JP5365004B2 - Method for producing aqueous cadaverine salt solution - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for producing an aqueous cadaverine salt solution whereby polymeric impurities can be removed from the solution. <P>SOLUTION: An aqueous cadaverine salt solution produced from lysine by the use of a lysine decarboxylase, a recombinant microorganism with an improved lysine decarboxylation activity, or cells or processed cells which produce a lysine decarboxylase is filtered through an ultrafilter membrane to remove polymeric impurities, (e.g., proteins) of a molecular weight of 12,000 or higher from the solution. A polyamide resin made from the treated cadaverine contains little gel and is therefore desirable for films, injection moldings, fibers, monofilaments, or the like. <P>COPYRIGHT: (C)2008,JPO&amp;INPIT

Description

  The present invention relates to a method for producing a cadaverine salt aqueous solution, and more particularly to a method for producing a cadaverine salt aqueous solution from which polymer impurities are removed.

  Most of plastic materials are so-called fossil materials. Except for the case of recycling, when plastic is discarded, disposal due to combustion or the like causes a release of carbon dioxide gas, which is becoming a problem in recent years. Therefore, in order to prevent global warming and form a recycling society, it is desired to replace the raw materials for plastic production with raw materials derived from biomass. Such needs are diverse such as films, automobile parts, electrical / electronic parts, injection molded products such as mechanical parts, fibers, monofilaments, and the like.

  By the way, the polyamide resin is excellent in mechanical strength, heat resistance, chemical resistance, etc., and is used in many fields as one of so-called engineering plastics. Above all, the film has excellent mechanical properties, heat resistance, transparency, gas barrier properties, etc. compared to biaxially stretched polypropylene film and biaxially stretched polyester film, etc. Widely used as an industrial film.

Polyamide resin films are often used after being subjected to stretching treatment such as biaxial stretching in order to impart strength and gas barrier properties. At this time, if there is a granular defect called “fish eye”, not only does it cause stretching and breakage, but the productivity is deteriorated, and the appearance of the film is deteriorated and the commercial value is remarkably impaired. For this reason, it is required to reduce fish eyes as much as possible.
Polyamide resins are also widely used in the field of fibers and monofilaments, taking advantage of their superior performance. Even in these applications, as with the above-described film, fish eyes are subject to stretch breakage during molding and deterioration of the surface appearance.

  On the other hand, injection molded products made of polyamide resin include automobile parts, electrical / electronic parts, mechanical parts and the like. In either case, thinning is desired for the purpose of reducing the size and weight of parts. In this case, in order to maintain the original physical properties of the polyamide resin, a polyamide resin having high fluidity is required without lowering the molecular weight (number average molecular weight).

  As a polyamide resin manufactured using a raw material derived from biomass, one using cadaverine as a raw material is known. For example, Patent Literature 1 and Patent Literature 2 propose a method for producing and purifying cadaverine dicarboxylate, which is a raw material.

JP 2004-208646 A JP 2005-006650 A

  However, the patent document does not mention anything about the relationship between the fish eye (F / E) of the polyamide resin film, the fluidity during injection molding, and the polymer impurities contained in the polyamide resin.

This invention is made | formed in order to solve the subject in the polyamide resin obtained from the raw material derived from biomass mentioned above.
That is, an object of the present invention is to provide a method for producing a cadaverine salt aqueous solution from which polymer impurities are removed.
An object of the present invention is to provide an aqueous cadaverine salt solution with reduced polymer impurities.
An object of the present invention is to provide a cadaverine salt obtained from a cadaverine salt aqueous solution.
The objective of this invention is providing the polyamide resin obtained from the raw material derived from biomass.
An object of the present invention is to provide a molded product obtained from such a polyamide resin.

  In order to solve the above problems, the present inventors have conducted intensive studies. As a result, when a polyamide resin is produced by removing polymer impurities from a cadaverine salt aqueous solution obtained from a biomass-derived raw material, the surface of the fish is remarkably reduced. It has been found that a polyamide resin film having an excellent appearance can be obtained and the fluidity during injection molding is remarkably excellent, and the present invention has been completed based on such findings.

Thus, according to the present invention, there is provided a method for producing a cadaverine salt aqueous solution, which is characterized by removing polymer impurities having a molecular weight of 12,000 or more.
Here, in the method for producing an aqueous cadaverine salt to which the present invention is applied, it is preferable to further remove polymer impurities having a molecular weight of 5,000 or more.
Moreover, it is preferable to remove such polymer impurities by film treatment.
Moreover, as such a membrane treatment, it is preferable to perform an ultrafiltration membrane (UF membrane) treatment.
Here, in the method for producing an aqueous solution of cadaverine salt to which the present invention is applied, cadaverine is a lysine decarboxylase, a recombinant microorganism having improved lysine decarboxylase activity, a cell producing lysine decarboxylase, or a processed product of this cell And is preferably produced from lysine.
The cadaverine salt is preferably a dicarboxylate.

  Next, according to the present invention, there is provided a cadaverine salt aqueous solution obtained by the production method described in the above-described method for producing a cadaverine salt aqueous solution.

  According to the present invention, there is provided a cadaverine salt produced by crystallizing the cadaverine salt aqueous solution described above.

  According to the present invention, there is provided a polyamide resin obtained by a polycondensation reaction using such a cadaverine salt aqueous solution as a raw material.

  According to the present invention, there is provided a polyamide resin obtained by the above polycondensation reaction of a cadaverine salt or a polycondensation reaction of a cadaverine salt with another copolymer component.

Furthermore, according to the present invention, there is provided a molded product obtained by molding such a polyamide resin by a predetermined molding method.
Here, as a molded product, a film, an injection molded product, a fiber, and a monofilament are preferable.

  According to the present invention, an aqueous cadaverine salt solution from which polymer impurities are removed is obtained.

  Hereinafter, the best mode (embodiment) for carrying out the present invention will be described in detail. The following description is a representative example of the embodiment of the present invention, and the present invention is not limited to these contents.

(Cadaverine)
The cadaverine in the present embodiment is obtained by, for example, performing an enzymatic decarboxylation reaction of lysine while adding an acid to the lysine solution so that the pH of the solution is maintained at a pH suitable for the enzymatic decarboxylation reaction. Can be manufactured.
Examples of the acid used here include inorganic acids such as hydrochloric acid, sulfuric acid, and phosphoric acid, and organic acids such as acetic acid. Free cadaverine can be collected from the resulting reaction product solution using a conventional separation and purification method.
Furthermore, it is also possible to collect cadaverine dicarboxylate, which is a raw material for producing polyamide directly, using dicarboxylic acid as the acid.

(Method for producing cadaverine adipate)
Hereinafter, a method for producing cadaverine adipate by enzymatic decarboxylation of lysine using adipic acid as an acid will be described in detail.
The lysine used as a raw material is usually preferably a free base (lysine base, ie, free lysine), but may be an adipate of lysine. The lysine may be either L-lysine or D-lysine as long as it produces cadaverine by enzymatic decarboxylation, but L-lysine is usually preferred because of its availability.
The lysine may be a purified lysine, or a fermentation liquid containing lysine as long as cadaverine produced by enzymatic decarboxylation can form a salt with adipic acid.

