CN102056889A - Process for production of pentamethylenediamine, and process for production of polyamide resin - Google Patents

Process for production of pentamethylenediamine, and process for production of polyamide resin Download PDF

Info

Publication number
CN102056889A
CN102056889A CN2009801211083A CN200980121108A CN102056889A CN 102056889 A CN102056889 A CN 102056889A CN 2009801211083 A CN2009801211083 A CN 2009801211083A CN 200980121108 A CN200980121108 A CN 200980121108A CN 102056889 A CN102056889 A CN 102056889A
Authority
CN
China
Prior art keywords
methylene diamine
carbonate
methionin
manufacture method
methylene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN2009801211083A
Other languages
Chinese (zh)
Other versions
CN102056889B (en
Inventor
人见达也
草野一直
横木正志
山本正规
浦嶋英俊
宫奥康平
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Mitsubishi Chemical Corp
Mitsubishi Rayon Co Ltd
Original Assignee
Mitsubishi Kasei Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mitsubishi Kasei Corp filed Critical Mitsubishi Kasei Corp
Publication of CN102056889A publication Critical patent/CN102056889A/en
Application granted granted Critical
Publication of CN102056889B publication Critical patent/CN102056889B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08G—MACROMOLECULAR COMPOUNDS OBTAINED OTHERWISE THAN BY REACTIONS ONLY INVOLVING UNSATURATED CARBON-TO-CARBON BONDS
    • C08G69/00—Macromolecular compounds obtained by reactions forming a carboxylic amide link in the main chain of the macromolecule
    • C08G69/02—Polyamides derived from amino-carboxylic acids or from polyamines and polycarboxylic acids
    • C08G69/26—Polyamides derived from amino-carboxylic acids or from polyamines and polycarboxylic acids derived from polyamines and polycarboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C209/00—Preparation of compounds containing amino groups bound to a carbon skeleton
    • C07C209/68—Preparation of compounds containing amino groups bound to a carbon skeleton from amines, by reactions not involving amino groups, e.g. reduction of unsaturated amines, aromatisation, or substitution of the carbon skeleton
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C209/00—Preparation of compounds containing amino groups bound to a carbon skeleton
    • C07C209/82—Purification; Separation; Stabilisation; Use of additives
    • C07C209/84—Purification
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08G—MACROMOLECULAR COMPOUNDS OBTAINED OTHERWISE THAN BY REACTIONS ONLY INVOLVING UNSATURATED CARBON-TO-CARBON BONDS
    • C08G69/00—Macromolecular compounds obtained by reactions forming a carboxylic amide link in the main chain of the macromolecule
    • C08G69/02—Polyamides derived from amino-carboxylic acids or from polyamines and polycarboxylic acids
    • C08G69/26—Polyamides derived from amino-carboxylic acids or from polyamines and polycarboxylic acids derived from polyamines and polycarboxylic acids
    • C08G69/28—Preparatory processes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Polyamides (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)

Abstract

Disclosed are: a process for producing purified pentamethylenediamine by simple production steps and in high yield; and others. The process for producing purified pentamethylenediamine comprises: a thermal decomposition step of heating pentamethylenediamine carbonate to yield crude pentamethylenediamine and carbon dioxide; and a distillation step of distilling the crude pentamethylenediamine produced in the thermal decomposition step to yield pentamethylenediamine, wherein the concentration of pentamethylenediamine in the crude pentamethylenediamine is 30 mol% or more relative to the total concentration of pentamethylenediamine and pentamethylenediamine carbonate.

Description

The manufacture method of five methylene diamine and the manufacture method of polyamide resin
Technical field
The present invention relates to the manufacture method of five methylene diamine etc., in more detail, relate to and comprise the manufacture method etc. of five methylene diamine carbonate being carried out the five methylene diamine of disaggregating treatment.
Background technology
As plastic raw materials, use so-called fossil feedstock mostly.Except that the situation of regeneration, during waste plastic, by the burning etc. the discarded emission of carbon-dioxide that causes, so becoming problem in recent years.So towards preventing global warming and form circular form society, the manufacturing raw material that people wait in expectation plastics replaces with the raw material that derives from biomass.Such demand spreads all over many-sides such as injection-molded articles such as film, trolley part, electrical and electronic parts, mechanical part, fiber, monofilament.
Under such background, for using the five methylene diamine (the following cadaverine that abbreviates as sometimes) that obtains from Methionin as 56 nylon of raw material and 56/66 nylon etc., its polymkeric substance as plant origin makes us expecting very much.Polyamide resin just is being used to a lot of fields in aspect excellences such as physical strength, thermotolerance, chemical proofings as one of so-called engineering plastics.
In the past, as the manufacture method of five methylene diamine, can enumerate following report (referring to patent documentation 1～patent documentation 4).
Put down in writing a kind of method in the patent documentation 1, wherein, the adding carbonatoms is 4～10 dicarboxylic acid, so that the pH of lysine solution maintains pH4.0～8.0 that are suitable for the enzymatic decarboxylic reaction, carry out the enzymatic decarboxylic reaction of Methionin simultaneously, generate the cadaverine dicarboxylate thus.
Put down in writing a kind of method in the patent documentation 2, wherein, make the L-Methionin dicarboxylate aqueous solution with the intestinal bacteria that imported L-lysine decarboxylase gene or be present in the partial intestinal bacteria of cell surface with the L-lysine decarboxylase and contact, the L-lysine fermentation liquor that use is fermented by the dicarboxyl acid for adjusting pH time prepares the L-lysine decarboxylase, thereby makes the cadaverine dicarboxylate.
Put down in writing a kind of method in the patent documentation 3, wherein, in colibacillary cytoclasis liquid, import the L-lysine decarboxylase gene that on the N-terminal aminoacid sequence, is added with 6 Histidines, making the L lysine HCL of high density contact or be present in the partial intestinal bacteria of cell surface with the L-lysine decarboxylase with this colibacillary cytoclasis liquid contacts, do not need to regulate pH thus, and generate cadaverine with high density, high reaction yield, high production speed, this reaction solution is adjusted to more than the pH13, extract, distill with polar organic solvent, make cadaverine thus.
Put down in writing a kind of method in the patent documentation 4, wherein, with Methionin carbonate is substrate, after adding carbonic acid gas adjustment pH, utilize the enzymatic decarboxylic reaction of Methionin to generate cadaverine carbonate, in the cadaverine carbonate that generates, add dicarboxylate, carry out the salt permutoid reaction with carbonic acid after, through separation circuit, make the cadaverine dicarboxylate.
The prior art document
Patent documentation
Patent documentation 1: TOHKEMY 2005-006650 communique
Patent documentation 2: TOHKEMY 2004-208646 communique
Patent documentation 3: TOHKEMY 2004-14 communique
Patent documentation 4: the international brochure that discloses No. 2006/123778
Summary of the invention
In addition, can from reaction solution, separate, generate the cadaverine dicarboxylate that obtains by the enzymatic decarboxylic reaction of Methionin (below be sometimes referred to as LDC react) by the combination known method.For example,, separate out the cadaverine dicarboxylate by the reaction solution after will concentrating cooling, thereafter, the crystallization that utilizes common solid-liquid separating method such as centrifugation to isolate the cadaverine dicarboxylate.
But the crystallization method not only is difficult to obtain the cadaverine dicarboxylate with high yield, and, can not remove impurity fully, so have painted problem with its polymeric amide that is raw material obtains.
And, as the method for from reaction solution, obtaining the cadaverine that generates by LDC reaction, known following method: in reaction terminating liquid, add alkali such as sodium hydroxide, the pH of reaction solution is adjusted into 12～14 after, with trichloromethane isopolarity organic solvent extraction cadaverine.But organic solvent is harmful mostly, and particularly trichloromethane has acute toxicity, so its operability is not preferred.And, if when extracting with an organic solvent, then not reclaiming under the situation of organic solvent influences cost greatly, reclaims the problem that exists manufacturing process to complicate under the situation of organic solvent.And, reclaiming under the situation of organic solvent, the operation that need reclaim exists not only that technology complicates, and also unfavorable and so on the problem in energy aspect.
In addition, also consider following method: at 40 ℃ of left and right sides concentrating under reduced pressure, carbanion etc. is come out as Carbon emission the cadaverine carbonate aqueous solution, obtain the method for cadaverine thus.But, need the long period to separate carbanion etc. sometimes from cadaverine carbonate.
And, the known macromolecule impurities such as impurity that Methionin etc. has 3 above functional groups or protein that in the five methylene diamine carbonate aqueous solution in biomass sources, exist.Therefore, if the five methylene diamine carbonate aqueous solution that contains such impurity is distilled, then the reaction product or the such high-viscosity material of impurity enriched material of impurity generation are deposited at the bottom of the tower of distillation tower, become the reason that causes fault.Sneaking in the five methylene diamine that is obtained by distillation if such high-viscosity material or above-mentioned Methionin etc. have the impurity of 3 above functional groups, then is that the polyamide membrane such as 56 nylon of raw material might produce bad order with the five methylene diamine.
The object of the present invention is to provide a kind of manufacture method of refining five methylene diamine etc., it can obtain high yield with simple manufacturing process.
The inventor furthers investigate, found that, by the five methylene diamine carbonate aqueous solution being implemented the disaggregating treatment under the high temperature, can obtain five methylene diamine with high yield, and, obtain the five methylene diamine of specific concentrations by making the thermolysis of five methylene diamine carbonate, and distill refining, can obtain high-quality five methylene diamine with high yield, thereby finish the present invention.
According to the present invention, can provide the manufacture method of refining five methylene diamine and the manufacture method of polyamide resin.
That is, main points of the present invention are as described below.
(1) a kind of manufacture method of refining five methylene diamine is characterized in that, this manufacture method comprises: pyrolosis operation in this pyrolosis operation, by adding five methylene diamine carbonate, obtains five methylene diamine crude product and carbonic acid gas; With
Distillation process in this distillation process, will be distilled by the five methylene diamine crude product that above-mentioned pyrolosis operation obtains, and obtains five methylene diamine,
In above-mentioned five methylene diamine crude product, with respect to the summation 100mol% of five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is more than the 30mol%.
