding, vacuum forming can be utilized, the polyamide resin of present embodiment is shaped to desired shape.As products formed, such as injection-molded article, film, sheet material, silk, sharpening brushing, fiber etc. can be enumerated.Further, polyamide resin also can be used in joint compound, coating etc.
And then, for the concrete purposes example of the polyamide resin of present embodiment, as automobile-vehicle associated components, such as intake manifold can be enumerated, with gemel folder (door assembly with hinge and glass in right hand and left products formed), bundling article, resonator, air filter, engine shield, rocker cover, cylinder cover hood, timing gear (timingbeltcover) with cover, pneumatic thickener, secondary pneumatic thickener, radiator tank, side cooler, oil tank (oilreservoirtank), food tray, electric direction varying device, oil filter, respirator, engine support, terminal box, relay box, connector, corrugated tube, the automobile railway carriage or compartment inner parts such as protector, the automobile exterior member such as automobile door pull handle, mud guard, bonnet protuberance (hoodbulge), roof stick carline, driving mirror bracket, safety lever, spoiler, wheel cover, the in-built component for automobile such as saucer, supervisory control desk box (ConsoleBox), accelerator pedal, clutch pedal, shift lever bracket, gear shift lever knob.
And, the polyamide resin of present embodiment can be used in fishing line, the fishery relevant supplies equipment such as fishing net, Switch, subminiature slide switch, DIP switch, switch capsule, lamp socket, bundling article, connector, connector box, connector housings, IC socket class, coil pipe, coiling barrel cover, rly., relay1 box, condenser casing, the internal part of motor, mini motor casing, gear cam, dancing pulley, spacer, isolator, little horn ring, terminal board, the shell of power tool, the insulated part of trigger, fuse unit, the shell of terminal, bearing retainer, speaker diaphragm, thermally resistant container, microwave oven component, electric cooker parts, the electric and electronic associated components that printer color tape guide plate etc. are representative, family office electric product parts, computer associated components, facsimile recorder duplicating machine associated components, the various uses such as machinery associated components.
Embodiment
Below provide embodiment, more specifically the present invention is described, but the present invention is not by the restriction of the record of these embodiments.The physical property measurement method of the sample used in embodiment and comparative example etc. and the preparation method of sample as described below.
(1) measuring method of five methylene diamine concentration
Each concentration of the total five methylene diamine in each sample, five methylene diamine, five methylene diamine carbonate uses automatic titration device (society of Mitsubishi Chemical manufactures GT-100), passes through titration determination.
During mensuration, take sample, make the amount of the total five methylene diamine in sample be 0.2g ~ 1.0g, and with after deionized water dilution, carry out titration with the 1mol/LHCl aqueous solution (manufacture of KishidaChemical society).
Five methylene diamine concentration is obtained by following method of calculation based on measurement result.
In the result of titration determination, during existence 3 stoichiometric points (with reference to Fig. 1 (a)), the stoichiometric point that the neutralization that this stoichiometric point is the ion shown in table 1, salt exchange.When the HCl titer of the 2nd stoichiometric point is set to xmL, the HCl titer of the 3rd stoichiometric point is set to ymL, respective ionic concn is as shown in (formula 1) ~ (formula 3).It should be noted that, the molecular weight of five methylene diamine is set to 102.18, the molecular weight of five methylene diamine carbonate is set to 164.21, the weight of sample is set to ag, the factor of the 1mol/LHCl aqueous solution is set to f.Herein, HCl uses the volumetry reagent that Wako Pure Chemical Industries, Ltd. manufactures.Further, factor f is the correction value that reagent place records, and it is the ratio of the equivalent concentration that the true equivalent concentration calculated by back titration etc. is calculated relative to weighing scale when being prepared by reagent.
Total five methylene diamine concentration (% by weight):
{ y ÷ 1000 × f} ÷ 2 × 102.18 ÷ a × 100 (formula 1)
Five methylene diamine concentration (% by weight):
[{ x-(y-x) } ÷ 1000 × f] ÷ 2 × 102.18 ÷ a × 100 (formula 2)
Five methylene diamine carbonate concentration (% by weight):
{ ÷ a × 100, (y-x) ÷ 1000 × f} × 164.21 (formula 3)
Table 1
In the result of titration determination, when stoichiometric point is 1 (with reference to Fig. 1 (b)), this stoichiometric point is the stoichiometric point of five methylene diamine, not containing carbonate in sample.When the HCl titer at stoichiometric point place is set to zmL, five methylene diamine concentration is as shown in (formula 4).In addition, the molecular weight of five methylene diamine is set to 102.18, the weight of sample is set to ag, the factor of the 1mol/LHCl aqueous solution is set as f.
Total five methylene diamine concentration (% by weight):
{ z ÷ 1000 × f} ÷ 2 × 102.18 ÷ a × 100 (formula 4)
(2) amino acid analysis
Use Hitachi's amino acidanalyser (Hitachi high-speed amino acid analyzer L-8900), carry out the amino acid analysis such as Methionin, ornithine.First, weigh appropriate sample solution, after dilute with water, carry out ultrafiltration (MicrocomYM-10), using filtrate as analytical sample.Analysis condition adopts organism separation for amino acids condition, and analytical method adopts ninhydrin (wavelength: 570nm, 440nm).The amino-acid mixed standardization liquid ANII type that standard substance use diluted and Guang Chun medicine society to manufacture and Type B, be set as 10 μ L by sample injection rate.As quantitative Analysis, utilize one point external standard method, proline(Pro) by the peak area of 570nm, calculates aminoacids content by the peak area of 440nm, other amino acid.
(3) measuring method of YI (YellownessIndex (yellowness index)) value
Refining five methylene diamine and five methylene diamine carbonate are sampled respectively.Deionized water and hexanodioic acid is added, the five methylene diamine hexanodioic acid aqueous solution of preparation 50 % by weight in above-mentioned refining five methylene diamine.In above-mentioned five methylene diamine carbonate, add deionized water and hexanodioic acid, exchanged by salt and carry out decarboxylation, prepare the five methylene diamine hexanodioic acid aqueous solution of 50 % by weight simultaneously.Then, use MINOLTASPECTROPHOTOMETERCM-3700d, carry out school zero, the white correction of determining instrument with light source C, 2 °, the visual field.Then, in CellCM-A98 (optical length 10mm), add the five methylene diamine adipate aqueous solution of above-mentioned 50 % by weight, carry out the mensuration of X, Y, Z, by measured value according to JISK7373 standard test YI value.
(4) measuring method of the relative viscosity (η rel) of polyamide resin
The sample of polyamide resin is obtained by the polycondensation between the five methylene diamine that reclaims from five methylene diamine carbonate aqueous solution and hexanodioic acid, by the sample dissolution of obtained polyamide resin in the vitriol oil of 98 % by weight, be prepared into the sample solution that concentration is 0.01g/mL.Then, use Ostwald's formula viscometer, measure the elution time t of sample solution and the elution time t of the vitriol oil of 25 DEG C respectively 0, by (t/t 0) as relative viscosity (η rel).
(5) measuring method of the fusing point (Tm) of polyamide resin
Use differential scanning calorimeter (RobotDSC that DSC:SEIKO electronic industry society manufactures), measure the fusing point (Tm) of polyamide resin in a nitrogen atmosphere.About 5mg polyamide resin sample is melted completely, keeps after 3 minutes, be reduced to 30 DEG C with the cooling rate of 20 DEG C/min.Then, polyamide resin sample is kept 3 minutes in 30 DEG C, observe when then heating up from 30 DEG C with the heat-up rate of 20 DEG C/min, observed endotherm peak temperature is measured as fusing point Tm.When endotherm(ic)peak is more than 2, take top temperature as fusing point Tm.
(6) preparation of five methylene diamine carbonate aqueous solution
(A) LDC gene (cadA) strengthens the making of strain
A () e. coli dna extracts:
Intestinal bacteria (Eschericiacoli) JM109 strain is cultured to the logarithmic proliferation after date phase in 10mLLB (Luria-Bertani) substratum (composition: 10g Tryptones, 5g yeast extract and 5gNaCl are dissolved in 1L distilled water), obtained thalline is suspended in 10mMNaCl/20mMTris damping fluid (tris buffer) (the pH8.0)/1mMEDTA2Na solution 0.15mL containing 10mg/mL N,O-Diacetylmuramidase.
Next, in above-mentioned suspension, add Proteinase K make its ultimate density be 100 μ g/mL, in 37 DEG C of insulations 1 hour.Further interpolation sodium lauryl sulphate also makes its ultimate density be 0.5 % by weight, in 50 DEG C of insulations 6 hours, prepares lysate.
Secondly, (phenol/trichloromethane (volume ratio 1: 1)) solution of equivalent is added in this lysate, after room temperature is slowly vibrated 10 minutes, all carry out centrifugation (5,000 × g, 20 minutes, 10 ~ 12 DEG C), divide and get supernatant fraction, after adding sodium acetate to 0.3M, the ethanol adding 2 times amount mixes.Next, the throw out that will be reclaimed by centrifugation (15,000 × g, 2 minutes) is with after 70 % by weight aqueous ethanolic solution cleanings, air-dry.In obtained DNA, add 10mMTris damping fluid (pH7.5)/1mMEDTA2Na solution 5mL, leave standstill a night, for the template DNA of PCR described later (polymerase chain reaction) at 4 DEG C.
The clone of (b) cadA:
The acquisition of intestinal bacteria cadA is undertaken by following PCR, and described PCR for template, employs synthetic DNA (sequence numbering 1 (sequence with the DNA of preparation in above-mentioned (a); And sequence numbering 2 (sequence GTTGCGTGTTCTGCTTCATCGCGCTGATG); ACCAAGCTGATGGGTGAGATAGAGAATGAGTAAG)), described synthetic DNA be this gene of e. coli k12-MG1655 strain to report whole genome sequence sequence (GenbankDatabaseAccessionNo.U00096) based on design.
(reaction solution composition)
By 1 μ L template DNA, 0.2 μ LPfxDNA polysaccharase (manufacture of Invitrogen society), damping fluid (1 times of concentration) (manufacture of Invitrogen society), the above-mentioned synthetic DNA (sequence numbering 1 (omission sequence) and sequence numbering 2 (omission sequence)) of 0.3 μM, the MgSO of 1mM 4deoxynucleoside triphosphate (dATP, dCTP, dGTP and dTTP) mixing with 0.25 μM, makes total amount be 20 μ L.
(temperature of reaction condition)
As DNA thermal cycler, " PTC-200 " that use MJResearch society to manufacture, carries out 35 times repeatedly by the circulation formed for 2.5 minutes at at 94 DEG C 20 seconds, 60 DEG C 20 seconds and 72 DEG C.Just the insulation at the 1st 94 DEG C of circulating is set as 1 minute 20 seconds, the insulation at 72 DEG C of last circulation is set as 10 minutes.
Fig. 2 is the figure of the process that clone cadA is described.
As shown in Figure 2, PCR is refined amplified production by alcohol settling after stopping, and then cuts off with restriction enzyme KpnI and restriction enzyme SphI.After these DNA standard substance being separated by 0.75 % by weight agarose (manufacture of SeaKemGTGagarose:FMCBioProducts society) gel electrophoresis, come visual by ethidium bromide staining, detect the fragment of the about 2.6kb containing cadA thus, use QIAQuickGelExtractionKit (manufacture of QIAGEN society) to reclaim target DNA fragments.
The DNA fragmentation obtained is regulated to mix with cutting off e. coli plasmid vector pUC18 (Bao Jiuzao society manufactures) with restriction enzyme KpnI and restriction enzyme SphI the DNA fragmentation reclaimed, use after connecting test kit ver.2 (manufacture of Bao Jiuzao society) connection, with the plasmid DNA transformation intestinal bacteria (JM109 strain) obtained.The recombination bacillus coli obtained like this is spread upon on LB (Luria-Bertani) nutrient agar containing 50 μ g/mL penbritins, 0.2mMIPTG (isopropyl-β-D-thiogalactoside(IPTG)) and 50 μ g/mLX-Gal.
Utilize ordinary method that the clone being formed with white colony on this substratum is carried out liquid culture, then plasmid DNA is refined.Confirming, by being cut off by obtained plasmid DNA restriction enzyme KpnI and restriction enzyme SphI, the Insert Fragment of about 2.5kb can be found, and by this plasmid DNA called after pCAD1, by the e. coli strains called after JM109/pCAD1 containing pCAD1.
(B) preparation of five methylene diamine carbonate aqueous solution
Use JM109/pCAD1, using the lysine carbonate aqueous solution as raw material, in order to below legal system for five methylene diamine carbonate aqueous solution used in embodiment.
The cultivation of (a) JM109/pCAD1:
After cultivating before JM109/pCAD1 is carried out in the flask filling LB substratum, the nutrient solution of 3mL is seeded in the flask of the 1L volume of the LB substratum of the 2 times of concentration filling 100mL, carries out stir culture in 35 DEG C with 250rpm.Cultivate and add the IPTG (isopropyl-β-D-thiogalactoside(IPTG)) through sterilizing and make its ultimate density be 0.5mM for after starting the 4th hour, continue cultivation 14 hours thereafter.
The separation of (b) thalline and preservation:
With 8000rpm, medium centrifugal is separated 10 minutes, discarded supernatant, reclaims thalline.To suspend the wet thallus obtained with 50mM sodium acetate buffer (damping fluid), the sodium acetate buffer used is 1/20 of nutrient solution volume, in time carrying out being saved to reaction needed for 4 DEG C.
(c) five methylene diamine carbonate aqueous solution (i)
50% (w/v) lysine solution (consonance fermenting organism society manufactures) 48kg and deionized water 30L is prepared in the reactive tank of 200L volume, pass into carbonic acid gas to add carbonic acid gas with 15L/min, be prepared into the lysine carbonate aqueous solution.The pH of lysine solution is at first near 10.3, and with the supply of carbonic acid gas, pH oxytropism side reduces.Supply carbonic acid gas is stopped when pH is almost constant.PH is now about 7.5.
Being added by pyridoxal phosphate in above-mentioned substrate solution to concentration is 0.1mM, then the thalline adding JM109/pCAD1 reaches 0.5 to OD660 (OpiticalDensitiy660), starts reaction.
Condition during reaction is set as temperature 37 DEG C, obstructed gas (0vvm), mixing speed 148rpm.During reaction, reactive tank is set as enclosed system, seals the carbonic acid gas of generation up for safekeeping, regulate pH.Reaction beginning is after 5 hours, and almost the Methionin of 100% is converted into five methylene diamine.Reacted solution (about 72L) carries out the inactivation treatment (70 DEG C, 20 minutes) of thalline.By above operation, prepare five methylene diamine carbonate aqueous solution (i).
The organic total content with more than 3 functional groups contained as impurity in five methylene diamine carbonate aqueous solution (i) counting 0.0063 relative to the part by weight of five methylene diamine (Methionin 0.0053, ornithine 0.0004 and other 0.0006).
(d) five methylene diamine carbonate aqueous solution (ii)
UF film module (ACP-0013 that industry society of Asahi Chemical Industry manufactures) is used to process five methylene diamine carbonate aqueous solution (i) prepared by aforesaid operations, prepare and eliminate the five methylene diamine carbonate aqueous solution (ii) that molecular weight is the high molecular body impurity of 12, more than 000.The rate of recovery of UF film process is 99.4%.The rate of recovery of UF film process represents the yield of five methylene diamine.
The organic total content with more than 3 functional groups contained as impurity in five methylene diamine carbonate aqueous solution (ii) counting 0.0063 relative to the part by weight of five methylene diamine (Methionin 0.0053, ornithine 0.0004 and other 0.0006).
(e) five methylene diamine carbonate aqueous solution (iii)
Above-mentioned five methylene diamine carbonate aqueous solution (ii) 5600g (total five methylene diamine concentration 18.7 % by weight) is added in flask, under the condition of interior temperature 102 DEG C (oil bath temperature 139 DEG C), normal pressure while recycle-water, start pyrolosis operation, resolve into five methylene diamine crude product and carbonic acid gas.Decompose after starting, pressure is remained on normal pressure, slowly raised temperature, in finally, temperature reaches the moment stopping decomposition of 180 DEG C (oil bath temperatures 191 DEG C).