As a solvent for preparing the lysine solution, water is preferably used. Since the pH of the reaction solution is adjusted with adipic acid, it is not necessary to use other pH adjusting agents or buffers, but a buffer solution may be used as the solvent.
Examples of such a buffer include sodium acetate buffer. However, from the viewpoint of forming a salt of cadaverine and adipic acid, it is preferable not to use a buffering agent or the like, or to suppress it to a low concentration even if it is used.

When free lysine is used as lysine, adipic acid is added to the lysine solution to adjust to a pH suitable for enzymatic decarboxylation. Specifically, the pH is usually 4.0 or more, preferably 5.0 or more, more preferably 5.5 or more, and usually 8.0 or less, preferably 7.0 or less, more preferably 6.5. The following are mentioned.
When lysine adipate is used as lysine, it is not necessary to add adipic acid when preparing the reaction solution. Hereinafter, the adjustment of the pH of the reaction solution to a pH suitable for the enzymatic decarboxylation reaction may be referred to as “neutralization”.

In the enzymatic decarboxylation reaction of lysine, it is preferable to add at least one vitamin B6 selected from pyridoxine, pyridoxamine, pyridoxal and pyridoxal phosphate in order to improve the production rate and reaction yield, and in particular, pyridoxal phosphate Is particularly preferred.
There is no restriction | limiting in particular in the method of adding vitamin B6. You may add suitably during reaction.

The enzymatic decarboxylation reaction of lysine can be performed, for example, by adding lysine decarboxylase (LDC) to the lysine solution neutralized as described above.
The LDC is not particularly limited as long as it acts on lysine to produce cadaverine. As the LDC, a purified enzyme may be used, or a cell such as a microorganism, a plant cell, or an animal cell that produces LDC may be used. One type of LDC or a cell that produces it may be used, or a mixture of two or more types may be used.
Further, the cells may be used as they are, or a cell treatment product containing LDC may be used. Examples of the cell treatment product include a cell lysate and a fraction thereof.

  Examples of the microorganism include E. coli. Escherichia bacteria such as E. coli, coryneform bacteria such as Brevibacterium lactofermentum, Bacillus subtilis such as Bacillus subtilis, Serratia marcescens such as Serratia marcescens And eukaryotic cells such as Saccharomyces cerevisiae. Among these, bacteria, in particular E. coli. E. coli is preferred.

  The microorganism may be a wild strain or a mutant strain as long as it produces LDC. Moreover, the recombinant strain modified so that LDC activity may increase may be sufficient. Plant cells or animal cells can also be recombinant cells that have been modified to increase LDC activity. The recombinant cell will be described later.

After starting the reaction by adding LDC to the lysine solution, as the reaction proceeds, carbon dioxide released from the lysine is released from the reaction solution, and the pH rises. Therefore, adipic acid is added to the reaction solution so that the pH of the reaction solution is in the above range. Adipic acid may be added continuously, or may be added in portions as long as the pH is maintained in the above range.
The reaction temperature is not particularly limited as long as LDC acts on lysine to produce cadaverine, but the temperature is usually 20 ° C or higher, preferably 30 ° C or higher, and usually 60 ° C or lower, preferably 40 ° C or lower. To do.

  The raw material lysine or lysine adipate may be added to the reaction solution in its entirety at the start of the reaction, or may be added in portions as the LDC reaction proceeds.

When the enzyme reaction is carried out batchwise, adipic acid can be easily added. The reaction can also be carried out by moving bed column chromatography using a carrier on which LDC, LDC-producing cells or treatments thereof are immobilized.
In that case, lysine and adipic acid may be injected into an appropriate part of the column so that the reaction proceeds while the pH of the reaction system is maintained within a predetermined range.

  As described above, the enzymatic reaction proceeds favorably by sequentially neutralizing the pH, which increases with cadaverine production by enzymatic decarboxylation of lysine, using adipic acid. The cadaverine thus produced accumulates in the reaction solution as an adipate.

The present embodiment is characterized in that polymer impurities having a molecular weight of 12,000 or more, preferably 5,000 or more, particularly preferably 1,000 or more are removed from a cadaverine salt aqueous solution obtained using LDC. To do.
There is no limitation on the timing of removing the polymer impurities from the cadaverine aqueous solution, and the cadaverine / hydrochloride aqueous solution, cadaverine / sulfate aqueous solution, cadaverine / phosphate aqueous solution, cadaverine · You may remove directly from carbonate aqueous solution, cadaverine dicarboxylate aqueous solution, etc.

When the microbial cells are used, the microbial cells in the cadaverine salt aqueous solution obtained by LDC may be sterilized and insoluble matters such as microbial cells may be removed by a method such as centrifugation.
Also, when the cadaverine salt aqueous solution is not a cadaverine dicarboxylate aqueous solution, the cadaverine salt aqueous solution is made into a cadaverine aqueous solution using an ion exchange resin or the like, and then an operation for removing polymer impurities is performed, and then the dicarboxylic acid is added. It may be added to obtain a cadaverine / dicarboxylate aqueous solution. Furthermore, after adding dicarboxylic acid to the said cadaverine aqueous solution and obtaining cadaverine dicarboxylate aqueous solution, operation which removes a polymer impurity may be performed.

Among these, in order to reduce the complexity of operation and increase the efficiency of polymer impurity removal, a method of removing polymer impurities from the cadaverine dicarboxylate aqueous solution from which insolubles have been removed after the reaction by LDC is preferable.
In particular, when crystallization is performed from an aqueous solution of cadaverine / dicarboxylate to obtain cadaverine / dicarboxylate, a high-quality polyamide resin cannot be obtained if polymer impurities are mixed into the crystallized salt. It is preferable to remove the polymer impurities before the step.

There is no limitation on the method for removing polymer impurities having a molecular weight of 12,000 or more, and examples thereof include a method using an adsorbent and a film treatment. Among them, a method using an ultrafiltration membrane (UF membrane) is preferable from the viewpoint of simplicity and removal effect.
The molecular weight range that can be removed by the type of the ultrafiltration membrane is determined. In the present embodiment, the molecular weight that can be removed is preferably 12,000 or more, more preferably 5,000 or more, and particularly preferably 1,000 or more.
Examples of polymer impurities to be removed include proteins, nucleic acids, and polysaccharides. In particular, when a reaction using microorganisms is involved, proteins are likely to be mixed, so the effect obtained by this embodiment is remarkable.

There are no restrictions on the material and shape of the ultrafiltration membrane. Specific examples of the material include cellulose acetate, polyethersulfone, polysulfone, polyvinylidene fluoride, polyvinylbenzyltrimethylammonium chloride, sodium polystyrenesulfonate, acrylonitrile copolymer, polyamide 12 and the like. Of these, acrylonitrile copolymers are preferred.
Examples of the membrane shape include a flat membrane, a hollow fiber, a plate, a tube, and a spiral winding. Among these, a hollow fiber is preferable.
Various ultrafiltration membrane modules are sold by various companies, but those made modular are preferable for ease of operation.

When polymer impurities are polymerized as at least a part of the raw material without removing polymer impurities from the aqueous cadaverine salt solution, many gels are present in the obtained polyamide resin. Such a gel causes a decrease in fluidity and mechanical properties in an injection-molded product, and causes a decrease in surface appearance due to fish eye (F / E) and a stretch fracture in a film and a filament.
Further, it is not preferable to remove a substance having an excessively low molecular weight because the operation becomes complicated and the productivity is lowered.

  The cadaverine salt aqueous solution from which the polymer impurities have been removed can be purified by a combination of known methods as necessary and used as a raw material for the polyamide resin.