As the manufacture method of above-mentioned (1) described refining five methylene diamine, it is characterized in that (2) in the described pyrolosis operation, the top temperature of heating is 40 ℃～300 ℃.
As the manufacture method of above-mentioned (1) or (2) described refining five methylene diamine, it is characterized in that (3) condition of described distillation process is following (1) and (2).
(1) distillation temperature: 40 ℃～300 ℃
(2) distillation pressure: 0.2kPa～1200kPa (absolute pressure)
(4) a kind of manufacture method of refining five methylene diamine is characterized in that, this manufacture method comprises: pyrolosis operation in this pyrolosis operation, by heating five methylene diamine carbonate, obtains five methylene diamine crude product and carbonic acid gas; With
Distillation process in this distillation process, will be distilled by the five methylene diamine crude product that above-mentioned pyrolosis operation obtains, and obtains five methylene diamine,
The top temperature of the heating in the above-mentioned pyrolosis operation is 110 ℃～300 ℃.
(5) as the manufacture method of each described refining five methylene diamine of above-mentioned (1)～(4), it is characterized in that, in the described pyrolosis operation, five methylene diamine carbonate is the aqueous solution of five methylene diamine carbonate, by heating, obtain five methylene diamine crude product, carbonic acid gas and water.
As the manufacture method of each described refining five methylene diamine of above-mentioned (1)～(5), it is characterized in that (6) pressure in the described pyrolosis operation is 2kPa～1200kPa.
(7) as the manufacture method of each described refining five methylene diamine of above-mentioned (1)～(6), it is characterized in that, in the described pyrolosis operation, Yi Bian be blown into gas, Yi Bian heat five methylene diamine carbonate.
As the manufacture method of above-mentioned (7) described refining five methylene diamine, it is characterized in that (8) described gas is rare gas element.
(9) as the manufacture method of each described refining five methylene diamine of above-mentioned (1)～(8), it is characterized in that, before described pyrolosis operation, has enzymatic decarboxylic reaction operation, in the described enzymatic decarboxylic reaction operation, use is selected from by lysine decarboxylase, improved at least a in the group that the handled thing of lysine decarboxylase active recombinant microorganism, the cell that produces lysine decarboxylase and this cell forms, by Methionin and/or Methionin carbonate production five methylene diamine carbonate.
As the manufacture method of above-mentioned (9) described refining five methylene diamine, it is characterized in that (10) in the described enzymatic decarboxylic reaction operation, described Methionin and/or Methionin carbonate are the aqueous solution of this Methionin and/or the aqueous solution of this Methionin carbonate.
(11) as the manufacture method of above-mentioned (9) or (10) described refining five methylene diamine, it is characterized in that, under carbon dioxide atmosphere, carry out described enzymatic decarboxylic reaction operation.
(12) as the manufacture method of each described refining five methylene diamine of above-mentioned (9)～(11), it is characterized in that before described enzymatic decarboxylic reaction operation, having the Methionin carbonate generation operation that obtains Methionin carbonate by Methionin and carbonic acid gas.
As the manufacture method of above-mentioned (12) described refining five methylene diamine, it is characterized in that (13) described Methionin carbonate generates in the operation, Methionin is the aqueous solution.
(14) as the manufacture method of above-mentioned (11) described refining five methylene diamine, it is characterized in that, with the carbonic acid gas that generates in the described pyrolosis operation as the carbon dioxide recovery of enzymatic decarboxylic reaction operation, re-use.
(15) as the manufacture method of above-mentioned (12) described refining five methylene diamine, it is characterized in that, with the carbonic acid gas that generates in the described pyrolosis operation as being used for carbon dioxide recovery that described Methionin carbonate generates operation, re-using.
(16) as the manufacture method of above-mentioned (10) described refining five methylene diamine, it is characterized in that, the water that generates in the described pyrolosis operation water as described enzymatic decarboxylic reaction operation is reclaimed, re-uses.
(17) as the manufacture method of above-mentioned (13) described refining five methylene diamine, it is characterized in that, the water that generates in the described pyrolosis operation is reclaimed, re-uses as the water that described Methionin carbonate generates operation.
(18) as the manufacture method of each described refining five methylene diamine of above-mentioned (5)～(17), it is characterized in that the weight ratio of the five methylene diamine that is contained in the described aqueous solution of the organic total content with 3 above functional groups with respect to five methylene diamine carbonate that is contained in the five methylene diamine carbonate is below 0.01.
As the manufacture method of above-mentioned (18) described refining five methylene diamine, it is characterized in that (19) organism with 3 above functional groups that is contained is a Methionin in the described aqueous solution of five methylene diamine carbonate.
As the manufacture method of each described refining five methylene diamine of above-mentioned (5)～(19), it is characterized in that (20) macromolecule impurity that is contained heats after removing in the aqueous solution with five methylene diamine carbonate.
(21) as the manufacture method of above-mentioned (20) described refining five methylene diamine, it is characterized in that, use ultra-filtration membrane to remove the macromolecule impurity that is contained in the five methylene diamine carbonate aqueous solution.
(22) a kind of manufacture method of polyamide resin is characterized in that, this manufacture method comprises:
Enzymatic decarboxylic reaction operation, in this enzymatic decarboxylic reaction operation, use is selected from by lysine decarboxylase, improved at least a in the group that the handled thing of lysine decarboxylase active recombinant microorganism, the cell that produces lysine decarboxylase and this cell forms, by Methionin and/or Methionin carbonate production five methylene diamine carbonate;
Pyrolosis operation in this pyrolosis operation, by the five methylene diamine carbonate that above-mentioned enzymatic decarboxylic reaction operation obtains, obtains five methylene diamine crude product and carbonic acid gas by heating;
Distillation process in this distillation process, will be distilled by the five methylene diamine crude product that above-mentioned pyrolosis operation obtains, and obtains five methylene diamine; With
The polycondensation operation in this polycondensation operation, is carried out polycondensation with dicarboxylic acid with by the five methylene diamine that above-mentioned distillation process obtains as monomer component,
In the five methylene diamine crude product that obtains in the above-mentioned pyrolosis operation, with respect to the summation 100mol% of five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is more than the 30mol%.
(23) a kind of manufacture method of polyamide resin is characterized in that, this manufacture method comprises:
Enzymatic decarboxylic reaction operation, in this enzymatic decarboxylic reaction operation, use by lysine decarboxylase, improved at least a in the group that the handled thing of lysine decarboxylase active recombinant microorganism, the cell that produces lysine decarboxylase or this cell forms, by Methionin and/or Methionin carbonate production five methylene diamine carbonate;
Pyrolosis operation in this pyrolosis operation, by the five methylene diamine carbonate that above-mentioned enzymatic decarboxylic reaction operation obtains, obtains five methylene diamine crude product and carbonic acid gas by heating;
Distillation process in this distillation process, will be distilled by the five methylene diamine crude product that above-mentioned pyrolosis operation obtains, and obtains five methylene diamine; With
The polycondensation operation in this polycondensation operation, will be carried out polycondensation as monomer component by the five methylene diamine that dicarboxylic acid and above-mentioned distillation process obtain,
The top temperature of the heating in the above-mentioned pyrolysis operation is 110 ℃～300 ℃.
(24) as the manufacture method of above-mentioned (22) or (23) described polyamide resin, it is characterized in that, before described polycondensation operation, has enrichment process, in this enrichment process, after utilizing described five methylene diamine, dicarboxylic acid and water to make the five methylene diamine dicarboxylate aqueous solution, water is removed in distillation.
(25) as the manufacture method of each described polyamide resin of above-mentioned (22)～(24), it is characterized in that, in the described enzymatic decarboxylic reaction operation, described Methionin and/or Methionin carbonate are this lysine solution and/or this Methionin carbonate aqueous solution.
(26) as the manufacture method of each described polyamide resin of above-mentioned (22)～(25), it is characterized in that before described enzymatic decarboxylic reaction operation, having the Methionin carbonate generation operation that obtains Methionin carbonate by Methionin and carbonic acid gas.
As the manufacture method of above-mentioned (26) described polyamide resin, it is characterized in that (27) described Methionin carbonate generates in the operation, Methionin is the aqueous solution.
(28) as the manufacture method of above-mentioned (25) described polyamide resin, it is characterized in that, the water that generates in described polycondensation operation and/or the enrichment process water as described enzymatic decarboxylic reaction operation is reclaimed, re-uses.
(29) as the manufacture method of above-mentioned (27) described polyamide resin, it is characterized in that, the water that generates in described polycondensation operation and/or the enrichment process is reclaimed, re-uses as the water that described Methionin carbonate generates operation.
According to the present invention, compared with the past, can pass through simple manufacturing process, make five methylene diamine with high yield.And then, by part or all carbon dioxide recovery that will generate in the pyrolosis operation, and it is re-used, can reduce and make energy expenditure that carbonic acid gas accompanies and the Carbon emission of accompanying with energy expenditure.And part or all water by will generate in pyrolosis operation, polycondensation step and/or the enrichment process reclaims, and it is re-used, and can reduce the energy that supplied water consumes and the discharging of water.
Description of drawings
Fig. 1 is an example of utilizing the result of automatic titration device mensuration.
Fig. 2 is the figure of the process of explanation clone cadA.
Embodiment
Below, describe embodiments of the present invention in detail.Need to prove, the invention is not restricted to following embodiment, can in the scope of its main points, carry out various distortion and implement.And used accompanying drawing is not represented physical size for present embodiment is described.
(five methylene diamine carbonate)
The employed five methylene diamine carbonate of present embodiment preferably obtains by the enzymatic decarboxylic reaction (LDC reaction) of Methionin.Use Methionin or Methionin carbonate and be selected from by lysine decarboxylase, at least a LDC that carries out Methionin that improved in the group that the handled thing of the active recombinant microorganism of lysine decarboxylase, the cell that produces lysine decarboxylase and this cell forms reacts.The LDC reaction of Methionin as described later.