The water 0.40L preparing 50% (w/v) lysine solution 0.60kg and reclaimed by the decomposition process of above-mentioned five methylene diamine carbonate aqueous solution in the reactive tank of 3L volume.Then, pass into the carbon dioxide that reclaimed by the decomposition process of above-mentioned five methylene diamine carbonate aqueous solution and add carbonic acid gas, preparing the lysine carbonate aqueous solution.The pH of lysine solution is at first near 10.2, and along with the supply of carbonic acid gas, pH oxytropism side reduces.Supply carbonic acid gas is stopped when pH is almost constant.PH is now about 7.5.
In above-mentioned substrate solution, adding pyridoxal phosphate to concentration is 0.1mM, then the thalline adding JM109/pCAD1 reaches 0.5 to OD660, starts reaction.Condition during reaction is set as temperature 37 DEG C, mixing speed 500rpm, and utilizing the carbonic acid gas reclaimed by the decomposition process of above-mentioned five methylene diamine carbonate aqueous solution to make is carbon dioxide atmosphere in reactive tank, keeps pH constant.In reaction, the water 0.35L add 50% (w/v) lysine solution 0.60kg, being reclaimed by the decomposition process of above-mentioned five methylene diamine carbonate aqueous solution, the thalline of pyridoxal phosphate 0.1mM and JM109/pCAD1 reach 0.5 to OD660 (OpticalDensity660), continue reaction.Add lysine solution after 5 hours, almost the Methionin of 100% is converted into five methylene diamine.
Reacted solution is carried out to the inactivation treatment (70 DEG C, 20 minutes) of thalline, re-use the process of UF film module, be prepared into and eliminate the five methylene diamine carbonate aqueous solution (iii) that molecular weight is the high molecular body impurity of 12, more than 000.The yield of the five methylene diamine of the aqueous solution reclaimed by the process of UF film is 99.4%.
(f) five methylene diamine carbonate aqueous solution (iv)
When preparing above-mentioned five methylene diamine carbonate aqueous solution (iii), the five methylene diamine crude product that decomposition by above-mentioned five methylene diamine carbonate aqueous solution (ii) obtains is distilled under the condition of interior temperature 80 DEG C (oil bath temperature 110 DEG C), pressure 2.67kPa, isolates refining five methylene diamine.
Add deionized water 797.3g in the refining five methylene diamine obtained (five methylene diamine concentration is 99.2 % by weight) 331.8g after, add hexanodioic acid (manufacture of Honshu chemical industry society) 470.8g.Secondly, be heated to 70 DEG C, after mixture is dissolved completely, add a small amount of refining five methylene diamine, pH is adjusted to 8.4.After pH adjustment, add previously prepared 0.2 % by weight phosphorous acid aqueous solution 20.0g (using phosphorous acid (Wako Pure Chemical Industries, Ltd. manufactures, and reagent is superfine)) as polycondensation catalyst, for the preparation of the aqueous solution of raw material of polycondensation.Then, above-mentioned raw materials aqueous solution 1500g is added in autoclave, carries out nitrogen replacement.Thereafter, the temperature in autoclave is set as 142 DEG C, interior pressure is start to concentrate under 0.20MPaG condition, and being concentrated into interior temperature is 152 DEG C, reclaims the water distilled.Next, close autoclave, interior temperature raised at leisure, the temperature in autoclave is set as 268 DEG C, in be installed with and be decided to be 1.57MPaG.Then, slowly after release, be slowly decompressed to 61.3kPa, carry out the polycondensation of five methylene diamine and hexanodioic acid.Further, the water distilled is reclaimed.
The water 0.40L prepare 50% (w/v) lysine solution 0.60kg in the reactive tank of 3L volume, reclaiming in the polycondensation of the concentrated of the above-mentioned raw materials aqueous solution and above-mentioned five methylene diamine and hexanodioic acid, pass into carbonic acid gas with 2L/min, be prepared into the lysine carbonate aqueous solution.The pH of lysine solution is at first near 10.0, and along with the supply of carbonic acid gas, pH oxytropism side reduces.Supply carbonic acid gas is stopped when pH is almost constant.PH is now about 7.5.
In substrate solution, adding pyridoxal phosphate to concentration is 0.1mM, then the thalline adding JM109/pCAD1 reaches 0.5 to OD660, starts reaction.Condition during reaction is set as temperature 37 DEG C, obstructed gas (0vvm), mixing speed 500rpm.In reaction, add 50% (w/v) lysine solution 0.60kg, the water 0.35L reclaimed in the polycondensation of the concentrated of the above-mentioned raw materials aqueous solution and above-mentioned five methylene diamine and hexanodioic acid, the thalline of pyridoxal phosphate 0.1mM and JM109/pCAD1 reaches 0.5 to OD660 (OpticalDensity660), continue to react.Reaction beginning is after 5 hours, and almost the Methionin of 100% is converted into five methylene diamine.During reaction, capping groove, by enclosing the carbonic acid gas that reaction produces, regulates pH.Add lysine solution after 5 hours, almost the Methionin of 100% is converted into five methylene diamine.
Reacted solution is carried out to the inactivation treatment (70 DEG C, 20 minutes) of thalline, re-use the process of UF film module, be prepared into and eliminate the five methylene diamine carbonate aqueous solution (iv) that molecular weight is the high molecular body impurity of 12, more than 000.The yield of the five methylene diamine of the aqueous solution reclaimed by the process of UF film is 99.4%.
(embodiment 1)
< five methylene diamine refining and be separated >
(pyrolosis operation)
Above-mentioned five methylene diamine carbonate aqueous solution (ii) 5600g (total five methylene diamine concentration 18.7 % by weight) is added in flask, under the condition of interior temperature 102 DEG C (oil bath temperature 139 DEG C), normal pressure, start while recycle-water to be decomposed into five methylene diamine crude product and carbonic acid gas.Decompose after starting, remain on normal pressure, simultaneously raised temperature at leisure, the moment that temperature reaches 180 DEG C (oil bath temperatures 191 DEG C) in final stops decomposition, obtains five methylene diamine crude product.It should be noted that, the top temperature of pyrolosis operation is 180 DEG C.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the five methylene diamine crude product obtained measure based on above-mentioned measuring method, and concentration is respectively 95.5 % by weight, 93.5 % by weight, 3.2 % by weight.According to this measurement result, in five methylene diamine crude product, relative to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 98.0mol%.
(distillation process)
Then, the five methylene diamine crude product obtained by aforesaid operations is distilled under the condition of interior temperature 80 DEG C (oil bath temperature 110 DEG C), pressure 2.67kPa, obtains refining five methylene diamine 924g (purity: 99.2 % by weight).Yield is 87.6%.Further, by the method same with aftermentioned enrichment process, the preparation 50 % by weight five methylene diamine adipate aqueous solution, the measuring method according to above-mentioned YI measures YI, and its result, YI value is 0.2.
It should be noted that, yield is that the numerical value of use table 2 is calculated by following (formula 5).And, for the concentration (mol%) of the five methylene diamine under the pyrolosis operation condition of table 2 and table 3, use the five methylene diamine concentration (% by weight) by above-mentioned titration determination and five methylene diamine carbonate concentration (% by weight), the summation of five methylene diamine and five methylene diamine carbonate is set to 100mol%, is calculated the concentration (mol%) of five methylene diamine by following (formula 6).
(refining five methylene diamine gross weight × total five methylene diamine concentration ÷ 100) ÷ (raw material gross weight × total five methylene diamine concentration ÷ 100) × 100 (formulas 5)
(five methylene diamine concentration (% by weight) ÷ 102.18) ÷ ((five methylene diamine concentration (% by weight) ÷ 102.18)+(five methylene diamine carbonate concentration (% by weight) ÷ 164.21)) × 100 (formulas 6)
(enrichment process)
In the refining five methylene diamine 331.8g obtained by aforesaid operations (purity: add deionized water 797.3g 99.2 % by weight), then add hexanodioic acid 470.8g.Next, be heated to 70 DEG C, after mixture is dissolved completely, add a small amount of refining five methylene diamine, pH is adjusted to 8.4.After pH adjustment, add previously prepared 0.2 % by weight phosphorous acid aqueous solution 20.0g as polycondensation catalyst, be prepared into the aqueous solution of raw material for polycondensation.