  Next, as an example, a method for obtaining cadaverine adipate from the cadaverine adipate aqueous solution in the present embodiment will be specifically described by crystallization.

Since the cadaverine / adipate aqueous solution obtained from the biomass raw material is colored, it is preferable to decolorize it before crystallization, and examples of the decolorizing agent include activated carbon, synthetic adsorbent, activated clay, silica, zeolite, etc. Of these, activated carbon is preferred.
Examples of decolorization include a method in which a cadaverine / adipate aqueous solution is passed through a tower packed with a decolorizer, a method in which a decolorizer is added to and stirred in a cadaverine / adipate aqueous solution, and the former is preferred.

The aqueous solution of cadaverine and adipate after decolorization expels dissolved oxygen by nitrogen bubbling, and then the cadaverine and adipate concentration is concentrated to 50% to 69% by weight, preferably 60% to 67% by weight. If the cadaverine / adipate concentration is excessively small, the yield after crystallization is low, and if it is excessively large, the concentration of impurities mixed in the cadaverine / adipate increases, which is not preferable. Specifically, it is not preferable because the content of trifunctional or higher functional amino acids such as lysine and arginine is increased.
Concentration is preferably carried out at a temperature of 50 ° C. to 70 ° C. and a reduced pressure of 150 Torr or less of the cadaverine / adipate aqueous solution. If the temperature is too low, the concentration time becomes long, and if the temperature is too high, cadaverine adipate is decomposed, which is not preferable. In addition, if the degree of vacuum exceeds 150 Torr, the concentration time becomes longer, which is not preferable.

Crystallization is performed by cooling to precipitate cadaverine adipate. In this case, it is preferable to add the seed crystal during cooling. A seed crystal will not be specifically limited if the effect as a seed crystal is acquired. For example, precipitated cadaverine adipate is preferred.
The cooling rate during cooling is usually 1 ° C./h or more, preferably 2 ° C./h or more, more preferably 3 ° C./h or more. Moreover, it is 30 degrees C / h or less normally, Preferably it is 20 degrees C / h or less, More preferably, it is 10 degrees C / h or less. An excessively low temperature drop rate is not preferable because it tends to require time for crystallization. If the rate of temperature decrease is excessively high, the crystal size tends to be small, and the degree of purification tends to decrease.
The crystallization end temperature is usually 1 ° C. or higher, preferably 5 ° C. or higher, more preferably 10 ° C. or higher. Moreover, it is 30 degrees C or less normally, Preferably it is 25 degrees C or less, More preferably, it is 20 degrees C or less. An excessively high crystallization end temperature is not preferable because the yield tends to be low. If the crystallization end temperature is excessively low, it is not preferable because the piping is easily blocked when the cadaverine / adipate slurry is transferred.

  The crystallization rate is determined by the cadaverine / adipate concentration in the concentrate and the crystallization end temperature. Usually, it is 1% by weight or more, preferably 5% by weight or more, more preferably 10% by weight or more. Moreover, it is preferable to control to 46 weight% or less normally, Preferably it is 39 weight% or less, More preferably, it is 35 weight% or less. An excessively low crystallization rate is not preferable because the yield tends to be low. If the crystallization rate is excessively high, the concentration of impurities such as lysine, arginine and other trifunctional amino acids mixed in cadaverine / adipate is not preferable.

The cadaverine adipate slurry after crystallization is obtained as crystals by solid-liquid separation according to a conventional method. For example, when performing centrifugal filtration, after shaking off the mother liquor, sprinkle a small amount of demineralized water in the form of a shower while the centrifugal filter is rotating, and further wash away the mother liquor adhering to cadaverine and adipate. The degree of purification increases, which is preferable.
The amount of demineralized water is usually 1% by weight or more, preferably 5% by weight or more based on the wet cake (cadaverine adipate containing some water). Moreover, it is 40 weight% or less normally, Preferably it is 30 weight% or less. An excessively small amount of demineralized water is not preferable because the cleaning effect tends to be small. An excessively large amount of demineralized water is not preferable because the yield tends to decrease. The crystal thus obtained is referred to as the first crystal.

  The mother liquor and the washing liquid after the solid-liquid separation are collected, and again concentrated, crystallized, and solid-liquid separated to obtain the second crystal. Similarly, the third crystal, the fourth crystal and the like can be obtained.

  Next, a method for modifying microorganisms so that LDC activity is increased will be exemplified. For other cells, LDC activity can be similarly increased by appropriately modifying the following method so as to be suitable for the other cells.

  The LDC activity is increased by, for example, enhancing the expression of a gene encoding LDC (LDC gene). Enhanced expression of the LDC gene is achieved by increasing the copy number of the LDC gene. For example, an LDC gene fragment may be ligated with a vector that functions in a microorganism, preferably a multicopy vector, to produce a recombinant DNA, which is introduced into a suitable host and transformed.

Increasing the LDC gene copy number can also be achieved by having multiple copies of the LDC gene on the chromosomal DNA of the microorganism. In order to introduce a gene in multiple copies on the chromosomal DNA of a microorganism, homologous recombination is performed using a sequence present in multiple copies on the chromosomal DNA as a target.
As a sequence present in multiple copies on chromosomal DNA, repetitive DNA and inverted repeat present at the end of a transposable element can be used. Alternatively, as disclosed in JP-A-2-109985, a target gene can be mounted on a transposon and transferred to introduce multiple copies onto chromosomal DNA.

In addition to the gene amplification described above, the increase in LDC activity can also be achieved by replacing an expression regulatory sequence such as a promoter of LDC gene on chromosomal DNA or plasmid with a strong one. For example, lac promoter, trp promoter, trc promoter and the like are known as strong promoters.
Further, as disclosed in International Publication No. 00/18935 pamphlet, it is possible to introduce a base substitution of several bases into the promoter region of a gene and modify it to be more powerful. These promoter substitutions or modifications enhance LDC gene expression and increase LDC activity. Modification of these expression regulatory sequences may be combined with increasing the copy number of the gene.

  The replacement of the expression regulatory sequence can be performed, for example, in the same manner as the gene replacement using a temperature sensitive plasmid. E. Examples of the vector having a temperature-sensitive replication origin of E. coli include plasmid pMAN997 described in International Publication No. 99/03988 pamphlet. In addition, expression control is also performed by a method using red recombinase of λ phage (Datsenko, KA, Proc. Natl. Acad. Sci. USA (2000) 97 (12), 6640-6645). Sequence substitutions can be made.

  The LDC gene is not particularly limited as long as the encoded LDC can be effectively used for the lysine decarboxylation reaction. Examples thereof include bacteria such as E. coli, plants such as glass beans, and the LDC gene of microorganisms described in JP-A-2002-223770.

E. as a host microorganism When using E. coli, E. coli is used. The LDC gene derived from E. coli is preferred.
E. As the LDC gene of E. coli, cadA gene and ldc gene (US Pat. No. 5,827,698) are known, and among these, cadA gene is preferable.
E. The cadA gene of E. coli has a known sequence (N. Watson et al., Journal of Bacteriology (1992) vol. 174, p. 530-540; S. Y. Meng et al. Journal of Bacteriology (1992) vol. 174, p.2659-2668; GenBank accession M76411), by PCR using primers generated based on the sequence, E. coli. It can be isolated from E. coli chromosomal DNA.
Examples of such a primer include a primer having the base sequence shown in SEQ ID NO: 1 (sequence: GTTGCGGTTCTGCTTCCATCGCGCTGATG) and SEQ ID NO: 2 (sequence: ACCAAGCTGATGGGGTGAGAGAGAGAGATGAGAG).