In the present embodiment, the five methylene diamine carbonate that the LDC reaction by Methionin obtains obtains with the form of the aqueous solution usually.In addition, five methylene diamine carbonate also can be solid state, but is preferably the aqueous solution or is dissolved in the state of the solution of other solvents.The aqueous solution or the concentration of five methylene diamine carbonate that is dissolved in the solution of other solvents are generally 1 weight %～80 weight %, are preferably 30 weight %～70 weight %.
In addition, after the LDC of the Methionin reaction, when the concentration of resulting five methylene diamine carbonate is lower than above-mentioned scope, preferably carry out concentration operation as required.
The five methylene diamine carbonate that LDC reaction by Methionin obtains contains impurity usually, and described impurity comprises polymer substances such as organism with 3 above functional groups, protein.
Herein, the organism with 3 above functional groups can be enumerated intramolecularly and has the organism that can cause the functional group of cross linked gelization more than 3.As such functional group, can enumerate for example amino, carboxyl, sulfuryl, phosphate, hydroxyl, hydrazide group, epoxy group(ing), sulfydryl, nitro, alkoxyl group etc.
As organism, can enumerate amino acid, oligosaccharides, oxysuccinic acid, citric acid etc. with 3 above functional groups.As amino acid whose concrete example, can enumerate for example aspartic acid, L-glutamic acid, l-asparagine, glutamine, Methionin, ornithine, oxylysine, arginine, Histidine etc.Wherein, there are a large amount of Methionins.Need to prove that these amino acid can be left-handed (L) body, also can be dextrorotation (D) body.
(pyrolosis operation)
In the present embodiment, the five methylene diamine carbonate heating that will obtain by the LDC reaction of Methionin, in predefined temperature thermolysis is five methylene diamine crude product and the carbonic acid gas that contains impurity, next, with the distillation of five methylene diamine crude product, obtained removing the refining five methylene diamine of impurity.
At first, illustrate five methylene diamine carbonate pyrolysated operation.
By heating, with the thermolysis of five methylene diamine carbonate.So, in being attended by the arbitrary strokes such as distillation, distillation that concentrate, reflux, dewater of heating all thermolysis can take place.Therefore, the top temperature of the heat decomposition temperature among the present invention equals to be attended by the top temperature in whole strokes of heating.
The top temperature of the heat decomposition temperature of the five methylene diamine carbonate that is obtained by the LDC of Methionin reaction is generally more than 40 ℃, is preferably more than 110 ℃, more preferably more than 120 ℃, more preferably more than 130 ℃, be preferably more than 150 ℃ especially.And, be generally below 300 ℃, be preferably below 250 ℃, more preferably below 230 ℃, more preferably below 220 ℃, especially be preferably below 210 ℃, be preferably below 200 ℃ especially.
If the temperature of heating five methylene diamine carbonate is low excessively, then five methylene diamine carbonate does not decompose, and the yield of the distillation procedure that carries out reduces thereafter, and has the tendency that causes that pentamethylene carbonate is separated out.And, if the temperature of heating is too high, then might decompose by five methylene diamine.
Be not particularly limited the heat-up time to five methylene diamine carbonate, yet be generally more than 1 hour, be preferably more than 2 hours, more preferably more than 3 hours.
As mentioned above, the five methylene diamine carbonate that is obtained by the LDC of Methionin reaction obtains with the form of the aqueous solution usually.In this case, owing to the evaporation of water latent heat that evaporates because of heat treated, thereby the temperature of the aqueous solution is difficult for raising when direct heating.Therefore, five methylene diamine carbonate does not carry out thermolysis, after the dehydration, might separate out five methylene diamine carbonate.
Therefore, in the present embodiment, the preferred five methylene diamine carbonate aqueous solution that as required the LDC reaction by Methionin is obtained is implemented concentration operation, after being adjusted into predefined concentration, by with operations such as aqueous solution backflows, with the most of five methylene diamine carbonate decomposition that is contained in the aqueous solution, the distillation etc. of dewatering thereafter.
Reflux temperature when moisture concentration hangs down, can reflux at comparatively high temps according to the moisture in the aqueous solution and different.Reflux temperature is generally 40 ℃～300 ℃, is preferably 100 ℃～180 ℃ scope, and return time is generally more than 1 hour, is preferably more than 2 hours, more preferably more than 3 hours.
And, as the operation that can obtain effect same, preferably under the condition that the five methylene diamine carbonate that the aqueous solution contained is not separated out, while the distillation of dewatering is with most of five methylene diamine carbonate decomposition.At this moment, under the batch-wise situation, at first, 100 ℃～120 ℃ distillations of dewatering.Temperature rise in when amount of moisture reduces, temperature begin to distill out five methylene diamine near near 160 ℃～180 ℃ the time, finish dehydration basically.And the temperature of this moment has reached the temperature of enough five methylene diamine carbonate decomposition, obtains the five methylene diamine crude product.As additive method, have to add the method for dewatering distillation and decomposing of depressing.By being set at pressurized state, the elevation of boiling point of water decomposes and carries out effectively.
In addition, when using the continuous operation device to carry out the thermolysis of five methylene diamine carbonate aqueous solution, preferably in the reactive tank that remains in the necessary temperature of thermolysis, supply with the five methylene diamine carbonate aqueous solution of specified amount, while the method for dewatering and decomposing.
And, under the situation of using the continuous operation device,, consider following two steps in order effectively to carry out the decomposition of five methylene diamine carbonate.
As the 1st step, at first,, carry out the dehydration of five methylene diamine carbonate aqueous solution by under reduced pressure heating with distillation tower.Solution at the bottom of the tower is delivered to ensuing the 2nd step, and in solution at the bottom of this tower, moisture is few, and the heating under dehydration conditions makes a part of five methylene diamine carbonate decomposition.
As the 2nd step, regulate various conditions, make the solution thermal degradation of carrying from the 1st step.At this moment, preferably five methylene diamine carbonate is decomposed substantially fully.Secondly, five methylene diamine crude product (preferably under reduced pressure) distillation that will obtain at the bottom of the tower obtains five methylene diamine.
And then, except that aforesaid method, also can consider to carry out dehydration, the decomposition of five methylene diamine carbonate aqueous solution, the sequence of operations such as distillation of five methylene diamine with a device.For example, use multistage distillation tower etc.,, be arranged to high temperature at the bottom of the tower with distillation tower, thereby five methylene diamine carbonate is decomposed substantially fully by near the central authorities of distillation tower, supplying with the five methylene diamine carbonate aqueous solution.From the recovered overhead water and the carbonic acid gas of distillation tower, reclaim the five methylene diamine that distills from the distillation tower stage casing, at the bottom of tower, take out still residue.
In the present embodiment, by above-mentioned pyrolosis operation, the five methylene diamine carbonate decomposition in the five methylene diamine carbonate aqueous solution becomes five methylene diamine crude product and carbonic acid gas.If the summation of five methylene diamine and undecomposed and remaining five methylene diamine carbonate is made as 100mol%, the concentration of the five methylene diamine that then above-mentioned five methylene diamine crude product is contained be generally 30mol% above, be preferably 75mol% above, more preferably 85mol% above, more preferably 90mol% above, especially be preferably 95mol% above, be preferably more than the 99mol% especially.In addition, carrying out continuously under the situation of pyrolosis operation, owing to carry out thermolysis while supplying with the five methylene diamine carbonate aqueous solution, so the five methylene diamine crude product after being difficult to obtain five methylene diamine carbonate and decomposing fully, the concentration of the five methylene diamine that above-mentioned crude product contained be generally 99.9mol% following, be preferably 99.5mol% following, more preferably below the 99.0mol%.
If five methylene diamine carbonate amount undecomposed and remaining in the aqueous solution is too much, then by the time as the fractionation by distillation five methylene diamine of subsequent handling, might the form with carbonate separate out at the bottom of the tower of distillation tower, yield reduces, or causes reboiler obstruction, thermo-efficiency to reduce.
Pressure during thermolysis is generally more than the 2kPa, is preferably more than the 10kPa, is preferably more than the 100kPa especially.And, be generally below the 1200kPa, be preferably below the 800kPa, be preferably below the 500kPa especially.If hypotony then because interior temperature does not raise, so the decomposition of five methylene diamine carbonate is not carried out, the yield of the distillation procedure that carries out reduces thereafter, or is separated out carbonate and is caused trouble at the bottom of the tower of distillation tower.And if hypertonia, then partial pressure of carbon dioxide is big, need at high temperature make to decompose to carry out, and the too high five methylene diamine that might cause of temperature decomposes.
In addition, pressure herein is meant absolute pressure, and the pressure of relevant elsewhere record is also all represented absolute pressure when representing as kPa.And difference mutually adds on pressure unit as kPaG when G represents therewith, the expression gauge pressure.
In the pyrolosis operation, while can be blown into the decomposition that gas carries out five methylene diamine carbonate.As the kind of gas, preferred rare gas element usually, uses nitrogen or argon.By being blown into gas, reduce the dividing potential drop of carbonic acid gas, decompose and further carry out.
And then, except that five methylene diamine, five methylene diamine carbonate, water, also contain impurity that derives from Methionin or in the enzymatic decarboxylic reaction, generate etc. in the five methylene diamine crude product that in pyrolosis operation, obtains.The kind of the Methionin that uses comprises the lysine solution that obtains through the Methionin of purified medical-grade and the fermentation by glucose, the impurity level difference that it is contained.Therefore, difference according to the kind of employed Methionin, the impurity level difference that is contained in the five methylene diamine crude product, total five methylene diamine concentration in the five methylene diamine crude product is generally below the 99 weight %, impurity level is many under the situation of the Methionin of some kind, so total five methylene diamine concentration also is below the 95 weight % sometimes.Total five methylene diamine herein represents to comprise the two the five methylene diamine of five methylene diamine composition in five methylene diamine and the five methylene diamine carbonate.And, usually, when making five methylene diamine, note represents the free five methylene diamine, use with total five methylene diamine difference.