Then, above-mentioned raw materials aqueous solution 1500g is added in autoclave, carries out nitrogen replacement.Then, the temperature in autoclave is 142 DEG C, interior pressure is start to concentrate under the condition of 0.20MPaG, and continuous concentration, until interior temperature is 152 DEG C, reclaims the water distilled out.
(polycondensation operation)
Next, close autoclave, interior temperature slowly raised, the temperature in autoclave is set as 268 DEG C, in be installed with and be decided to be 1.57MPaG.Then, at leisure after release, be decompressed to 61.3kPa at leisure, carry out the polycondensation of five methylene diamine and hexanodioic acid.Further, the water distilled out is reclaimed.
Content is made line material shape after stopping by polycondensation, in the sink after cooling, makes particle with moving rotary cuber.With 120 DEG C, the particle that obtains of the condition of 0.13kPa drying until water ratio is less than 0.1 % by weight, obtain polyamide resin.Relative viscosity (the η of the polyamide resin obtained rel) be 3.3, fusing point (Tm) is 255 DEG C.The results are shown in table 2.
The evaluation result of the reaction conditions listed in the respective each operation of embodiment 1 ~ 10, comparative example 1 and comparative example 2, its result and polyamide resin etc. is gathered in table 2 and table 3.
In addition, in table 2 and table 3, "-" represents and does not implement or do not measure.
Further, in table 2 and table 3, " 56 " of " kind of polyamide resin " represent nylon 56, and " 510 " represent nylon 510, and " 512 " represent nylon 512.
(embodiment 2)
(pyrolosis operation and distillation process)
In pyrolosis operation, while be blown into nitrogen to gas phase, while carry out the decomposition of five methylene diamine carbonate aqueous solution (ii), carry out the operation identical with embodiment 1 in addition, obtain refining five methylene diamine 959g (purity: 99.4 % by weight).Yield is 91.0%.In addition, the top temperature of the interior temperature of pyrolosis operation is 180 DEG C.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the five methylene diamine crude product obtained measure based on above-mentioned measuring method, and concentration is respectively 96.8 % by weight, 96.8 % by weight, 0.0 % by weight.According to this measurement result, in five methylene diamine crude product, relative to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 100mol%.
(enrichment process and polycondensation operation)
Except using the refining five methylene diamine 331.2g (purity 99.4 % by weight), the deionized water 798.0g that are obtained by aforesaid operations, carry out concentrated and polycondensation under the same conditions as example 1, obtain polyamide resin.The results are shown in table 2.
(embodiment 3)
(pyrolosis operation)
Above-mentioned five methylene diamine carbonate aqueous solution (ii) 5600g (total five methylene diamine concentration 18.7 % by weight) is added in flask, carry out heating and refluxing under interior temperature 102 DEG C (oil bath temperature 137 DEG C), condition of normal pressure, be decomposed into five methylene diamine crude product and carbonic acid gas.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in above-mentioned five methylene diamine crude product measure based on above-mentioned measuring method, and concentration is respectively 21.1 % by weight, 14.9 % by weight, 10.0 % by weight.According to this measurement result, in five methylene diamine crude product, relative to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 70.5mol%.
Then, recycle-water, one side raised temperature at leisure, in finally, temperature reaches the moment termination decomposition of 180 DEG C (oil bath temperatures 191 DEG C), obtains five methylene diamine crude product.It should be noted that, in pyrolosis operation, the top temperature of interior temperature is 180 DEG C.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the five methylene diamine crude product obtained by above-mentioned pyrolosis operation measure based on above-mentioned measuring method, and concentration is respectively 96.7 % by weight, 96.7 % by weight, 0.0 % by weight.According to this measurement result, in five methylene diamine crude product, relative to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 100mol%.
(distillation process)
Then, the five methylene diamine crude product obtained by aforesaid operations is distilled under the condition of interior temperature 80 DEG C (oil bath temperature 110 DEG C), pressure 2.67kPa, obtains refining five methylene diamine 939g (purity: 99.2 % by weight).Yield is 88.9%.
(enrichment process and polycondensation operation)
Use the refining five methylene diamine obtained by aforesaid operations, carry out concentrated and polycondensation under the same conditions as example 1, obtain polyamide resin.The results are shown in table 2.
(embodiment 4)
(pyrolosis operation)
Above-mentioned five methylene diamine carbonate aqueous solution (ii) 5600g (total five methylene diamine concentration 18.7 % by weight) is added in flask, recycle-water under the condition of interior temperature 77 DEG C (oil bath temperature 99 DEG C), 40.0kPa, start to decompose simultaneously, be decomposed into five methylene diamine crude product and carbonic acid gas.Decompose after starting, raised temperature at leisure, in finally, temperature reaches the moment termination decomposition of 134 DEG C (oil bath temperatures 156 DEG C), obtains five methylene diamine crude product.In addition, the top temperature of pyrolosis operation is 134 DEG C.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the five methylene diamine crude product obtained measure based on above-mentioned measuring method, and concentration is respectively 91.8 % by weight, 79.4 % by weight, 19.9 % by weight.According to this measurement result, in five methylene diamine crude product, relative to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 86.5mol%.
(distillation process)
Then, under the same conditions as example 1 the five methylene diamine crude product obtained by aforesaid operations is distilled, obtain refining five methylene diamine 772g (purity: 96.7 % by weight).Yield is 71.3%.
(enrichment process)
In the refining five methylene diamine 291.1g obtained by aforesaid operations (purity: after adding deionized water 790.4g 96.7 % by weight), add nonane diacid (manufacture of COGNIScorporation society) 518.5g.Then, be heated to 70 DEG C, after mixture is dissolved completely, confirm that pH is 7.8.After confirming pH, 96.7 % by weight), acetic acid (Wako Pure Chemical Industries, Ltd.'s manufactures) 2.5g and the previously prepared 0.135 % by weight hydrogen phosphite two sodium water solution 22.7g (use hydrogen phosphite disodium pentahydrate (manufacture of KishidaChemical society)) as polycondensation catalyst (purity:, for the preparation of the aqueous solution of raw material of polycondensation to add refining five methylene diamine 3.5g.
Then, above-mentioned raw materials aqueous solution 1500g is added in autoclave, carries out nitrogen replacement.Next, the temperature in autoclave is 142 DEG C, start to concentrate under the condition of interior pressure 0.20MPaG, and continuous concentration, until interior temperature is 152 DEG C, reclaims the water distilled out.
(polycondensation operation)
Next, close autoclave, interior temperature slowly raised, the temperature in autoclave is set as 260 DEG C, in be installed with and be decided to be 1.57MPaG.Then, at leisure after release, be decompressed to 20.0kPa at leisure, carry out the polycondensation of five methylene diamine and nonane diacid.Further, the water distilled out is reclaimed.
Content is made line material shape after stopping by polycondensation, in the sink after cooling, makes particle with moving rotary cuber.120 DEG C, the dry particle obtained, until water ratio is less than 0.1 % by weight, obtains polyamide resin under the condition of 0.13kPa.Relative viscosity (the η of the polyamide resin obtained rel) be 2.5, fusing point (Tm) is 210 DEG C.The results are shown in table 2.
(embodiment 5)
(pyrolosis operation)