In order to prepare a recombinant DNA by ligating the obtained LDC gene and the vector, the vector is cleaved with a restriction enzyme suitable for the end of the LDC gene, and the gene and the vector are used using a ligase such as T4 DNA ligase. What is necessary is just to connect.
E. Examples of the vector for E. coli include pUC18, pUC19, pSTV29, pHSG299, pHSG399, pHSG398, RSF1010, pBR322, pACYC184, pMW219 and the like.

The LDC gene may be a wild type or a mutant type. For example, a cadA gene encodes an LDC that includes a substitution, deletion, insertion, or addition of one or several amino acids at one or more positions, as long as the activity of the encoded LDC is not impaired. Also good.
Here, “several” differs depending on the position and type of the amino acid residue in the three-dimensional structure of the protein, but specifically 2 to 50, preferably 2 to 30, more preferably 2 -10.

DNA encoding a protein substantially identical to LDC as described above is cadA so that the amino acid residue at a specific site contains a substitution, deletion, insertion, addition or inversion, for example, by site-directed mutagenesis. It is obtained by modifying the base sequence of the gene.
The modified DNA as described above can also be obtained by a conventionally known mutation treatment. As the mutation treatment, a method for treating DNA before mutation treatment with hydroxylamine or the like in vitro, and a microorganism that retains the DNA before mutation treatment, for example, Escherichia bacterium, by ultraviolet light or N-methyl-N′-nitro-N— A method of treating with a mutagen that is usually used for mutagenesis treatment such as nitrosoguanidine (NTG) or ethylmethanesulfonic acid (EMS) is mentioned.

By expressing the DNA having the mutation as described above in an appropriate cell and examining the activity of the expression product, DNA encoding a protein substantially identical to LDC can be obtained.
In addition, it hybridizes with a probe having a cadA gene (GenBank accession M76411) coding region or a part of the same from a DNA encoding a mutated LDC or a cell carrying the same under stringent conditions. A DNA encoding a protein that is soybean and has an activity equivalent to that of LDC is obtained.

  The “stringent conditions” referred to herein are conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed. Although it is difficult to quantify these conditions clearly, for example, DNAs having high homology, for example, DNAs having a homology of 70% or more, preferably 80% or more, more preferably 90% or more, are present. 60 ° C., 1 × SSC, 0.1% SDS, preferably 0.degree. Which is a condition in which the DNAs hybridize to each other, thereby preventing the low homology DNAs from hybridizing to each other, or normal Southern hybridization. Examples include conditions for hybridizing at a salt concentration corresponding to 1 × SSC and 0.1% SDS.

  A partial sequence of the cadA gene can also be used as a probe. Such a probe can be prepared by PCR using an oligonucleotide prepared based on a known cadA gene base sequence as a primer and a DNA fragment containing the cadA gene as a template. When a DNA fragment having a length of about 300 bp is used as a probe, hybridization washing conditions include 50 ° C., 2 × SSC, and 0.1% SDS.

  Specifically, DNA encoding a protein substantially identical to LDC is preferably 70% or more, more preferably 80% or more, and still more preferably 90% or more homology with an amino acid sequence encoded by a known cadA gene. And a DNA encoding a protein having LDC activity.

In order to introduce the recombinant DNA into the microorganism, the transformation method reported so far may be performed. For example, as reported for Escherichia coli K-12, recipient cells are treated with calcium chloride to increase DNA permeability (Mandel, M. and Higa, A., J. Mol. Biol. , 53, 159 (1970)), and a method of introducing competent cells from proliferating cells and introducing DNA as reported for Bacillus subtilis (Ducan, CH, Wilson, G.). A. and Young, FE, Gene, 1, 153 (1997)).
Alternatively, DNA-receptive cells, such as those known for Bacillus subtilis, actinomycetes, and yeast, are introduced into the DNA-receptor cells in the form of protoplasts or spheroplasts that readily take up recombinant DNA. (Chang, S. and Choen, SN, Molec, Gen. Genet., 168, 111 (1979); Bibb, MJ, Ward, JM and Hopwood, O.A.,). Nature, 274, 398 (1978); Hinnn, A., Hicks, JB and Fink, GR Proc. Natl. Acad. Sci. USA, 75 1929 (1978)). Also, transformation of microorganisms can be performed by an electric pulse method (Japanese Patent Laid-Open No. 2-207791).

Culture for obtaining microorganisms or cells producing LDC may be performed by a method suitable for production of LDC depending on the microorganism or cells used.
For example, the medium may be a normal medium containing a carbon source, a nitrogen source, inorganic ions, and other organic components as required. Examples of carbon sources include glucose, lactose, galactose, fructose, arabinose, maltose, xylose, trehalose, ribose and starch hydrolysates; alcohols such as glycerol, mannitol and sorbitol; gluconic acid, fumaric acid, citric acid And organic acids such as succinic acid can be used.

As the nitrogen source, inorganic ammonium salts such as ammonium sulfate, ammonium chloride, and ammonium phosphate, organic nitrogen such as soybean hydrolysate, ammonia gas, aqueous ammonia, and the like can be used.
As organic micronutrients, it is desirable to contain an appropriate amount of required substances such as vitamins such as vitamin B1, nucleic acids such as adenine and RNA, or yeast extract. In addition to these, a small amount of calcium phosphate, magnesium sulfate, iron ion, manganese ion or the like is added as necessary.

In the case of Escherichia coli, the culture is preferably carried out for about 16 to 72 hours under aerobic conditions. The culture temperature is controlled to 30 ° C. to 45 ° C., and the pH during the culture is controlled to 5 to 8. In addition, an inorganic or organic acidic or alkaline substance, ammonia gas, or the like can be used for pH adjustment.
When the expression of the LDC gene is regulated by an inducible promoter, an inducing agent is added to the medium.

  After culturing, the cells can be recovered from the culture solution by collecting them with a centrifuge or a membrane. The cells may be used as they are, but when those treated products containing LDC are used, the cells are disrupted by ultrasonication, French press, or enzymatic treatment to extract the enzyme, and a cell-free extract is obtained. In the case of purifying LDC from, it can be purified by using ammonium sulfate or various chromatography according to a conventional method.

(Polyamide resin)
The polyamide resin to which this embodiment is applied contains a cadaverine unit and a dicarboxylic acid unit as constituent components, and may contain other copolymerization components as long as the effects of the present invention are not impaired.