(reducing the method for the impurity in the aqueous solution)
As mentioned above, the five methylene diamine carbonate that the LDC reaction by Methionin obtains contains impurity usually, and this impurity comprises polymer substances such as organism with 3 above functional groups and protein.If under the remaining state of such impurity, carry out heating, the distillation procedure of five methylene diamine carbonate aqueous solution, then cause fault, for example, high-viscosity material is piled up and is present at the bottom of the tower of distillation tower, and impurity is considered to form the reason of high-viscosity material; Or the like.
Therefore, in the present embodiment, preferably, at least before the distillation process described later, preferably in pyrolosis operation, carry out thermal decomposition process before, the impurity in the five methylene diamine carbonate aqueous solution is reduced.
(minimizing has the organic method of 3 above functional groups)
In the organism with 3 above functional groups that exists in the five methylene diamine carbonate aqueous solution, origin of amino acid such as Methionin are in the microorganism (thalline) of the use of following lysine decarboxylase (below be sometimes referred to as LDC).Therefore, the biomass that uses when reacting by the LDC with Methionin is suppressed in the specialized range, can reduce amino acid such as Methionin.In addition, Methionin reaches about 100% by carrying out LDC reaction until the transformation efficiency of LDC reaction, can make lysine concentration below detectability.
Pass through aforesaid operations, thereby in the present embodiment, in the part by weight with respect to the five methylene diamine that is contained in the aqueous solution, that the organic total content with 3 above functional groups that is contained in the aqueous solution with five methylene diamine carbonate is reduced to is common below 0.01, preferred below 0.009, further preferred below 0.008, preferred below 0.007 especially.
(removal of macromolecule impurity is handled)
For the aqueous solution of the five methylene diamine carbonate that uses in the present embodiment, preferably before the thermal decomposition process of being undertaken, in advance the macromolecule impurity that is contained in the aqueous solution is removed by heating.Particularly be to use under the situation that lysine decarboxylase described later obtains by Methionin or the production of Methionin carbonate, for example in the aqueous solution, contain protein, nucleic acid, polyose etc. as macromolecule impurity at five methylene diamine carbonate.Carry out heat treated if in the aqueous solution, contain under the state of such macromolecule impurity, then can cause the heat transfer reduction of heat treatment apparatus etc.
The method that is used for removing macromolecule impurity can be enumerated following method usually: the method that macromolecule impurity is adsorbed in be added on the sorbent material of the aqueous solution; Utilize the method etc. of the membrane filtration aqueous solution of predefined size.Wherein, from the viewpoint of simplicity and removal effect, the method for preferably using ultra-filtration membrane (UF film) that the aqueous solution is handled.
By using the UF film that the aqueous solution is handled, thus with the molecular weight that is contained in the aqueous solution be 12,000 or more, preferred molecular weight is 5,000 or more, preferred molecular weight is the macromolecule impurity removal more than 1,000 especially.
The material of UF film can be enumerated for example rhodia, polyethersulfone, polysulfones, poly(vinylidene fluoride), polyvinyl benzyl trimethyl ammonium chloride, sodium polystyrene sulfonate, acrylonitrile copolymer, polymeric amide 12 etc.Wherein, preferred acrylonitrile copolymer.
The shape of UF film can be enumerated flat film, tubular fibre, plate, pipe, helical coil etc.Wherein, preferred tubular fibre.And various UF film modules are sold by each company, from the UF film of the easiness preferred moduleization of operation.
(distillation process)
Secondly, distillation process is described.
In the distillation process,, obtain the five methylene diamine that in the five methylene diamine crude product, is contained by distilling by the five methylene diamine crude product (containing five methylene diamine and impurity) that above-mentioned pyrolosis operation obtains.
Preferably before distillation process, the carbonic acid gas that produces in the pyrolosis operation is got rid of in reactive tank or distillation tower.In the absence with the carbonic acid gas eliminating,,, cause obstruction etc. attached to inner wall of tower so carbonic acid gas and the five methylene diamine reaction that distills out generate five methylene diamine carbonate owing to have carbonic acid gas at reactive tank or distillation tower top.
In addition, might in isolated five methylene diamine, contain five methylene diamine carbonate, be difficult to even the temperature more than the fusing point of five methylene diamine also can be solidified extract out by distillation.At this moment, by adding water in the refining five methylene diamine that obtains in distillation, can access the aqueous solution and five methylene diamine is solidified.At this moment, total five methylene diamine concentration in the aqueous solution be generally 20 weight % above, be preferably 30 weight % above, more preferably more than the 40 weight %, and be generally 99 weight % following, be preferably 95 weight % following, more preferably below the 90 weight %.
Method as removing carbonic acid gas has by being blown into rare gas element and will be set at the method for inert gas atmosphere in the tower.As the kind of rare gas element, can use nitrogen or argon.And, be provided with respectively by the distillation tower that uses in the reactive tank that will use in the pyrolosis operation or distillation tower and the distillation process, can prevent to generate in the distillation process five methylene diamine carbonate.
And, compare the condition that the condition optimization of the temperature and pressure in the distillation process is difficult to decompose for five methylene diamine carbonate with the condition of pyrolosis operation.When undecomposed and residual five methylene diamine carbonate takes place to decompose in distillation process in the pyrolosis operation, as mentioned above, owing to have carbonic acid gas on distillation tower top, so generate five methylene diamine carbonate, thereby cause stopping up and the solidifying of the five methylene diamine that obtains by distillation.
As mentioned above, if the summation of five methylene diamine and undecomposed and remaining five methylene diamine carbonate is made as 100mol%, the concentration of the five methylene diamine that is contained in the aqueous solution when then distilling be generally 30mol% above, be preferably 75mol% above, more preferably 85mol% above, more preferably 90mol% above, especially be preferably 95mol% above, be preferably more than the 99mol% especially.
During distillation, distillation temperature is generally 40 ℃～300 ℃, is preferably 50 ℃～200 ℃, more preferably 60 ℃～180 ℃, more preferably 70 ℃～150 ℃, is preferably 70 ℃～120 ℃ especially.Distillation pressure is generally 0.2kPa～1200kPa, is preferably 0.5kPa～800kPa, 1.0kPa～500kPa more preferably.
In addition, might contain some five methylene diamine carbonate in the refining five methylene diamine that obtains by distillation.But, because this carbonate is easy and dicarboxylic acid carries out the salt exchange, so can be no problemly as supplying polyamide resin polymeric monomer.
And, the weight of the refining five methylene diamine that distillation obtains is different because of the kind of used Methionin, under batch-wise situation, weight with respect to the five methylene diamine crude product, and under the situation of continous way, be supplied in the weight of the five methylene diamine crude product of water distilling apparatus with respect to the unit time, the weight of refining five methylene diamine be generally 99 weight % following, be preferably 97 weight % following, more preferably below the 95 weight %.And, be generally more than the 40 weight %, be preferably more than the 45 weight %, more preferably more than the 50 weight %.If the distillation amount is too much, then at the bottom of the tower of distillation tower, the such high-viscosity material of enriched material of formed reaction product of impurity or impurity is piled up, and causes fault.And, if the distillation amount is very few, then under batch-wise situation, involving the reduction of yield in a criminal case, production efficiency reduces under the situation of continous way, so be not preferred.
(recovery of carbonic acid gas and re-use)
Secondly, to the recovery of the carbonic acid gas that in the pyrolosis operation of five methylene diamine carbonate, generates with re-use and describe.Arbitrary operation during making five methylene diamine from starting raw material can both be used carbonic acid gas, and this is not particularly limited.In the present embodiment, especially preferably the Methionin carbonate that obtains Methionin carbonate by Methionin and carbonic acid gas generates operation, is generated the enzymatic decarboxylic reaction operation of five methylene diamine carbonate by Methionin carbonate.In one operation of back, if the enzymatic decarboxylic reaction carries out, then pH raises, so preferably adjust pH for neutral, uses carbonic acid gas in its pH adjusts.
The recovery of carbonic acid gas and the method that re-uses are not particularly limited, after the water conservancy that reclaims in the pyrolosis operation can being separated with water cooler, the carbonic acid gas of discharging are directly re-used in Methionin carbonate generation operation or enzymatic decarboxylic reaction operation.At this moment, also can use compressor that carbonic acid gas compression back is used.
(recovery of water re-uses)
And then, for the five methylene diamine carbonate aqueous solution concentrate and the pyrolosis operation of five methylene diamine carbonate in the water, the re-using of water of in the enrichment process of five methylene diamine described later and dicarboxylic acid and polycondensation operation, reclaiming that reclaim describe.Can both make water in arbitrary operation during making five methylene diamine, this is not particularly limited by starting raw material.In the present embodiment, the preferred especially enzymatic decarboxylic reaction operation that obtains the Methionin carbonate generation operation of Methionin carbonate, produces five methylene diamine carbonate by Methionin carbonate by Methionin and carbonic acid gas.
And then, owing in the enrichment process of thermolysis, five methylene diamine and the dicarboxylic acid of the concentrating of five methylene diamine carbonate aqueous solution, five methylene diamine carbonate and/or polycondensation operation, follow heating, take place to decompose and the impurity of generation so in the water that reclaims, might contain the part of five methylene diamine.Though the water that reclaims directly can be re-used, preferably re-uses behind the Impurity removal that the five methylene diamine decomposition is generated.Removal method to impurity is not particularly limited, can enumerate absorption methods such as ion-exchange-resin process, activated carbon treatment method, by the film of reverse osmosis membrane etc. handle, deimpurity method etc. is made a return journey in distillation.