Above-mentioned five methylene diamine carbonate aqueous solution (ii) 5600g (total five methylene diamine concentration 18.7 % by weight) is added in flask, while recycle-water, start to be decomposed into five methylene diamine crude product and carbonic acid gas under the condition of interior temperature 52 DEG C (oil bath temperature 78 DEG C), 13.3kPa.Decompose after starting, raised temperature at leisure, in finally, temperature reaches the moment termination decomposition of 113 DEG C (oil bath temperatures 129 DEG C), obtains five methylene diamine crude product.It should be noted that, the top temperature of pyrolosis operation is 113 DEG C.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the five methylene diamine crude product obtained measure based on above-mentioned measuring method, and concentration is respectively 85.4 % by weight, 67.2 % by weight, 29.3 % by weight.According to this measurement result, in five methylene diamine crude product, relative to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 78.7mol%.
(distillation process)
Then, the five methylene diamine crude product obtained by aforesaid operations is distilled under the same conditions as example 1, obtain refining five methylene diamine 547g (purity: 89.2 % by weight).Yield is 46.6%.
(enrichment process)
In the refining five methylene diamine 301.0g obtained by aforesaid operations (purity: after adding deionized water 767.5g 89.2 % by weight), add sebacic acid (manufacture of little Cang compound probability society) 531.5g.Secondly, be heated to 70 DEG C, after mixture is dissolved completely, confirm that pH is 7.7.After pH confirms, 89.2 % by weight), acetic acid 3.0g, previously prepared 0.135 % by weight hydrogen phosphite two sodium water solution 22.7g as polycondensation catalyst (purity:, for the preparation of the aqueous solution of raw material of polycondensation to add refining five methylene diamine 4.8g.
Then, above-mentioned raw materials aqueous solution 1500g is added in autoclave, carries out nitrogen replacement.Secondly, the temperature in autoclave is 143 DEG C, interior pressure is start to concentrate under the condition of 0.20MPaG, and continuous concentration, until interior temperature is 152 DEG C, reclaims the water distilled out.
(polycondensation operation)
Subsequently, close autoclave, interior temperature slowly raised, the temperature in autoclave is set as 260 DEG C, in be installed with and be decided to be 1.57MPaG.Then, at leisure after release, be decompressed to 33.3kPa at leisure, carry out the polycondensation of five methylene diamine and sebacic acid.Further, the water distilled out is reclaimed.
Content is made line material shape after stopping by polycondensation, in the sink after cooling, makes particle with moving rotary cuber.120 DEG C, the dry particle obtained, until water ratio is less than 0.1 % by weight, obtains polyamide resin under the condition of 0.13kPa.Relative viscosity (the η of the polyamide resin obtained rel) be 2.5, fusing point (Tm) is 218 DEG C.The results are shown in table 2.
Table 2
(embodiment 6)
(pyrolosis operation)
Above-mentioned five methylene diamine carbonate aqueous solution (ii) (total five methylene diamine concentration 18.7 % by weight) 5600g is added in flask, under the condition of interior temperature 39 DEG C (oil bath temperature 60 DEG C), 6.67kPa, recycle-water, is decomposed into five methylene diamine crude product and carbonic acid gas on one side.Decompose after starting, raised temperature at leisure, in finally, temperature reaches the moment termination decomposition of 89 DEG C (oil bath temperatures 98 DEG C), obtains five methylene diamine crude product.It should be noted that, in pyrolosis operation, the top temperature of interior temperature is 89 DEG C.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the five methylene diamine crude product obtained measure based on above-mentioned measuring method, and concentration is respectively 75.7 % by weight, 46.5 % by weight, 46.9 % by weight.According to this measurement result, in five methylene diamine crude product, relative to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 61.4mol%.
(distillation process)
Then, under the distillation condition identical with embodiment 1, five methylene diamine crude product is distilled, obtain refining five methylene diamine 522g (purity: 44.0 % by weight).Yield is 22.0%.
(embodiment 7)
(pyrolosis operation)
Above-mentioned five methylene diamine carbonate aqueous solution (ii) 5600g (total five methylene diamine concentration 18.7 % by weight) is added in autoclave, under the condition of interior temperature 124 DEG C (oil bath temperature 160 DEG C), 200kPa, start while recycle-water to be decomposed into five methylene diamine crude product and carbonic acid gas.Raised temperature at leisure, in finally, temperature reaches the moment termination decomposition of 204 DEG C (jacket temperatures 212 DEG C), obtains five methylene diamine crude product.It should be noted that, in pyrolosis operation, the top temperature of interior temperature is 204 DEG C.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the five methylene diamine crude product obtained measure based on above-mentioned measuring method, and concentration is respectively 96.6 % by weight, 96.6 % by weight, 0.0 % by weight.According to this measurement result, in five methylene diamine crude product, relative to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 100mol%.
(distillation process)
Then, the five methylene diamine crude product obtained is added in flask, distill under the same conditions as example 1 by aforesaid operations, obtain refining five methylene diamine 945g (purity: 99.1 % by weight).Yield is 89.4%.
(enrichment process)
In the refining five methylene diamine 248.1g obtained by aforesaid operations (purity: after adding deionized water 975.5g 99.1 % by weight), add dodecanedioic acid (manufacture of Yu Buxingchan society) 554.1g.Then, be heated to 70 DEG C, after mixture is dissolved completely, confirm that pH is 7.7.After confirming pH, 99.1 % by weight), acetic acid 3.0g, previously prepared 0.135 % by weight hydrogen phosphite two sodium water solution 22.7g as polycondensation catalyst (purity:, for the preparation of the aqueous solution of raw material of polycondensation to add refining five methylene diamine 4.4g.
Then, above-mentioned raw materials aqueous solution 1500g is added in autoclave, carries out nitrogen replacement.Secondly, the temperature in autoclave is 144 DEG C, start to concentrate under the condition of interior pressure 0.20MPaG, and continuous concentration, until interior temperature is 152 DEG C, reclaims the water distilled out.
(polycondensation operation)
Next, close autoclave, interior temperature slowly raised, the temperature in autoclave is set as 260 DEG C, in be installed with and be decided to be 1.57MPaG.Then, at leisure after release, be slowly decompressed to 33.3kPa, carry out the polycondensation of five methylene diamine and dodecanedioic acid.Further, the water distilled out is reclaimed.
Content is made line material shape after stopping by polycondensation, in the sink after cooling, makes particle with moving rotary cuber.120 DEG C, the dry particle obtained, until water ratio is less than 0.1 % by weight, obtains polyamide resin under the condition of 0.13kPa.Relative viscosity (the η of the polyamide resin obtained rel) be 2.5, fusing point (Tm) is 211 DEG C.The results are shown in table 2.
(embodiment 8)
(pyrolosis operation and distillation process)
Use above-mentioned five methylene diamine carbonate aqueous solution (i), obtain refining five methylene diamine 827g (purity: 98.4 % by weight) in addition under the same conditions as example 1.Yield is 77.7%.It should be noted that, the top temperature of pyrolosis operation is 180 DEG C.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the five methylene diamine crude product obtained measure based on above-mentioned measuring method, and concentration is respectively 96.2 % by weight, 96.2 % by weight, 0.0 % by weight.According to this measurement result, in five methylene diamine crude product, relative to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 100mol%.
(polycondensation operation)
In the refining five methylene diamine 10.45g obtained by aforesaid operations (purity: after adding deionized water 24.83g 98.4 % by weight), add hexanodioic acid 14.71g.Then, be heated to 70 DEG C, after mixture is dissolved completely, add a small amount of refining five methylene diamine, pH is adjusted to 8.4.After adjustment pH, add the previously prepared 0.2 % by weight phosphorous acid aqueous solution 0.625g as polycondensation catalyst, for the preparation of the aqueous solution of raw material of polycondensation.
Then, above-mentioned raw materials aqueous solution 40g is added after in special glass container, special glass container is put into autoclave, carries out nitrogen replacement.Secondly, autoclave is dipped in the oil bath of 100 DEG C, uses about 1 hour by the heating temperatures of oil bath to 270 DEG C, start polycondensation.