  In this case, examples of the copolymer component include amino acids such as 6-aminocaproic acid, 11-aminoundecanoic acid, 12-aminododecanoic acid and paraaminomethylbenzoic acid; lactams such as ε-caprolactam and ω-laurolactam; oxalic acid , Fats such as malonic acid, succinic acid, glutaric acid, adipic acid, pimelic acid, suberic acid, azelaic acid, sebacic acid, undecanedioic acid, dodecanedioic acid, brassic acid, tetradecanedioic acid, pentadecanedioic acid, octadecanedioic acid Aromatic dicarboxylic acids such as cyclohexanedicarboxylic acid; Aromatic dicarboxylic acids such as phthalic acid, isophthalic acid, terephthalic acid, naphthalenedicarboxylic acid;

Ethylenediamine, 1,3-diaminopropane, 1,4-diaminobutane, 1,6-diaminohexane, 1,7-diaminoheptane, 1,8-diaminooctane, 1,9-diaminononane, 1,10-diaminodecane, 1,11-diaminoundecane, 1,12-diaminododecane, 1,13-diaminotridecane, 1,14-diaminotetradecane, 1,15-diaminopentadecane, 1,16-diaminohexadecane, 1,17-diaminoheptadecane Aliphatic diamines such as 1,18-diaminooctadecane, 1,19-diaminononadecane, 1,20-diaminoeicosane, 2-methyl-1,5-diaminopentane; cyclohexanediamine, bis- (4-aminohexyl) ) Alicyclic diamines such as methane; Aromatics such as xylylenediamine Amines.

Examples of the dicarboxylic acid used in the present embodiment include the same compounds as the above-mentioned aromatic dicarboxylic acid, aliphatic dicarboxylic acid, and alicyclic dicarboxylic acid.
These copolymerization components may be used individually by 1 type, and may use 2 or more types together.

(Production method of polyamide resin)
As a method for producing a polyamide resin to which the present embodiment is applied, a known method can be used, and specifically disclosed in “Polyamide Resin Handbook” (published by Nikkan Kogyo Co., Ltd .: Osamu Fukumoto). For example, as a method for producing polyamide 56, a method in which cadaverine adipate is mixed in the presence of water and heated to proceed with a dehydration reaction (heat polycondensation) is preferable.

  In addition, the said heat polycondensation in this Embodiment is a manufacturing process which raises the highest ultimate temperature of the polymerization reaction material in manufacture of a polyamide resin to 200 degreeC or more. The upper limit of the maximum reaction temperature is usually 300 ° C. or lower in consideration of the thermal stability during the polymerization reaction. The polymerization method is not particularly limited, and a batch method or a continuous method can be adopted.

  The polyamide resin produced by the above method can be further subjected to solid phase polymerization after heat polycondensation. Thereby, the molecular weight of the polyamide resin can be increased. The solid phase polymerization can be performed, for example, by heating in a vacuum or an inert gas at a temperature of 100 ° C. or higher and a melting point or lower.

The degree of polymerization of the polyamide resin to which the present embodiment is applied is not particularly limited, and the relative viscosity (η _r ) at 25 ° C. of a 98% sulfuric acid solution having a concentration of 0.01 g / ml is 1.5 to 8.0. It is preferable that it is 2.0-5.5.
If the relative viscosity (η _r ) is excessively low, the practical strength is insufficient. On the other hand, if the relative viscosity is excessively high, the fluidity is lowered and the moldability is impaired.
From the viewpoint of moldability, the relative viscosity (η _r ) is particularly preferably 3.0 to 5.5 for extrusion molding of films, fibers, monofilaments, and 2.0 to 3.5 for injection molding.

In the polyamide resin in the present embodiment, other components can be blended at any stage from the polymerization of the polyamide resin to the molding as long as the effects of the present invention are not impaired.
Examples of such other components include antioxidants and heat stabilizers (hindered phenols, hydroquinones, phosphites and their substitutes, copper halides, iodine compounds, etc.); weathering agents (resorcinols) , Salicylates, benzotriazoles, benzophenones, hindered amines, etc.); mold release agents and lubricants (aliphatic alcohols, aliphatic amides, aliphatic bisamides, bisureas, polyethylene waxes, etc.); pigments (cadmium sulfide, phthalocyanine, carbon) Dye (Nigrosine, aniline black, etc.); Plasticizer (octyl p-oxybenzoate, N-butylbenzenesulfonamide, etc.);

Antistatic agents (alkyl sulfate type anionic antistatic agents, quaternary ammonium salt type cationic antistatic agents, nonionic antistatic agents such as polyoxyethylene sorbitan monostearate, betaine amphoteric antistatic agents, etc.); difficult Flame retardant (hydramine such as melamine cyanurate, magnesium hydroxide, aluminum hydroxide, ammonium polyphosphate, brominated polystyrene, brominated polyphenylene oxide, brominated polycarbonate, brominated epoxy resin or brominated flame retardant and trioxide Combination with antimony); other polymers (other polyamides, polyethylene, polypropylene, polyester, polycarbonate, polyphenylene ether, polyphenylene sulfide, liquid crystal polymer, polysulfone, polyethersulfone, ABS resin, SAN Fat, polystyrene, etc.).
These other components are preferably melt kneaded using a dry blend or an extruder.

In addition, when the polyamide resin of the present embodiment is used for a film, an inorganic filler such as talc, kaolin, calcined kaolin, silica, zeolite, etc., particularly a fine inorganic filler may be blended for improving the slipping property. preferable. More preferably, the aspect which uses together an inorganic filler, a mold release agent, and / or a lubricant is mentioned.
The blending amount of the inorganic filler is preferably 0.005 to 0.1 parts by weight per 100 parts by weight of the polyamide resin. The release agent and / or lubricant is preferably used in an amount of 0.01 to 0.5 parts by weight per 100 parts by weight of the polyamide resin.

  Further, the polyamide resin of the present embodiment can be molded into a desired shape by any molding method such as injection molding, film molding, melt spinning, blow molding, vacuum molding and the like. Examples of the molded product include injection molded products, films, sheets, filaments, tapered filaments, fibers, and the like. Polyamide resins can also be used for adhesives, paints, and the like.

  Further, specific examples of applications of the polyamide resin of the present embodiment include, for example, an intake manifold, a clip with a hinge (molded product with a hinge), a binding band, a resonator, an air cleaner, and an engine cover as automobile / vehicle-related parts. , Rocker cover, cylinder head cover, timing belt cover, gasoline tank, gasoline sub tank, radiator tank, intercooler tank, oil reservoir tank, oil pan, electric power steering gear, oil strainer, canister, engine mount, junction block, relay block, connector, corrugated Automotive under hood parts such as tubes and protectors; door handles, fenders, hood bulges, roof rail legs, door mirror stays, vans Chromatography, spoilers, automobile exterior parts such as wheel covers, cup holders, console boxes, accelerator pedals, clutch pedals, shift lever pedestals, automobile interior parts such as a shift lever knob and the like.

  Further, the polyamide resin of the present embodiment includes fishing line, fishing net and other fishery-related materials, switches, micro slide switches, DIP switches, switch housings, lamp sockets, cable ties, connectors, connector housings, connector shells. , IC sockets, coil bobbins, bobbin covers, relays, relay boxes, condenser cases, motor internal parts, small motor cases, gears / cams, dancing pulleys, spacers, insulators, casters, terminal blocks, power tool housings, starter Electrical / electronic parts such as insulation parts, fuse boxes, terminal housings, bearing retainers, speaker diaphragms, heat-resistant containers, microwave oven parts, rice cooker parts, printer ribbon guides, etc. Parts, computer-related parts, facsimile-copier-related parts, can be used in the machine-related parts such as various applications.

(Polyamide resin film molding method)
The polyamide resin film in the present embodiment can be formed by a known method. For example, a T-die method in which a melt of a polyamide resin composition obtained by dry blending a release agent or a lubricant with a polyamide resin is continuously extruded from a T-die and cooled into a film by a casting roll; For example, a water-cooled inflation method in which water is extruded from a continuous die and cooled by contact with water; an air-cooled inflation method in which the material is extruded from an annular die and cooled by air is used. Moreover, a multilayer film can also be obtained by a coextrusion method in which other materials are simultaneously extruded by these molding methods.