(the enzymatic decarboxylic reaction of the generation of Methionin carbonate, Methionin)
Secondly, the generation of the Methionin carbonate that is used for preparing the five methylene diamine carbonate that present embodiment uses and the enzymatic decarboxylic reaction of Methionin are described.
In the present embodiment, the enzymatic decarboxylic reaction of Methionin for example can be in the lysine solution that obtains that Methionin is dissolved in the water add the pH that carbonic acid gas is the enzymatic decarboxylic reaction (LDC reaction) that is suitable for Methionin with the pH that keeps this solution on one side, react on one side, perhaps under carbon dioxide atmosphere, react.
Below be elaborated.
Usually be preferably free alkali (Methionin alkali, be free lysine) as the Methionin of raw material.And, can be the carbonate of Methionin.Methionin can be enumerated L-Methionin, D-Methionin.Usually, from the easiness that obtains, preferred L-Methionin.And Methionin can be for through purified Methionin, also can be for containing the fermented liquid of Methionin.
The solvent of preparation lysine solution preferably makes water.The pH that can carry out the reaction solution of LDC reaction utilizes carbonic acid gas to regulate, and does not use other pH regulator agent, buffer reagent usually.In addition, in the solvent of dissolving Methionin, use under the situation of sodium acetate buffer for example etc.,, preferably lysine concentration is suppressed to be lower concentration from forming the aspect of five methylene diamine carbonate.
Using under the situation of free lysine, adding in the lysine solution that obtains for example being dissolved in water in the carbonic acid gas or under carbon dioxide atmosphere, is the pH that is suitable for the LDC reaction with the pH regulator of reaction solution.Concrete pH is generally more than 4.0, is preferably more than 5.0, and is generally below 12.0, is preferably below 9.0.Below, claim sometimes that like this pH regulator with reaction solution is being operating as of pH " neutralization " that is suitable for the LDC reaction.In addition, be meant the state that the gas phase part almost is full of with carbonic acid gas under the carbon dioxide atmosphere among the present invention.
During the LDC reaction,, preferably add vitamin B6 in order to improve production rate and reaction yield.As vitamin B6, can enumerate pyridoxol, Pyridoxylamine, pyridoxal, pyridoxal phosphate etc.Wherein, preferably phosphoric acid pyridoxal.Addition means, interpolation to vitamin B6 are not particularly limited period, and suitable being added in the LDC reaction gets final product.
By through as above adding lysine decarboxylase (LDC) in the neutral lysine solution, carry out the LDC reaction.As LDC, as long as act on Methionin, generate five methylene diamine, just be not particularly limited.As LDC, can enumerate the cells such as microorganism, vegetable cell or zooblast of refining enzyme, generation LDC.Two or more kinds may be used for the cell of LDC or generation LDC.And, can directly use cell, also can use the cell handled thing that contains LDC.As the cell handled thing, can enumerate cytoclasis liquid or its fraction.
As the microorganism that produces LDC, can enumerate colon bacillus Escherichias such as (E.coli) bacterium, Brevibacterium lactofermentus bar shaped bacterias such as (Brevibacterium lactofermentum), Bacillus subtilus Bacillus bacteriums such as (Bacillus subtilis), serratia marcescens bacteriums such as serratia bacterium such as (Serratia marcescens), cereuisiae fermentum eukaryotic cells such as (Saccharomyces cerevisiae).Preferred bacterium in these, preferred especially E.coli.
Above-mentioned microorganism can be wild strain as long as produce LDC, also can be variant.And, also can for through transforming so that the active recombinant strain that raises of LDC.Vegetable cell or zooblast also can use through transforming so that the active reconstitution cell that raises of LDC.Detailed content is recorded in for example Japanese Patent Application 2008-4759 number.
In the LDC reaction, in lysine solution, add the LDC initiation reaction.After the reaction beginning, follow the carrying out of reaction and from reaction solution, discharged, pH is raise from the Methionin carbonic acid gas that dissociates.Therefore, carbonic acid gas is added in (being blown into) reaction solution, so that the pH of reaction solution reaches the scope of the pH that is suitable for the LDC reaction.Carbonic acid gas can be added in the reaction solution continuously, also can portion-wise addition.And, also can by under carbon dioxide atmosphere, be arranged to mode such as enclosed system and will be used for pH and adjust from the dissociate carbonic acid gas that of Methionin.Temperature of reaction to LDC reaction is not particularly limited, and is generally more than 20 ℃, is preferably more than 30 ℃, and be generally below 60 ℃, be preferably below 40 ℃.
In addition, raw material Methionin can full dose be added in the reaction solution when the reaction beginning, also can be according to the progress portion-wise addition of LDC reaction.
When carrying out the LDC reaction, can in reaction solution, easily add carbonic acid gas in batches.And, also can react by the moving-bed column chromatography, this moving-bed column chromatography comprises the cell that is fixed with LDC, produces LDC or the carrier of its handled thing.At this moment, Methionin and carbonic acid gas are injected the suitable position of post so that the pH of reaction system maintains in the predetermined scope reacts.
And, also can not carry out the interpolation of carbonic acid gas, will be used for neutralization by all or part of carbonic acid gas that the LDC reaction is emitted.
The pH that raises by the generation of using carbonic acid gas to neutralize one by one as mentioned above to follow five methylene diamine, thus the LDC reaction is carried out well.The five methylene diamine that generates by LDC reaction is accumulated in the reaction solution with the form of dicovalent carbon hydrochlorate or monovalence supercarbonate.
(polyamide resin)
Below, the manufacture method of polyamide resin is described, the manufacture method of this polyamide resin uses the five methylene diamine that obtained by above-mentioned five methylene diamine carbonate and dicarboxylic acid as monomer component.
In the present embodiment, five methylene diamine that will be obtained by five methylene diamine carbonate and dicarboxylic acid use polycondensation catalyst as monomer component, make polyamide resin by polycondensation.
Be used for the polycondensation of five methylene diamine, can enumerate aliphatic dicarboxylic acids such as oxalic acid, propanedioic acid, succsinic acid, pentanedioic acid, hexanodioic acid, pimelic acid, suberic acid, nonane diacid, sebacic acid, undecane diacid, dodecanedioic acid, undecane dicarboxylic acid, tetradecane diacid, pentadecane diacid, Thapsic acid, heptadecane diacid, octadecane diacid, nonadecen diacid, octadecane dicarboxylic acid for example as the concrete example of the dicarboxylic acid of monomer component; Ester ring type dicarboxylic acid such as cyclohexane dicarboxylic acid; Aromatic dicarboxylic acids such as phthalic acid, m-phthalic acid, terephthalic acid, naphthalene dicarboxylic acids.
In these dicarboxylic acid, preferred aliphat dicarboxylic acid, preferred especially hexanodioic acid.And, when using hexanodioic acid as dicarboxylic acid, the concentration of the hexanodioic acid in the dicarboxylic acid be generally 90 weight % above, be preferably above, the 100 weight % more preferably of 95 weight %.
And then, in the degree of not damaging the effect that obtains by the present invention, can use other monomer components.As other such monomer components, can enumerate for example 6-aminocaprolc acid, 11-aminoundecanoic acid, amino 12 (alkane) acid of 12-to amino acid such as amino methyl phenylformic acid; Lactan such as ε-Ji Neixianan, omega-lauric lactam; Quadrol, 1, the 3-diaminopropanes, 1, the 4-diaminobutane, 1,1,7-diamino heptane, 1,8-diamino octane, 1,9-diamino nonane, 1, the 10-diamino decane, 1,11-diamino undecane, 1,12-diamino dodecane, 1,13-diamino tridecane, 1, the 14-diamino tetradecane, 1,15-diamino pentadecane, 1,16-diamino n-Hexadecane, 1,17-diamino heptadecane, 1,18-diamino octadecane, 1,19-diamino nonadecane, 1,20-diamino eicosane, the 2-methyl isophthalic acid, aliphatie diamines such as 5-diamino pentane; Cyclohexane diamine, two-ester ring type diamines such as (the amino hexyl of 4-) methane; Aromatic diamines such as benzene dimethylamine.Also two or more these monomer components can be share.
(polycondensation method)
In the present embodiment, the polycondensation method of five methylene diamine and dicarboxylic acid is not particularly limited, can be from existing known method suitable the selection.And polycondensation catalyst can suitable the selection use from existing known polycondensation catalyst, and there is no particular limitation as to it.As the manufacture method of general polyamide resin, for example be disclosed in " Port リ ァ ミ De Trees fat Ha Application De Block ッ Network " (Nikkan Kogyo Shimbun: Fu Benxiu compiles, 1987 year version) etc.
As an example of polycondensation method, can enumerate for example will contain that five methylene diamine and dicarboxyl aqueous acid carry out dehydration reaction under High Temperature High Pressure add the thermal polycondensation method., add in the thermal polycondensation method, the top temperature of polycondensation is more than 200 ℃, is preferably more than 220 ℃, is generally below 300 ℃ herein.The polycondensation mode is not particularly limited, can adopts batch-type or continuous mode.
Need to prove, by will by add polyamide resin that the thermal polycondensation method obtains in vacuum for example or in the rare gas element with more than 100 ℃ to the heating of the temperature below the fusing point, can increase the molecular weight (solid state polymerization) of polyamide resin.
And, can enumerate: the method that five methylene diamine and dicarboxylic acid polycondensation obtain under the High Temperature High Pressure rudimentary condenses (oligopolymer) polymer is quantized; Make the aqueous solution that five methylene diamine dissolving obtains and dicarboxylate or dicarboxylic acid dihalide are dissolved in the solution that obtains in aqueous solvent or the organic solvent contact, carry out the interface polycondensation of polycondensation etc. at their interface.
In addition, in the present embodiment, before polycondensation, also can insert the enrichment process that contains five methylene diamine and dicarboxyl aqueous acid.By inserting enrichment process, can realize the shortening of above-mentioned polycondensation time.In the enrichment process, usually under 140 ℃～160 ℃, preferably be 70 weight %～90 weight % adding the concentration of depressing the salt that is concentrated into five methylene diamine and dicarboxylic acid, and do not make salting out of five methylene diamine and dicarboxylic acid.