After polycondensation starts, to press maintenance in the autoclave of 1.57MPaG 2 hours, next, at leisure after release, then be decompressed to 61.3kPa, keep 1 hour, stop polycondensation.
After polycondensation stops, pressure in autoclave is maintained and carries out naturally cooling under a reduced pressure, after naturally cooling, take out the polyamide resin obtained by polycondensation.Relative viscosity (the η of polyamide resin rel) be 3.3, fusing point (Tm) is 255 DEG C.The results are shown in table 3.
(embodiment 9)
(pyrolosis operation)
Above-mentioned five methylene diamine carbonate aqueous solution (iii) 900g (total five methylene diamine concentration 18.8 % by weight) is added in flask, under the condition of interior temperature 102 DEG C (oil bath temperature 139 DEG C), normal pressure while recycle-water, start to be decomposed into five methylene diamine crude product and carbonic acid gas.Maintain normal pressure, simultaneously raised temperature at leisure, the moment that temperature reaches 180 DEG C (jacket temperatures 190 DEG C) in final stops decomposition, obtains five methylene diamine crude product.It should be noted that, in pyrolosis operation, the top temperature of interior temperature is 180 DEG C.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the five methylene diamine crude product obtained measure based on above-mentioned measuring method, and concentration is respectively 96.0 % by weight, 96.0 % by weight, 0.0 % by weight.According to this measurement result, in five methylene diamine crude product, relative to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 100mol%.
(distillation process)
Then, under the same conditions as example 1 the five methylene diamine crude product obtained by aforesaid operations is distilled, obtain refining five methylene diamine 154g (purity: 98.3 % by weight).Yield is 89.3%.
(polycondensation operation)
98.3 % by weight), deionized water 24.82g (purity:, in addition, carries out polycondensation, obtains polyamide resin under condition similarly to Example 8 to use the refining five methylene diamine 10.47g obtained by aforesaid operations.The results are shown in table 3.
(embodiment 10)
(pyrolosis operation and distillation process)
Use above-mentioned five methylene diamine carbonate aqueous solution (iv) 900g (total five methylene diamine concentration 18.8 % by weight), in addition, under condition similarly to Example 8, obtain refining five methylene diamine 152g (purity: 99.2 % by weight).Yield is 89.3%.It should be noted that, the top temperature of pyrolosis operation is 180 DEG C.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the five methylene diamine crude product obtained measure based on above-mentioned measuring method, and concentration is respectively 95.8 % by weight, 95.8 % by weight, 0.0 % by weight.According to this measurement result, in five methylene diamine crude product, relative to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 100mol%.
(polycondensation operation)
(purity: 99.2 % by weight) 10.37g, deionized water 24.92g, in addition, carries out polycondensation, obtains polyamide resin under condition similarly to Example 8 to use the refining five methylene diamine obtained by aforesaid operations.The results are shown in table 3.
(comparative example 1)
(pyrolosis operation)
Above-mentioned five methylene diamine carbonate aqueous solution (ii) 5600g (total five methylene diamine concentration 18.7 % by weight) is added in flask, under the condition of interior temperature 71 DEG C (oil bath temperature 74 DEG C), normal pressure, recycle-water on one side, while be decomposed into five methylene diamine crude product and carbonic acid gas, obtain five methylene diamine crude product.It should be noted that, the top temperature of pyrolosis operation is 71 DEG C.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the five methylene diamine crude product obtained measure based on above-mentioned measuring method, and concentration is respectively 19.6 % by weight, 4.7 % by weight, 24.0 % by weight.According to this measurement result, in five methylene diamine crude product, relative to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 24.0mol%.
(distillation process)
Next, under the condition of interior temperature 40 DEG C (oil bath temperature 100 DEG C), 6.7kPa, make the five methylene diamine carbonate aqueous solution dehydration obtained by aforesaid operations, carry out the distillation of five methylene diamine simultaneously.Refining five methylene diamine is the aqueous solution (total five methylene diamine concentration: 2.0 % by weight), obtain 3217g.Yield is 6.1%.
(comparative example 2)
(pyrolosis operation)
Above-mentioned five methylene diamine carbonate aqueous solution (ii) 500g (total five methylene diamine concentration 18.7 % by weight) is added in flask, and add gac 50g (manufacture of Ka Ergang society of Mitsubishi Chemical, MM-11), stir 30 minutes in 30 DEG C.Secondly, cross and filter gac, the obtained aqueous solution is added in flask, under the condition of interior temperature 40 DEG C (oil bath temperature 65 DEG C), 6.67kPa, utilizes vaporizer to concentrate.After concentrated, obtain the five methylene diamine carbonate 126g (total five methylene diamine concentration 64.3 % by weight) solidified, yield is 86.2%.
Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration measure based on above-mentioned measuring method, and concentration is respectively 64.3 % by weight, 13.8 % by weight, 81.1 % by weight.According to this measurement result, in the five methylene diamine carbonate of solidification, relative to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 21.5mol%.Further, utilize the method same with polycondensation operation described later, the five methylene diamine adipate aqueous solution of preparation 50 % by weight, according to the measuring method of above-mentioned YI, measure YI, its result, YI value is 141.
(polycondensation operation)
In five methylene diamine carbonate 16.00g (total five methylene diamine concentration: add deionized water 22.77g 64.3 % by weight), make the five methylene diamine dissolves carbonate of solidification of the solidification obtained by aforesaid operations.Next, add hexanodioic acid 14.71g, be heated to 70 DEG C, after mixture is dissolved completely, add the refining five methylene diamine (purity: 99.2 % by weight), pH is adjusted to 8.4 obtained in embodiment 1 on a small quantity.After adjustment pH, add previously prepared 0.2 % by weight phosphorous acid aqueous solution 0.625g as polycondensation catalyst, for the preparation of the aqueous solution of raw material of polycondensation.
Then, above-mentioned raw materials aqueous solution 40g is added after in special glass container, special glass container is put into autoclave, carries out nitrogen replacement.Secondly, autoclave is immersed in the oil bath of 100 DEG C, use about 1 hour by the heating temperatures of oil bath to 270 DEG C, start polycondensation.
After polycondensation starts, keep pressing 2 hours in autoclave with 1.57MPaG, next, at leisure after release, then be decompressed to 61.3kPa, keep 1 hour, stop polycondensation.
After polycondensation stops, pressure in autoclave is maintained decompression state and carries out naturally cooling, after naturally cooling, take out the polyamide resin obtained by polycondensation.Polyamide resin is with dark brown, and more crisp.
Table 3
Industrial applicibility
The present invention can manufacture five methylene diamine by Methionin with high yield by simple manufacturing process, uses the five methylene diamine that obtains to make us expecting very much to have industrial applicibility as 56 nylon of raw material etc. as the polymkeric substance of plant origin.In addition, in the operation of manufacture five methylene diamine of the present invention, by re-using after part or all generated carbonic acid gas or Water Sproading, can reduce with they manufacture, transmit the energy that consumes and the discharge of carbonic acid gas and the discharge of water.
In addition, the full content of No. 2009-109805, the Japanese patent application that No. 2008-274582, the Japanese patent application submitted in No. 2008-174342, the Japanese patent application submitted on July 3rd, 2008, on October 24th, 2008, on April 28th, 2009 submit to and the specification sheets of No. 2009-158806, Japanese patent application, claims, accompanying drawing and summary that on July 3rd, 2009 submits to is quoted so far, and the disclosure as specification sheets of the present invention charges to the application.