If necessary, it can be used as a uniaxially or biaxially stretched film. A known method can be applied as the stretching method. For example, in the case of a film formed by the T-die method, the roll method is used for longitudinal stretching (uniaxial stretching). Furthermore, when extending | stretching to a horizontal direction, the sequential biaxial stretching method which uses a tenter system is mentioned. For the tubular film formed from an annular die, a tubular stretching method that can be simultaneously stretched in the vertical and horizontal directions is used in addition to the sequential biaxial stretching method.
Each layer can be stretched (co-stretched) at the same time by the same method for the coextruded film. The stretching ratio is 2 to 4 times, preferably 2 to 3.5 times in both the vertical and horizontal directions.

The thickness of the polyamide resin film in the present embodiment is preferably 1 μm to 70 μm. If the thickness of the film is excessively small, the strength tends to be insufficient, and if it is excessively large, the bending fatigue resistance tends to decrease.
When the film is a polyamide resin monolayer film, the thickness is more preferably 5 μm to 50 μm, still more preferably 10 μm to 30 μm. When the film is a multilayer film, the thickness as the polyamide resin layer is more preferably 2 μm to 50 μm, still more preferably 5 μm. ˜30 μm.

The polyamide resin film in the present embodiment can also be used after corona treatment on one side or both sides in order to improve printability or laminate properties (adhesiveness).
In the present embodiment, an injection molded product of polyamide resin molded into a desired shape can be obtained by an injection molding method.

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to the description of these examples.
[Relative viscosity (η _r )]
The sample was dissolved in 98% concentrated sulfuric acid to a concentration of 0.01 g / ml, and measured at 25 ° C. using an Ostwald viscometer. The (sample solution falling time) / (concentrated sulfuric acid falling time) was the relative viscosity. (Η _r ).

[DSC (Differential Scanning Calorimetry)]
About 5 mg of a sample was collected under a nitrogen atmosphere using a Seiko Electronics robot DSC and measured under the following conditions.
After the polyamide resin is completely melted and held for 3 minutes, the temperature of the exothermic peak that appears when the temperature is lowered to 30 ° C. at a temperature lowering rate of 20 ° C./min (temperature-lowering crystallization temperature Tc), followed by 30 After holding at 3 ° C. for 3 minutes, an endothermic peak temperature (melting point Tm) observed when the temperature was raised from 30 ° C. at a rate of temperature increase of 20 ° C./min was determined. When there were a plurality of endothermic peaks, the highest temperature was defined as the melting point Tm.

[Static friction coefficient (sliding property)]
The coefficient of static friction was measured by a parallel movement method under conditions of a relative humidity of 65% and a temperature of 23 ° C.

[F / E (fisheye) number]
A polyamide resin film having a thickness of 40 μm is formed from the polyamide resin raw material using a T-die type film forming machine having an extruder cylinder diameter of 30 mmφ. The film forming conditions are: the cylinder set temperature of the extruder is 280 ° C., the cooling roll temperature for winding the polyamide resin film is 90 ° C., and the discharge amount is 2 kg / hour.
A granular defect having an area of 900 cm ² having a size of 50 μm or more was defined as a fish eye, and the number of the fish eye was counted (unit: piece / 900 cm ² ).

[Number average molecular weight]
(1) Terminal amino group After 0.1 g to 2 g of a polyamide resin sample was accurately weighed and dissolved in 50 ml of phenol, 0.1N hydrochloric acid was used using an automatic titrator (manufactured by Mitsubishi Chemical Corporation, GT-06). And calculated (unit: eq / g).
(2) Terminal carboxyl group After 0.1 g to 2 g of a polyamide resin sample was accurately weighed and dissolved in 50 ml of benzyl alcohol, an automatic titrator (manufactured by Mitsubishi Chemical Co., Ltd., GT-06) or a normal burette type titration Titration with 0.1N sodium hydroxide was performed using an apparatus, and calculation was performed (unit: eq / g).
(3) Number average molecular weight The number average molecular weight was calculated according to the following formula from the total number of terminals determined by the methods (1) and (2).

[Spiral flow length]
Molding of a spiral flow test piece was performed using a J75EII type injection molding machine manufactured by Nippon Steel Works, at a resin temperature of 265 ° C., a mold temperature of 75 ° C., an injection pressure of 50 MPa, and a spiral flow test piece thickness of 3 mm. The length of the spiral flow test piece was measured and defined as the spiral flow length (unit: mm).

[Preparation of lysine decarboxylase gene (cadA) -enhanced strain]
(A) Escherichia coli DNA extraction LB medium [composition: tryptone 10 g, yeast extract 5 g, NaCl 5 g dissolved in 1 L of distilled water] 10 mL of Escherichia coli JM109 strain was cultured until the late logarithmic phase, and the resulting bacteria The body was suspended in 0.15 mL of 10 mM NaCl / 20 mM Tris buffer (pH 8.0) / 1 mM EDTA · 2Na solution containing 10 mg / mL lysozyme.

  Next, proteinase K was added to the suspension so that the final concentration was 100 μg / mL, and the mixture was incubated at 37 ° C. for 1 hour. Further, sodium dodecyl sulfate was added to a final concentration of 0.5%, and the mixture was incubated at 50 ° C. for 6 hours for lysis. To this lysate, add an equal amount of phenol / chloroform solution, shake gently at room temperature for 10 minutes, and then centrifuge (5,000 × g, 20 minutes, 10 ° C. to 12 ° C.) to obtain the supernatant. Fractions were collected and sodium acetate was added to a concentration of 0.3 M, and then twice the amount of ethanol was added and mixed. The precipitate collected by centrifugation (15,000 × g, 2 minutes) was washed with 70% ethanol and then air-dried. To the obtained DNA, 5 mL of a 10 mM Tris buffer (pH 7.5) -1 mM EDTA · 2Na solution was added and allowed to stand at 4 ° C. overnight, and used as template DNA for subsequent PCR.

(B) Cloning of cadA E. coli cadA is obtained by using the DNA prepared in the above (A) as a template and the sequence of the gene of E. coli K12-MG1655 strain (GenBank Database Accession No. U00096) for which the entire genome sequence has been reported. PCR was carried out using synthetic DNAs (SEQ ID NO: 1 (sequence; GTTGCGGTTCTGCTTCCATCGCGCTGATG) and SEQ ID NO: 2 (sequence; ACCAAGCTGATGGGTGGAGAGAGAGATGAGTAAG)) designed based on the above.

(Reaction solution composition)
Template DNA 1 μL, Pfx DNA polymerase (manufactured by Invitrogen) 0.2 μL, 1 × concentration attached buffer, 0.3 μM each primer, 1 mM MgSO ₄ , 0.25 μM dNTPs were mixed to make a total volume of 20 μL.

(Reaction temperature conditions)
Using a DNA thermal cycler (PTJ-200 manufactured by MJ Research), a cycle consisting of 94 ° C. for 20 seconds, 60 ° C. for 20 seconds, and 72 ° C. for 2.5 minutes was repeated 35 times. However, the heat retention at 94 ° C. in the first cycle was 1 minute and 20 seconds, and the heat retention at 72 ° C. in the final cycle was 10 minutes.