In the present embodiment, the molecular weight of the polyamide resin that the polycondensation by five methylene diamine and dicarboxylic acid is obtained is not particularly limited, and can select according to purpose is suitable.Viewpoint from practicality, usually, (the polyamide resin lipid concentration: the lower limit of relative viscosity 0.01g/mL) is generally 1.5, is preferably 1.8, is preferably 2.2 especially 25 ℃ 98% sulphuric acid soln of polyamide resin, and the upper limit is generally 8.0, is preferably 5.5, is preferably 3.5 especially.If relative viscosity is too small, then has the tendency of the practical intensity of can not get.If relative viscosity is excessive, then the flowability of polyamide resin reduces, and the impaired tendency of forming process is arranged.
(additive)
Can mix various additives as required in the polyamide resin that present embodiment is suitable for.As additive, can enumerate for example antioxidant, thermo-stabilizer, weather resisting agent, release agent, lubricant, pigment, dyestuff, crystallization nucleating agent, softening agent, static inhibitor, fire retardant, weighting agent, other polycondensates etc.
Specifically, as antioxidant or thermo-stabilizer, can enumerate hindered phenol based compound, Resorcinol based compound, phosphorous acid ester based compound and their substituent etc.
As weather resisting agent, can enumerate Resorcinol based compound, salicylate based compound, benzotriazole based compound, benzophenone based compound, hindered amine based compound etc.
As release agent or lubricant, can enumerate fatty alcohol, aliphatic amide, aliphatics bisamide, allophanamide, polyethylene wax etc.
As pigment, can enumerate Cadmium Sulfide, phthalocyanine, carbon black etc.As dyestuff, can enumerate nigrosine, nigrosine etc.
As crystallization nucleating agent, can enumerate talcum, silicon-dioxide, kaolin, clay etc.As softening agent, can enumerate P-hydroxybenzoic acid monooctyl ester, N-butylbenzenesulfonamide etc.
As static inhibitor, can enumerate the alkyl sulphate type negatively charged ion is that static inhibitor, quaternary ammonium salt cationic are that nonionics such as static inhibitor, Tween-60 are that static inhibitor, trimethyl-glycine are both sexes static inhibitor etc.
As fire retardant, can enumerate the combination of melamine cyanurate, oxyhydroxide (such as magnesium hydroxide, aluminium hydroxide etc.), ammonium polyphosphate, brominated Polystyrene, brominated polyphenylether, brominated polycarbonate, brominated epoxy resin or these bromide fire retardants and ANTIMONY TRIOXIDE SB 203 99.8 PCT etc.
As weighting agent, can enumerate particulate state, needle-like, tabular packing materials such as glass fibre, carbon fiber, carbon black, graphite, barium sulfate, sal epsom, lime carbonate, magnesiumcarbonate, weisspiessglanz, titanium dioxide, aluminum oxide, zinc oxide, ferric oxide, zinc sulphide, zinc, lead, nickel, aluminium, copper, iron, stainless steel, wilkinite, polynite, synthetic mica.
As other polycondensates, can enumerate other polymeric amide, polyethylene, polypropylene, polyester, polycarbonate, polyphenylene oxide, polyphenylene sulfide, liquid crystalline polymers, polysulfones, polyethersulfone, ABS resin, AS resin, polystyrene etc.
In making the operation of polyamide resin, the suitable addition of selecting these materials, add operation etc. and add and get final product.
In the present embodiment, can additive and strongthener be blended in the polyamide resin in the polycondensation of polyamide resin any stage to moulding.Wherein, preferably, they are carried out melting mixing with in polyamide resin and additive and the strongthener input forcing machine, thus the preparation Amilan polyamide resin composition.
And, can utilize forming method arbitrarily such as injection molding, film moulding, melt-spinning, blow molding, vacuum forming, the polyamide resin of present embodiment is shaped to desired shape.As the moulding product, can enumerate for example injection-molded article, film, sheet material, silk, sharpening brushing, fiber etc.And polyamide resin also can be used in joint compound, coating etc.
And then, concrete purposes example for the polyamide resin of present embodiment, as automobile-vehicle associated components, can enumerate for example intake manifold, with gemel folder (door assembly with hinge and glass in right hand and left moulding product), finish band, resonator, air filter, engine shield, rocker cover, cylinder cover hood, timing cingulum lid (timing belt cover), pneumatic thickener, secondary pneumatic thickener, radiator tank, side cooler, oil tank (oil reservoir tank), food tray, electric direction varying device, oil filter, respirator, engine support, terminal box, relay box, connector, corrugated tube, automobile railway carriage or compartment inner parts such as protector; Automobile exterior members such as automobile door pull handle, splash pan, bonnet protuberance (hood bulge), roof stick carline, driving mirror bracket, safety lever, spoiler, wheel cover; In-built component for automobile such as saucer, supervisory control desk box (Console Box), accelerator pedal, clutch pedal, shift lever bracket, gear shift lever knob.
And the polyamide resin of present embodiment can be used in fishing line, fishery relevant supplies equipment such as fishing net, Switch, the subminiature slide switch, DIP switch, switch capsule, lamp socket, finish band, connector, the connector box, connector housings, IC socket class, coil pipe, the reel cover, rly., relay1 box, condenser casing, the internal part of motor, the miniature motor shell, the gear cam, dancing pulley, spacer, isolator, little horn ring, terminal board, the shell of power tool, the insulated part of trigger, fuse unit, the shell of terminal, bearing retainer, speaker diaphragm, thermally resistant container, microwave oven component, the electric cooker parts, the electric and electronic associated components of representatives such as printer color tape guide plate, family office electric product parts, the computer associated components, facsimile recorder duplicating machine associated components, various uses such as machinery associated components.
Embodiment
Below provide embodiment, the present invention more specifically is described, but the present invention is not subjected to the qualification of the record of these embodiment.The physical property measurement method and the method for sample preparation of the samples that use in embodiment and the comparative example etc. are as described below.
(1) measuring method of five methylene diamine concentration
Each concentration of total five methylene diamine in each sample, five methylene diamine, five methylene diamine carbonate is used automatic titration device (Mitsubishi Chemical society makes GT-100), passes through titration determination.
During mensuration, take by weighing sample, the amount that makes the total five methylene diamine in the sample is 0.2g～1.0g, and with after the deionized water dilution, carries out titration with the 1mol/L HCl aqueous solution (manufacturing of Kishida Chemical society).
Obtain five methylene diamine concentration based on measurement result by following method of calculation.
Among the result of titration determination, when having 3 stoichiometric points (with reference to Fig. 1 (a)), this stoichiometric point is the stoichiometric point of the ionic neutralization shown in the table 1, salt exchange.When the HCl titer that the HCl titer of the 2nd stoichiometric point is made as x mL, the 3rd stoichiometric point was made as y mL, ionic concn separately was shown in (formula 1)～(formula 3).Need to prove, the molecular weight of five methylene diamine is made as 102.18, the molecular weight of five methylene diamine carbonate is made as 164.21, the weight of sample is made as a g, the factor of the 1mol/L HCl aqueous solution is made as f.Herein, the volumetry reagent that HCl uses and the pure pharmaceutical worker's industry of light society makes.And factor f is the correction value of reagent place record, the ratio of the equivalent concentration that its weight that is the true equivalent concentration that calculates by back titration etc. with respect to by reagent preparation the time calculates.
Total five methylene diamine concentration (weight %):
{ y ÷ 1000 * f} ÷ 2 * 102.18 ÷ a * 100 (formula 1)
Five methylene diamine concentration (weight %):
[{ x-(y-x) } ÷ 1000 * f] ÷ 2 * 102.18 ÷ a * 100 (formula 2)
Five methylene diamine carbonate concentration (weight %):
{ (y-x) ÷ 1000 * f} * 164.21 ÷ a * 100 (formula 3)
Table 1
Figure BPA00001272907600201
Among the result of titration determination, when stoichiometric point is 1 (with reference to Fig. 1 (b)), this stoichiometric point is the stoichiometric point of five methylene diamine, does not contain carbonate in the sample.When the HCl titer at stoichiometric point place was made as z mL, five methylene diamine concentration was shown in (formula 4).In addition, the molecular weight of five methylene diamine is made as 102.18, the weight of sample is made as a g, the factor of the 1mol/L HCl aqueous solution is set at f.
Total five methylene diamine concentration (weight %):
{ z ÷ 1000 * f} ÷ 2 * 102.18 ÷ a * 100 (formula 4)
(2) amino acid analysis
Use Hitachi's amino acidanalyser (the high-speed amino acid analyzer L-8900 of Hitachi), carry out amino acid analysises such as Methionin, ornithine.At first, an amount of sample solution of weighing behind the dilute with water, carries out ultrafiltration (Microcom YM-10), with filtrate as analytical sample.Analysis condition adopts organism amino acid separation condition, and analytical method adopts ninhydrin (wavelength: 570nm, 440nm).Standard substance use amino-acid mixed standardization liquid ANII type and Type B diluted and that the pure medicine of light society makes, and the sample injection rate is set at 10 μ L.As quantitative Analysis, utilize one point external standard method, proline(Pro) calculates aminoacids content by the peak area of 440nm, other amino acid peak area by 570nm.
(3) measuring method of YI (Yellowness Index (yellowness index)) value
Refining five methylene diamine and five methylene diamine carbonate are taken a sample respectively.In above-mentioned refining five methylene diamine, add deionized water and hexanodioic acid, prepare the five methylene diamine hexanodioic acid aqueous solution of 50 weight %.In above-mentioned five methylene diamine carbonate, add deionized water and hexanodioic acid, carry out decarboxylation, prepare the five methylene diamine hexanodioic acid aqueous solution of 50 weight % simultaneously by the salt exchange.Then, use MINOLTASPECTROPHOTOMETER CM-3700d, proofread and correct with light source C, 2 ° of school zero, the whites of carrying out determining instrument in the visual field.Then, in Cell CM-A98 (optical length 10mm), add the five methylene diamine adipate aqueous solution of above-mentioned 50 weight %, carry out the mensuration of X, Y, Z, by measured value according to JIS K 7373 standard test YI values.