Claims (21)

1. a manufacture method for refining five methylene diamine, is characterized in that, this manufacture method comprises:
Pyrolosis operation, in this pyrolosis operation, by heating five methylene diamine carbonate, obtain five methylene diamine crude product and carbonic acid gas, in described pyrolosis operation, the top temperature of heating is 180 DEG C ~ 200 DEG C;
Distillation process, in this distillation process, by the five methylene diamine crude product distillation obtained by above-mentioned pyrolosis operation, obtains five methylene diamine; With
There is enzymatic decarboxylation reaction process before described pyrolosis operation, in described enzymatic decarboxylation reaction process, use at least a kind in the group being selected from and being made up of lysine decarboxylase, the recombinant microorganism that improve lysine decarboxylase activity, the generation cell of lysine decarboxylase and the handled thing of this cell, five methylene diamine carbonate is produced by the aqueous solution of Methionin and/or the aqueous solution of lysine carbonate, after using ultra-filtration membrane to be removed by macromolecule impurity contained in the aqueous solution of five methylene diamine carbonate, heat
In above-mentioned five methylene diamine crude product, relative to the summation 100mol% of five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is more than 99mol%.
2. the manufacture method of refining five methylene diamine as claimed in claim 1, it is characterized in that, the condition of described distillation process is following (1) and (2),
(1) distillation temperature: 40 DEG C ~ 300 DEG C
(2) pressure: 0.2kPa ~ 1200kPa is distilled, absolute pressure.
3. the manufacture method of refining five methylene diamine as claimed in claim 1, it is characterized in that, in described pyrolosis operation, five methylene diamine carbonate is the aqueous solution of five methylene diamine carbonate, by heating, obtain five methylene diamine crude product, carbonic acid gas and water.
4. the manufacture method of refining five methylene diamine as claimed in claim 1, it is characterized in that, the pressure in described pyrolosis operation is 2kPa ~ 1200kPa.
5. the manufacture method of refining five methylene diamine as claimed in claim 1, is characterized in that, in described pyrolosis operation, be blown into gas, while heating five methylene diamine carbonate.
6. the manufacture method of refining five methylene diamine as claimed in claim 5, it is characterized in that, described gas is rare gas element.
7. the manufacture method of refining five methylene diamine as claimed in claim 1, is characterized in that, carry out described enzymatic decarboxylation reaction process under carbon dioxide atmosphere.
8. the manufacture method of refining five methylene diamine as claimed in claim 1, is characterized in that before described enzymatic decarboxylation reaction process, have the lysine carbonate generation process being obtained lysine carbonate by Methionin and carbonic acid gas.
9. the manufacture method of refining five methylene diamine as claimed in claim 8, it is characterized in that, in described lysine carbonate generation process, Methionin is the aqueous solution.
10. the manufacture method of five methylene diamine as claimed in claim 7 refining, is characterized in that, using the carbonic acid gas generated in described pyrolosis operation as enzymatic decarboxylation reaction process carbon dioxide recovery, re-use.
The manufacture method of 11. as claimed in claim 8 refining five methylene diamines, is characterized in that, using the carbonic acid gas generated in described pyrolosis operation as be used for described lysine carbonate generation process carbon dioxide recovery, re-use.
The manufacture method of 12. as claimed in claim 1 refining five methylene diamines, is characterized in that, using the water generated in described pyrolosis operation as described enzymatic decarboxylation reaction process Water Sproading, re-use.
The manufacture method of 13. as claimed in claim 9 refining five methylene diamines, is characterized in that, using the water generated in described pyrolosis operation as described lysine carbonate generation process Water Sproading, re-use.
The manufacture method of 14. refining five methylene diamines as described in any one of claim 3 ~ 13, it is characterized in that, the organic total content with more than 3 functional groups contained in five methylene diamine carbonate is less than 0.01 relative to the weight ratio of five methylene diamine contained in the described aqueous solution of five methylene diamine carbonate.
The manufacture method of 15. refining five methylene diamines as claimed in claim 14, it is characterized in that, the organism with more than 3 functional groups contained in the described aqueous solution of five methylene diamine carbonate is Methionin.
The manufacture method of 16. 1 kinds of polyamide resins, is characterized in that, this manufacture method comprises:
Enzymatic decarboxylation reaction process, in this enzymatic decarboxylation reaction process, use at least one in the group being selected from and being made up of lysine decarboxylase, the recombinant microorganism that improve lysine decarboxylase activity, the generation cell of lysine decarboxylase and the handled thing of this cell, five methylene diamine carbonate is produced by the aqueous solution of Methionin and/or the aqueous solution of lysine carbonate, after using ultra-filtration membrane to be removed by macromolecule impurity contained in the aqueous solution of five methylene diamine carbonate, heat;
Pyrolosis operation, in this pyrolosis operation, by heating the five methylene diamine carbonate obtained by above-mentioned enzymatic decarboxylation reaction process, obtain five methylene diamine crude product and carbonic acid gas, in described pyrolosis operation, the top temperature of heating is 180 DEG C ~ 200 DEG C;
Distillation process, in this distillation process, by the five methylene diamine crude product distillation obtained by above-mentioned pyrolosis operation, obtains five methylene diamine; With
Polycondensation operation, in this polycondensation operation, carries out polycondensation using the five methylene diamine obtained by dicarboxylic acid and above-mentioned distillation process as monomer component,
In the five methylene diamine crude product obtained in above-mentioned pyrolosis operation, relative to the summation 100mol% of five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is more than 99mol%.
The manufacture method of 17. polyamide resins as claimed in claim 16, it is characterized in that, before described polycondensation operation, there is enrichment process, in this enrichment process, after utilizing described five methylene diamine, dicarboxylic acid and water to make the five methylene diamine dicarboxylate aqueous solution, water is removed in distillation.
The manufacture method of 18. polyamide resins as described in claim 16 or 17, is characterized in that, before described enzymatic decarboxylation reaction process, having the lysine carbonate generation process being obtained lysine carbonate by Methionin and carbonic acid gas.
The manufacture method of 19. polyamide resins as claimed in claim 18, is characterized in that, in described lysine carbonate generation process, Methionin is the aqueous solution.
The manufacture method of 20. polyamide resins as claimed in claim 16, is characterized in that, using the water generated in described polycondensation operation and/or enrichment process as described enzymatic decarboxylation reaction process Water Sproading, re-use.
The manufacture method of 21. polyamide resins as claimed in claim 19, is characterized in that, using the water generated in described polycondensation operation and/or enrichment process as described lysine carbonate generation process Water Sproading, re-use.
CN200980121108.3A 2008-07-03 2009-07-03 The manufacture method of five methylene diamine and the manufacture method of polyamide resin Active CN102056889B (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
JP2008-174342 2008-07-03
JP2008174342 2008-07-03
JP2008274582 2008-10-24
JP2008-274582 2008-10-24
PCT/JP2009/062218 WO2010002000A1 (en) 2008-07-03 2009-07-03 Process for production of pentamethylenediamine, and process for production of polyamide resin