FIG. 1 is a diagram for explaining the procedure for cloning cadA.
As shown in FIG. 1, after completion of the PCR reaction, the amplified product was purified by ethanol precipitation, and then cleaved with restriction enzyme KpnI and restriction enzyme SphI. This DNA preparation was separated by 0.75% agarose (SeaKem GTG agarose: manufactured by FMC BioProducts) gel electrophoresis, and visualized by ethidium bromide staining to detect a fragment of about 2.6 kb containing cadA, and QIAQuick Gel The DNA fragment of interest was recovered using an Extraction Kit (manufactured by QIAGEN).

The recovered DNA fragment was mixed with a DNA fragment prepared by cleaving E. coli plasmid vector pUC18 (Takara Shuzo Co., Ltd.) with restriction enzymes KpnI and restriction enzyme SphI, and ligation kit ver. After ligation using 2 (Takara Shuzo Co., Ltd.), Escherichia coli (JM109 strain) was transformed with the obtained plasmid DNA.
The recombinant Escherichia coli thus obtained was smeared on an LB agar medium containing 50 μg / mL ampicillin, 0.2 mM IPTG (isopropyl-β-D-thiogalactopyranoside) and 50 μg / mL X-Gal.

  Clones that formed white colonies on this medium were subjected to liquid culture by a conventional method, and then plasmid DNA was purified. By cleaving the obtained plasmid DNA with restriction enzymes KpnI and restriction enzyme SphI, it was confirmed that an inserted fragment of about 2.5 kb was observed, and these E. coli strains containing pCAD1 and pCAD1 were named JM109 / pCAD1, respectively. did.

[Preparation of cadaverine / adipate aqueous solution (1)]
The reaction solution (cadaverine / adipate aqueous solution) used in the following examples was prepared by the following method using a cadA amplified strain and lysine / adipate as a raw material.
(1) Culture of cadA amplified strain E. coli JM109 / pCAD1 was pre-cultured in 10 flasks containing LB medium, and then 1 L of the culture solution was inoculated into a 200 L jar fermenter containing 99 L of LB medium, and aerated at 0.5 vvm, 35 ° C., 250 rpm. Stirring culture was performed.
Six hours after the start of the culture, the whole culture solution was inoculated into a 5 m ³ volume culture tank containing 3 m ³ of 2 × LB medium and further cultured. The culture conditions in a 5 m ³ volume culture tank were an aeration rate of 0.5 vvm and 35 ° C. The stirring rotation speed was adjusted in the range of 60 to 100 rpm so that the dissolved oxygen concentration had a sufficiently high value. At 4 hours of culture, sterilized IPTG (isopropyl-β-D-thiogalactopyranoside) was added to a final concentration of 0.5 mM, and then the culture was continued for 14 hours.

(2) Separation of bacterial cells Under the conditions of 6,400 rpm and a feed rate of 750 L / hr, the bacterial cells were collected from the culture solution using an Alfa Laval separator. The wet weight of the collected cells was 36.9 kg. After suspending the wet cells in 160 L of 10 mM sodium acetate solution, the cells were collected again with a sharp press centrifuge at 15,000 rpm and a feed rate of 1.0 L / min, and 18.7 kg of wet cells were collected. Acquired the body.

(3) Manufacture of cadaverine and adipate Addition of adipic acid to 50% (w / v) lysine base solution (manufactured by Kyowa Hakko Kogyo Co., Ltd.) so that pH is 6.0, A concentrated solution of was prepared. A substrate solution (3 m ³ ) was prepared so as to have a lysine concentration of 60 g / L, and placed in a 5 m ³ culture tank. Pyridoxal phosphate was added to the substrate solution to 0.1 mM, and E. coli was further added. The reaction was started by adding E. coli JM109 / pCAD1 cells so that the OD660 was 0.5.

The reaction conditions were 37 ° C., 0.5 vvm aeration, and 70 rpm. The pH of the solution during the reaction was controlled to be 6.5 by adding a slurry in which 250 kg of adipic acid was suspended in 400 L of ion-exchanged water.
Further, a substrate concentrated solution (600 L) having a lysine concentration of 318 g / L was continuously fed at about 130 L / h from the start, and the whole amount was added in about 4.5 hours. The reaction was further continued for a total of 22 hours.

At the end of the reaction, the residual concentration of lysine was 0.03 g / L or less, and almost 100% of lysine was converted to cadaverine.
The solution after the reaction was inactivated (80 ° C., 30 min) to obtain a cadaverine / adipine salt aqueous solution (about 3.9 m ³ ) containing approximately equimolar amounts of cadaverine and adipic acid.

(4) UF membrane treatment (A) Removal of polymer impurities with a molecular weight of 13,000 or more Through the UF membrane module ACP-3053 (manufactured by Asahi Kasei Kogyo Co., Ltd.) for removing polymer impurities with a molecular weight of 13,000 or more, Impurities were removed to obtain about 1.3 m ³ of cadaverine / adipate aqueous solution (a). The recovery rate by the UF membrane treatment was 99.4%.

(B) Removal of polymer impurities having a molecular weight of 6,000 or more The impurities of the polymer molecules are removed through a UF membrane module AIP-0013UF (manufactured by Asahi Kasei Kogyo Co., Ltd.) that removes polymer impurities having a molecular weight of 6,000 or more. A 1.3 m ³ cadaverine-adipate aqueous solution (b) was obtained. The recovery rate by the UF membrane treatment was 99.1%.

(C) Untreated UF membrane A cadaverine / adipate aqueous solution (c) of about 1.3 m ³ was obtained without performing the UF membrane treatment.

[Purification and isolation of cadaverine adipate (A)]
(1) Decolorization by activated carbon Activated carbon MM-11 (35 kg, about 150 L) manufactured by Mitsubishi Chemical Calgon Co., Ltd. was charged into an activated carbon tower having a diameter of 500 mm, and demineralized water was passed through for 2 days. Next, the cadaverine adipate aqueous solution (a) (about 1.3 m ³ ) was passed at a rate of 1.32 m ³ / h, and finally 200 L of demineralized water was passed. After initially purging 150 L, activated carbon-treated cadaverine / adipate aqueous solution was collected.

(2) Concentration Through the PP pleated cartridge filter TCP-JX, the activated cadaverine / adipate aqueous solution (a) is charged into a 2 m ³ stirring tank, jacket temperature is 110 ° C., internal temperature is 57 ° C., and the degree of vacuum is 140 to 150 Torr. The cadaverine / adipate concentration was adjusted to 63.5 wt% to obtain a concentrated solution.

  The cadaverine concentration in the cadaverine / adipate aqueous solution such as the above concentrated solution was titrated with a 1N-HCl aqueous solution and calculated from the titration amount up to the inflection point of pH. Similarly, the concentration of adipic acid in the cadaverine / adipate aqueous solution such as the above concentrated solution was titrated with a 1N-NaOH aqueous solution and calculated from the titration amount up to the inflection point of pH. For titration, an automatic titration apparatus (GT-06 model manufactured by Mitsubishi Chemical Corporation) was used.

(3) Crystallization Next, crystallization was performed in the same 2m ³ stirring tank of the concentrated liquid. 350 g of stirring blades were added, 350 g of cadaverine adipate prepared in advance was added as a seed crystal when the stirring speed was 40 rpm, the cooling rate was 8 ° C./h, and the internal temperature was 38 ° C. At the end of crystallization at 10 ° C., a cadaverine / adipate slurry was obtained. Cadaverine adipate as a seed crystal was prepared on a lab scale according to this example.