(4) measuring method of the relative viscosity of polyamide resin (η rel)
The sample that obtains polyamide resin by the five methylene diamine that from the five methylene diamine carbonate aqueous solution, reclaims and the polycondensation between the hexanodioic acid, the sample dissolution of resulting polyamide resin in the vitriol oil of 98 weight %, is prepared into the sample solution that concentration is 0.01g/mL.Then, use Ostwald's formula viscometer, measure 25 ℃ the elution time t of sample solution and the elution time t of the vitriol oil respectively 0, with (t/t 0) as relative viscosity (η Rel).
(5) measuring method of the fusing point of polyamide resin (Tm)
Use differential scanning calorimeter (the Robot DSC that DSC:SEIKO electronic industry society makes), under nitrogen atmosphere, measure the fusing point (Tm) of polyamide resin.About 5mg polyamide resin sample is fused fully, keep being reduced to 30 ℃ with 20 ℃/minute cooling rates after 3 minutes.Then, the polyamide resin sample in 30 ℃ of maintenances 3 minutes, is observed when 30 ℃ heat up with 20 ℃/minute heat-up rate then, the endotherm peak temperature of being observed is measured as fusing point Tm.Endotherm(ic)peak is 2 when above, is fusing point Tm with the top temperature.
(6) preparation of five methylene diamine carbonate aqueous solution
(A) LDC gene (cadA) strengthens the making of strain
(a) e. coli dna extracts:
Intestinal bacteria (Eschericia coli) JM109 strain is cultured to the logarithmic proliferation after date phase in 10mL LB (Luria-Bertani) substratum (form: 10g Tryptones, 5g yeast extract and 5g NaCl are dissolved in the 1L distilled water), with resulting thalline be suspended in contain the 10mg/mL N,O-Diacetylmuramidase 10mM NaCl/20mM Tris damping fluid (tris buffer) (pH8.0)/1mM EDTA2Na solution 0.15mL in.
Next, adding Proteinase K in above-mentioned suspension, to make its ultimate density be 100 μ g/mL, in 37 ℃ of insulations 1 hour.Further adding sodium lauryl sulphate and making its ultimate density is 0.5 weight %, in 50 ℃ of insulations 6 hours, prepares lysate.
Secondly, in this lysate, add (phenol/trichloromethane (volume ratio 1: 1)) solution of equivalent, after room temperature was slowly vibrated 10 minutes, all carry out centrifugation (5,000 * g, 20 minutes, 10～12 ℃), divide and get the supernatant part, add sodium acetate to 0.3M, the ethanol that adds 2 times of amounts mixes.Next, the throw out that will reclaim by centrifugation (15,000 * g, 2 minutes) with the cleaning of 70 weight % aqueous ethanolic solutions after, air-dry.In resulting DNA, add 10mM Tris damping fluid (pH7.5)/1mM EDTA2Na solution 5mL, leave standstill a night, be used for the template DNA of PCR described later (polymerase chain reaction) at 4 ℃.
(b) clone of cadA:
The acquisition of intestinal bacteria cadA is undertaken by following PCR, and described PCR is a template with the DNA of preparation in above-mentioned (a), has used synthetic DNA (sequence numbering 1 (sequence; GTTGCGTGTTCTGCTTCATCGCGCTGATG) and sequence numbering 2 (sequences; ACCAAGCTGATGGGTGAGATAGAGAATGAGTAAG)), described synthetic DNA is that the sequence (Genbank DatabaseAccession No.U00096) with this gene of e. coli k12-MG1655 strain of having reported whole genome sequence is that basic design goes out.
(reaction solution composition)
With the above-mentioned synthetic DNA (sequence numbering 1 (omission sequence) and sequence numbering 2 (omission sequence)) of 1 μ L template DNA, 0.2 μ L PfxDNA polysaccharase (manufacturing of Invitrogen society), damping fluid (1 times of concentration) (manufacturing of Invitrogen society), 0.3 μ M, the MgSO of 1mM 4Mix with the deoxynucleoside triphosphate (dATP, dCTP, dGTP and dTTP) of 0.25 μ M, making total amount is 20 μ L.
(temperature of reaction condition)
As the DNA thermal cycler, " PTC-200 " that uses MJ Research society to make carries out 35 times repeatedly by 94 ℃ following 20 seconds, 60 ℃ following 20 seconds and 72 ℃ of following circulations that constituted in 2.5 minutes.Just the insulation under 94 ℃ of the 1st round-robin is set at 1 minute 20 seconds, the insulation under 72 ℃ of last round-robin is set at 10 minutes.
Fig. 2 is the figure of the process of explanation clone cadA.
As shown in Figure 2, PCR comes amplified production is made with extra care by ethanol sedimentation after stopping, and cuts off with restriction enzyme Kpn I and restriction enzyme Sph I then.After by 0.75 weight % agarose (manufacturing of SeaKem GTG agarose:FMCBioProducts society) gel electrophoresis this DNA standard substance being separated, come visual by ethidium bromide staining, detect the fragment of the about 2.6kb that contains cadA thus, use QIA Quick Gel Extraction Kit (manufacturing of QIAGEN society) to reclaim the target dna fragment.
The dna fragmentation that reclaims is regulated the dna fragmentation that obtains and mixed with cutting off e. coli plasmid vector pUC18 (precious wine is made society and made) with restriction enzyme Kpn I and restriction enzyme Sph I, after using connection test kit ver.2 (precious wine is made society and made) to connect, with resulting plasmid DNA transformed into escherichia coli (JM109 strain).The recombination bacillus coli that obtains is like this spread upon on LB (Luria-Bertani) nutrient agar that contains 50 μ g/mL penbritins, 0.2mM IPTG (isopropyl-) and 50 μ g/mL X-Gal.
The clone of utilizing ordinary method will be formed with white colony on this substratum is carried out liquid culture, then plasmid DNA is made with extra care.Confirm,, can find the insertion fragment of about 2.5kb by resulting plasmid DNA is cut off with restriction enzyme Kpn I and restriction enzyme Sph I, and with this plasmid DNA called after pCAD1, will contain the e. coli strains called after JM109/pCAD1 of pCAD1.
(B) preparation of five methylene diamine carbonate aqueous solution
Use JM109/pCAD1, the Methionin carbonate aqueous solution as raw material, is equipped with five methylene diamine carbonate aqueous solution used among the embodiment in order to the below legal system.
(a) cultivation of JM109/pCAD1:
After cultivating before JM109/pCAD1 carried out in the flask that fills the LB substratum, the nutrient solution of 3mL is seeded in the 1L volumetrical flask of LB substratum of 2 times of concentration that fill 100mL, carries out stir culture with 250rpm in 35 ℃.Cultivation beginning back was added the IPTG (isopropyl-) through sterilizing on the 4th hour and made its ultimate density is 0.5mM, and continuation was thereafter cultivated 14 hours.
(b) separation of thalline and preservation:
With 8000rpm medium centrifugal was separated 10 minutes, discarded supernatant reclaims thalline.With 50mM sodium acetate buffer (damping fluid) the resulting wet thallus that suspends, employed sodium acetate buffer is 1/20 of a nutrient solution volume, when being saved to reaction needed for 4 ℃.
(c) five methylene diamine carbonate aqueous solution (i)
In 200L volumetrical reactive tank, prepare 50% (w/v) lysine solution (consonance fermenting organism society makes) 48kg and deionized water 30L, feed carbonic acid gas with 15L/min and add carbonic acid gas, be prepared into the Methionin carbonate aqueous solution.The pH of lysine solution near 10.3, follows the supply of carbonic acid gas at first, and pH oxytropism side reduces.When pH is almost constant, stop to supply with carbonic acid gas.The pH of this moment is about 7.5.
With pyridoxal phosphate add in the above-mentioned substrate solution to concentration be 0.1mM, the thalline that adds JM109/pCAD1 again reaches 0.5 to OD660 (Opitical Densitiy660), begins reaction.
Condition enactment during reaction is 37 ℃ of temperature, obstructed gas (0vvm), mixing speed 148rpm.During reaction, reactive tank is set at enclosed system, seals the carbonic acid gas of generation up for safekeeping, regulate pH.The reaction beginning is after 5 hours, and almost 100% Methionin is converted into five methylene diamine.Reacted solution (about 72L) is carried out the inactivation treatment (70 ℃, 20 minutes) of thalline.By above operation, preparation five methylene diamine carbonate aqueous solution (i).
The organic total content with 3 above functional groups that contains as impurity in the five methylene diamine carbonate aqueous solution (i) is to count 0.0063 (Methionin 0.0053, ornithine 0.0004, and other 0.0006) with respect to the part by weight of five methylene diamine.
(d) the five methylene diamine carbonate aqueous solution (ii)
Use UF film module (ACP-0013 that industry society of Asahi Chemical Industry makes) to handling by the five methylene diamine carbonate aqueous solution (i) of aforesaid operations preparation, prepare removed molecular weight be the high molecular body impurity more than 12,000 the five methylene diamine carbonate aqueous solution (ii).The rate of recovery that the UF film is handled is 99.4%.The rate of recovery that the UF film is handled is represented the yield of five methylene diamine.
The organic total content with 3 above functional groups that the five methylene diamine carbonate aqueous solution contains as impurity in (ii) is to count 0.0063 (Methionin 0.0053, ornithine 0.0004, and other 0.0006) with respect to the part by weight of five methylene diamine.