Publications (2)

Publication Number Publication Date
CN102056889A CN102056889A (en) 2011-05-11
CN102056889B true CN102056889B (en) 2016-01-20

Family

ID=41466090

Family Applications (1)

Application Number Title Priority Date Filing Date
CN200980121108.3A Active CN102056889B (en) 2008-07-03 2009-07-03 The manufacture method of five methylene diamine and the manufacture method of polyamide resin

Country Status (2)

Country Link
CN (1) CN102056889B (en)
WO (1) WO2010002000A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017198147A1 (en) * 2016-05-16 2017-11-23 宁夏伊品生物科技股份有限公司 Method for fermentation-production of pentanediamine comprising carbon dioxide stripping technique

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100421585B1 (en) 2001-10-25 2004-03-09 한국전자통신연구원 System for cell searching of mobile station in Time Division Duplex system and method thereof
JP5548864B2 (en) * 2008-07-03 2014-07-16 三菱化学株式会社 Method for producing purified pentamethylenediamine and method for producing polyamide resin
DE102009005289B4 (en) 2009-01-20 2023-06-22 Merck Patent Gmbh Materials for organic electroluminescent devices, methods for their production and electronic devices containing them
US20120016077A1 (en) * 2009-03-30 2012-01-19 Toray Industries Inc. Polyamide resin, polyamide resin composition, and molded article comprising same
JP5630286B2 (en) * 2010-01-29 2014-11-26 東レ株式会社 Method for producing polyamide resin
JP5729085B2 (en) * 2010-03-31 2015-06-03 三菱化学株式会社 Method for producing pentamethylenediamine and method for producing polyamide resin
JP5930594B2 (en) * 2011-03-14 2016-06-08 三菱化学株式会社 Method for producing purified pentamethylenediamine and method for producing polyamide resin
JP2012201817A (en) * 2011-03-25 2012-10-22 Mitsubishi Chemicals Corp Method for producing purified pentamethylenediamine, and method for producing polyamide resin
US9234203B2 (en) 2012-05-21 2016-01-12 Cathay Industrial Biotech Ltd. Stabilized recombinant expression plasmid vector in hafnia alvei and applications thereof
EP2955170B1 (en) 2013-02-08 2019-08-07 Ajinomoto Co., Inc. Method for preserving 1,5-pentadiamine or salt thereof, method for preventing discoloration of same, and packaged 1,5-pentadiamine or salt thereof
JPWO2015076233A1 (en) * 2013-11-19 2017-03-16 東レ株式会社 Polyamide resin, polyamide resin pellets and method for producing polyamide resin
CN104762336B (en) * 2014-01-06 2019-10-29 上海凯赛生物技术股份有限公司 The preparation method of 1,5- pentanediamine
CN104974046B (en) * 2014-04-03 2017-11-17 凯赛（金乡）生物材料有限公司 A kind of purification process of pentanediamine
US10711289B2 (en) * 2014-12-23 2020-07-14 Genomatica, Inc. Method of producing and processing diamines from an engineered microorganism
KR101694854B1 (en) 2015-01-28 2017-01-10 서울대학교 산학협력단 Microporous polymers and fabrication methods of the same
WO2016123745A1 (en) 2015-02-03 2016-08-11 上海凯赛生物技术研发中心有限公司 Immobilized cell and preparation method thereof
JP2016033138A (en) * 2015-11-09 2016-03-10 三菱化学株式会社 Method for producing purified pentamethylenediamine and method for producing polyamide resin
CN107043330B (en) 2016-02-06 2020-10-20 上海凯赛生物技术股份有限公司 Method for extracting 1, 5-pentamethylene diamine from solution system containing 1, 5-pentamethylene diamine salt
CN107338275A (en) * 2016-04-13 2017-11-10 宁夏伊品生物科技股份有限公司 The method for producing pentanediamine using accessory substance carbon dioxide automatic control pH whole-cell catalytic
US11161101B2 (en) 2017-05-31 2021-11-02 Furukawa Electric Co., Ltd. Catalyst structure and method for producing the catalyst structure
KR102094348B1 (en) 2017-10-18 2020-03-27 씨제이제일제당 주식회사 Refining method of 1,5-diaminopentane
CN108997141B (en) * 2018-08-28 2021-10-19 河北美邦工程科技股份有限公司 Preparation method of 1, 5-pentanediamine
CN111087309B (en) * 2019-12-19 2023-03-21 西安近代化学研究所 Method for preparing 2-methylbutylamine by one-step method

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0118290A1 (en) * 1983-03-04 1984-09-12 Tosoh Corporation Process for recovering ethyleneamines from aqueous solution of ethyleneamine carbonates
WO2006123778A1 (en) * 2005-05-19 2006-11-23 Ajinomoto Co., Inc. Method for producing cadaverine carbonate, and method for producing polyamide using the same

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS59161337A (en) * 1983-03-03 1984-09-12 Toyo Soda Mfg Co Ltd Decarboxylation of ethyleneamine carbonate
JP4196620B2 (en) * 2002-04-08 2008-12-17 東レ株式会社 Method for producing cadaverine for polyamide raw material

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0118290A1 (en) * 1983-03-04 1984-09-12 Tosoh Corporation Process for recovering ethyleneamines from aqueous solution of ethyleneamine carbonates
WO2006123778A1 (en) * 2005-05-19 2006-11-23 Ajinomoto Co., Inc. Method for producing cadaverine carbonate, and method for producing polyamide using the same

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
用固定化L-赖氨酸脱羧酶细胞制备1,5-戊二胺;蒋丽丽等;《精细化工》;20071130;第24卷(第11期);第1080-1084页 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017198147A1 (en) * 2016-05-16 2017-11-23 宁夏伊品生物科技股份有限公司 Method for fermentation-production of pentanediamine comprising carbon dioxide stripping technique

Also Published As

Publication number Publication date
CN102056889A (en) 2011-05-11
WO2010002000A1 (en) 2010-01-07

Similar Documents

Publication Publication Date Title
CN102056889B (en) The manufacture method of five methylene diamine and the manufacture method of polyamide resin
JP5812150B2 (en) Method for producing purified pentamethylenediamine and method for producing polyamide resin
JP5644037B2 (en) Polyamide resin composition
CN101443382B (en) Polyamide resin
JP5656343B2 (en) Process for producing purified pentamethylenediamine
US4345066A (en) Transparent copolyamides and their application to transparent, impact resistant molded articles
JP2003292612A (en) Polypentamethylene adipamide resin and its producing method
JP4168702B2 (en) Process for producing polypentamethylene adipamide resin
JP2015096552A (en) Method for manufacturing pentamethylenediamine and method for manufacturing polyamide resin
JP2003292614A (en) Polyamide resin
CN101578256B (en) Cadaverine salt, aqueous cadaverine salt solution, polyamide resin, molded article and process for producing cadaverine salt and aqueous cadaverine salt solution
CN100509917C (en) Polyamide prepolymer, polyamide ,and processes for producing these
US20160289165A1 (en) 1,5-pentamethylene diamine and production method therefor
JP5930594B2 (en) Method for producing purified pentamethylenediamine and method for producing polyamide resin
CN102782010B (en) Process for production of polypentamethyleneadipamide resin
JP2012201817A (en) Method for producing purified pentamethylenediamine, and method for producing polyamide resin
JP2009131239A (en) Method for producing pentamethylenediamine
JP5365004B2 (en) Method for producing aqueous cadaverine salt solution
US4219636A (en) Preparation polyamides of isophthalic acid and hexamethylene diamine with formic acid
JP2009096796A (en) Method for producing pentamethylene diamine
JP4329292B2 (en) Method for producing polyamide prepolymer and method for producing polyamide
JP2016033138A (en) Method for producing purified pentamethylenediamine and method for producing polyamide resin
JP2009195202A (en) Method for manufacturing purified pentamethylene diamine
CN103483581B (en) Transparent polyamide and synthetic method thereof
JP5309649B2 (en) Method for producing pentamethylenediamine dicarboxylate

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CP01 Change in the name or title of a patent holder

Address after: Tokyo, Japan

Patentee after: MITSUBISHI CHEMICAL Corp.

Address before: Tokyo, Japan

Patentee before: MITSUBISHI RAYON Co.,Ltd.

CP01 Change in the name or title of a patent holder
TR01 Transfer of patent right

Effective date of registration: 20170919

Address after: Tokyo, Japan

Patentee after: MITSUBISHI RAYON Co.,Ltd.

Address before: Tokyo, Japan

Patentee before: MITSUBISHI CHEMICAL Corp.

TR01 Transfer of patent right