(4) Centrifugal filtration The cadaverine adipate slurry was centrifugally filtered using a centrifugal filter having a diameter of 1.22 m. The number of revolutions was 980 rpm, the mother liquor was shaken off for 15 minutes, and after washing off the mother liquor, about 15 kg of demineralized water at 10 ° C. was sprinkled and washed, and the demineralized water was shaken off for 15 minutes. About 70 kg of wet cake obtained as the first crystal was obtained, and about 60 kg of cadaverine adipate (a) was obtained.
The weight of the cadaverine adipate is measured by measuring the moisture content of the wet cake with a moisture meter (coulometric titration moisture measuring device CA-06 type and moisture vaporizer VA-06 type manufactured by Mitsubishi Chemical Corporation). Calculated.

[Purification and isolation of cadaverine adipate (B)]
Using the cadaverine adipate aqueous solution (b) (about 1.3 m ³ ), the wet cake was about 70 kg in the same manner as [Purification and isolation of cadaverine adipate (A)]. About 60 kg of adipate (b) was obtained.

[Purification and isolation of cadaverine adipate (C)]
Using the cadaverine adipate aqueous solution (c) (about 1.3 m ³ ), the wet cake was about 70 kg in the same manner as [Purification and isolation of cadaverine adipate (A)]. About 60 kg of adipate (c) was obtained.

[Example 1]
<Manufacture of polyamide resin>
After 25 kg of water was added to 25 kg of the cadaverine adipate (a), 1.25 g of phosphorous acid was added, and the mixture was completely dissolved under a nitrogen atmosphere to obtain a raw material aqueous solution. The raw material aqueous solution was transferred to an autoclave which had been previously purged with nitrogen by a plunger pump. The jacket temperature was adjusted to 280 ° C., the autoclave pressure was adjusted to 1.47 MPa, and the contents were heated to 270 ° C.

Next, after gradually releasing the pressure in the autoclave, the pressure was further reduced and the reaction was terminated when a predetermined stirring power was reached. After completion of the reaction, the pressure was restored with nitrogen, and the contents were introduced into a cooling water tank in the form of a strand and then pelletized with a rotary cutter. The obtained pellets were dried under the conditions of 120 ° C. and 1 torr (0.13 kPa) until the water content became 0.1% or less to obtain a polyamide resin. The relative viscosity (η _r ) was 3.51.

<Film forming>
For 100 parts by weight of the obtained polyamide resin, 0.03 part by weight of talc having an average particle size of 3.0 μm and 0.1 part by weight of ethylenebisstearic acid amide (Kao Wax EB-FF, manufactured by Kao Corporation) Using a polyamide resin composition obtained by dry blending as a raw material, using a T-die film forming machine having an extruder cylinder diameter of 40 mm, an extruder cylinder set temperature of 260 ° C., a cooling roll temperature of 90 ° C., and a film having a thickness of 25 μm Was formed.
The heat resistance (melting point), slipperiness (coefficient of static friction), and fish eye (F / E) were evaluated using the film for 1 hour after the start of film formation. The results are shown in Table 1.

[Example 2]
In Example 1, except that cadaverine adipate (b) was used, polyamide resin was obtained (relative viscosity (η _r ) 3.52), film formation, and evaluation was performed in the same manner as in Example 1. It was. The results are shown in Table 1.

[Example 3]
A polyamide resin was obtained (relative viscosity (η _r ) 2.72) in the same manner as in Example 1 except that the stirring power at the end of the polymerization was changed. Using the obtained polyamide resin, the terminal amino group and terminal carboxyl group were measured, and the number average molecular weight was calculated. The results are shown in Table 1.

<Formation of spiral flow test piece>
Spiral flow test piece molding using as raw material a polyamide resin composition obtained by dry blending 0.03 part by weight of talc having an average particle size of 3.0 μm as a crystal nucleating agent with respect to 100 parts by weight of the obtained polyamide resin. Went.
Molding was performed using a J75EII type injection molding machine manufactured by Nippon Steel, Ltd. at a resin temperature of 265 ° C., a mold temperature of 75 ° C., an injection pressure of 50 MPa, and a spiral flow test piece thickness of 3 mm. Table 1 shows the spiral flow length.

[Example 4]
A polyamide resin was obtained (relative viscosity (η _r ) 2.72) in the same manner as in Example 2 except that the stirring power at the end of the polymerization was changed. Using the obtained polyamide resin, the terminal amino group and terminal carboxyl group were measured, and the number average molecular weight was calculated. The results are shown in Table 1.

<Formation of spiral flow test piece>
Spiral flow test piece molding using as raw material a polyamide resin composition obtained by dry blending 0.03 part by weight of talc having an average particle size of 3.0 μm as a crystal nucleating agent with respect to 100 parts by weight of the obtained polyamide resin. Went.
Molding was performed using a J75EII type injection molding machine manufactured by Nippon Steel, Ltd. at a resin temperature of 265 ° C., a mold temperature of 75 ° C., an injection pressure of 50 MPa, and a spiral flow test piece thickness of 3 mm. Table 1 shows the spiral flow length.

[Comparative Example 1]
In Example 1, polyamide resin was obtained (relative viscosity (η _r ) 3.54), film formation, and evaluation was performed in the same manner as in Example 1 except that cadaverine adipate (c) was used. It was. The results are shown in Table 1.

[Comparative Example 2]
<Manufacture of polyamide resin>
A polyamide resin was obtained (relative viscosity (η _r ) 3.03) in the same manner as in Comparative Example 1 except that the stirring power at the end of the polymerization was changed. Using the obtained polyamide resin, the terminal amino group and terminal carboxyl group were measured, and the number average molecular weight was calculated. The results are shown in Table 1.

<Formation of spiral flow test piece>
In the same manner as in Example 4, a spiral flow test piece was molded. Table 1 shows the spiral flow length.

As described above in detail, the method for producing a cadaverine salt aqueous solution in the present embodiment is characterized by removing polymer impurities such as proteins, nucleic acids, and polysaccharides. Polyamide resin made from this material is less likely to generate gel due to crosslinking or the like, and can be used very suitably for films, injection-molded products, fibers, monofilaments, and the like. Specifically, it is possible to obtain a polyamide resin film, fiber, and monofilament having a very small fish eye and excellent surface appearance, and the fluidity during injection molding is remarkably excellent.
Furthermore, since biomass-derived raw materials can be used, it is extremely effective in preventing global warming and forming a recycling society.

It is a figure explaining the procedure of cloning of cadA.

Claims (3)

A method for producing a cadaverine salt aqueous solution that removes polymer impurities having a molecular weight of 12,000 or more by ultrafiltration membrane (UF membrane) treatment,
Cadaverine is produced from lysine using lysine decarboxylase, a recombinant microorganism having improved lysine decarboxylase activity, a cell producing lysine decarboxylase, or a treated product of the cell. A method for producing an aqueous cadaverine salt solution.   Furthermore, the polymeric impurity with a molecular weight of 5,000 or more is removed, The manufacturing method of the cadaverine salt aqueous solution of Claim 1 characterized by the above-mentioned.   The method for producing an aqueous cadaverine salt solution according to claim 1 or 2, wherein the cadaverine salt is a dicarboxylate.

Images