(e) the five methylene diamine carbonate aqueous solution (iii)
With above-mentioned five methylene diamine carbonate aqueous solution (ii) 5600g (total five methylene diamine concentration 18.7 weight %) add in the flask, under 102 ℃ of interior temperature (139 ℃ of oil bath temperatures), non-pressurized condition in the recycle-water, the beginning pyrolosis operation resolves into five methylene diamine crude product and carbonic acid gas.After decomposing beginning, pressure is remained on normal pressure, elevated temperature slowly, the moment that temperature reaches 180 ℃ (191 ℃ of oil bath temperatures) in final stops decomposition.
In 3L volumetrical reactive tank, prepare the water 0.40L that 50% (w/v) lysine solution 0.60kg and the decomposition process by above-mentioned five methylene diamine carbonate aqueous solution reclaim.Then, feeding is added carbonic acid gas by the carbon dioxide of the decomposition process recovery of above-mentioned five methylene diamine carbonate aqueous solution, prepares the Methionin carbonate aqueous solution.Near 10.2, along with the supply of carbonic acid gas, pH oxytropism side reduces the pH of lysine solution at first.When pH is almost constant, stop to supply with carbonic acid gas.The pH of this moment is about 7.5.
Adding pyridoxal phosphate to concentration in above-mentioned substrate solution is 0.1mM, and the thalline that adds JM109/pCAD1 again reaches 0.5 to OD660, begins reaction.Condition enactment during reaction is 37 ℃ of temperature, mixing speed 500rpm, and the carbonic acid gas that utilizes the decomposition process by above-mentioned five methylene diamine carbonate aqueous solution to reclaim makes and is carbon dioxide atmosphere in the reactive tank, keeps the pH constant.In the reaction, the thalline that adds 50% (w/v) lysine solution 0.60kg, water 0.35L, pyridoxal phosphate 0.1mM that the decomposition process by above-mentioned five methylene diamine carbonate aqueous solution reclaims and JM109/pCAD1 reaches 0.5 to OD660 (Optical Density 660), continues to react.Append lysine solution after 5 hours, almost 100% Methionin is converted into five methylene diamine.
Reacted solution is carried out the inactivation treatment (70 ℃, 20 minutes) of thalline, re-uses the UF film module and handle, be prepared into removed molecular weight be the high molecular body impurity more than 12,000 the five methylene diamine carbonate aqueous solution (iii).The yield of handling the five methylene diamine of the aqueous solution that reclaims by the UF film is 99.4%.
(f) the five methylene diamine carbonate aqueous solution (iv)
At the above-mentioned five methylene diamine carbonate aqueous solution of preparation (iii) the time, the five methylene diamine crude product that is obtained by the decomposition (ii) of above-mentioned five methylene diamine carbonate aqueous solution is distilled under the condition of 80 ℃ of interior temperature (110 ℃ of oil bath temperatures), pressure 2.67kPa, isolate refining five methylene diamine.
After in the refining five methylene diamine that obtains (five methylene diamine concentration is 99.2 weight %) 331.8g, adding deionized water 797.3g, add hexanodioic acid (manufacturing of Honshu chemical industry society) 470.8g.Secondly, be heated to 70 ℃, mixture is dissolved fully after, add a small amount of refining five methylene diamine, pH is adjusted into 8.4.After pH adjusted, as polycondensation catalyst, preparation was used for the aqueous solution of raw material of polycondensation to add previously prepared 0.2 weight % phosphorous acid aqueous solution 20.0g (using phosphorous acid (society makes the reagent superfine with the pure pharmaceutical worker's industry of light)).Then, above-mentioned raw materials aqueous solution 1500g is added in the autoclave, carry out nitrogen replacement.Thereafter, it is to begin to concentrate under the 0.20MPaG condition that the temperature in autoclave is set at 142 ℃, interior pressure, and temperature is 152 ℃ in being concentrated into, and reclaims the water that distills.Next, the sealing autoclave, temperature raises at leisure in making, and the temperature in the autoclave is set at 268 ℃, interior pressure is set at 1.57MPaG.Then, slowly after the release, slowly be decompressed to 61.3kPa, carry out the polycondensation of five methylene diamine and hexanodioic acid.And, reclaim the water that distills.
In 3L volumetrical reactive tank, prepare 50% (w/v) lysine solution 0.60kg, the above-mentioned raw materials aqueous solution concentrate and the polycondensation of above-mentioned five methylene diamine and hexanodioic acid in the water 0.40L that reclaims, feed carbonic acid gas with 2L/min, be prepared into the Methionin carbonate aqueous solution.Near 10.0, along with the supply of carbonic acid gas, pH oxytropism side reduces the pH of lysine solution at first.When pH is almost constant, stop to supply with carbonic acid gas.The pH of this moment is about 7.5.
Adding pyridoxal phosphate to concentration in substrate solution is 0.1mM, and the thalline that adds JM109/pCAD1 again reaches 0.5 to OD660, begins reaction.Condition enactment during reaction is 37 ℃ of temperature, obstructed gas (0vvm), mixing speed 500rpm.In the reaction, add 50% (w/v) lysine solution 0.60kg, the above-mentioned raw materials aqueous solution concentrate and the polycondensation of above-mentioned five methylene diamine and hexanodioic acid in the thalline of the water 0.35L, the pyridoxal phosphate 0.1mM that reclaim and JM109/pCAD1 reach 0.5 to OD660 (Optical Density 660), continue to react.The reaction beginning is after 5 hours, and almost 100% Methionin is converted into five methylene diamine.During reaction, the capping groove by enclosing the carbonic acid gas that reaction produces, is regulated pH.Append lysine solution after 5 hours, almost 100% Methionin is converted into five methylene diamine.
Reacted solution is carried out the inactivation treatment (70 ℃, 20 minutes) of thalline, re-uses the UF film module and handle, be prepared into removed molecular weight be the high molecular body impurity more than 12,000 the five methylene diamine carbonate aqueous solution (iv).The yield of handling the five methylene diamine of the aqueous solution that reclaims by the UF film is 99.4%.
(embodiment 1)
＜five methylene diamine refining and separate
(pyrolosis operation)
With above-mentioned five methylene diamine carbonate aqueous solution (ii) 5600g (total five methylene diamine concentration 18.7 weight %) add in the flask, under 102 ℃ of interior temperature (139 ℃ of oil bath temperatures), non-pressurized condition, begin to be decomposed into five methylene diamine crude product and carbonic acid gas in the time of recycle-water.After the decomposition beginning, remain on normal pressure, the while is elevated temperature at leisure, and temperature reaches the moment termination decomposition of 180 ℃ (191 ℃ of oil bath temperatures) in final, obtains the five methylene diamine crude product.Need to prove that the top temperature of pyrolosis operation is 180 ℃.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the resulting five methylene diamine crude product measured based on above-mentioned measuring method, and concentration is respectively 95.5 weight %, 93.5 weight %, 3.2 weight %.According to this measurement result, in the five methylene diamine crude product, with respect to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 98.0mol%.
(distillation process)
Then, the five methylene diamine crude product that obtains by aforesaid operations is distilled under the condition of 80 ℃ of interior temperature (110 ℃ of oil bath temperatures), pressure 2.67kPa, obtain refining five methylene diamine 924g (purity: 99.2 weight %).Yield is 87.6%.And, by the method same, prepare the 50 weight % five methylene diamine adipate aqueous solution with the aftermentioned enrichment process, measure YI according to the measuring method of above-mentioned YI, its result, YI value are 0.2.
Need to prove that yield is to use the numerical value of table 2 to calculate by following (formula 5).And, concentration (mol%) for the five methylene diamine under the pyrolosis operation condition of table 2 and table 3, use five methylene diamine concentration (weight %) and five methylene diamine carbonate concentration (weight %) by above-mentioned titration determination, the summation of five methylene diamine and five methylene diamine carbonate is made as 100mol%, calculates the concentration (mol%) of five methylene diamine by following (formula 6).
(refining five methylene diamine gross weight * total five methylene diamine concentration ÷ 100) ÷ (raw material gross weight * total five methylene diamine concentration ÷ 100) * 100 (formulas 5)
(five methylene diamine concentration (weight %) ÷ 102.18) ÷ ((five methylene diamine concentration (weight %) ÷ 102.18)+(five methylene diamine carbonate concentration (weight %) ÷ 164.21)) * 100 (formulas 6)
(enrichment process)
In the refining five methylene diamine 331.8g that obtains by aforesaid operations (purity: add deionized water 797.3g 99.2 weight %), add hexanodioic acid 470.8g then.Next, be heated to 70 ℃, mixture is dissolved fully after, add a small amount of refining five methylene diamine, pH is adjusted into 8.4.PH adds previously prepared 0.2 weight % phosphorous acid aqueous solution 20.0g as polycondensation catalyst after adjusting, and is prepared into the aqueous solution of raw material that is used for polycondensation.
Then, above-mentioned raw materials aqueous solution 1500g is added in the autoclave, carry out nitrogen replacement.Then, the temperature in autoclave is that 142 ℃, interior pressure are to begin to concentrate under the condition of 0.20MPaG, and continuing to concentrate until interior temperature is 152 ℃, reclaims the water that distills out.
(polycondensation operation)
Next, the sealing autoclave, temperature slowly raises in making, and the temperature in the autoclave is set at 268 ℃, interior pressure is set at 1.57MPaG.Then, after the release, be decompressed to 61.3kPa at leisure at leisure, carry out the polycondensation of five methylene diamine and hexanodioic acid.And, reclaim the water that distills out.
Polycondensation is made line material shape with content after stopping, and after the cooling, makes particle with rotary dicing machine in tank.Is below the 0.1 weight % with 120 ℃, the dry resulting granules of the condition of 0.13kPa until water ratio, obtains polyamide resin.Relative viscosity (the η of resulting polyamide resin Rel) be 3.3, fusing point (Tm) is 255 ℃.The results are shown in table 2.
Gather the evaluation result of listing reaction conditions, its result and polyamide resin etc. in embodiment 1～10, comparative example 1 and comparative example 2 each operation separately in table 2 and the table 3.
In addition, in table 2 and the table 3, "-" expression is not implemented or is not measured.
And, in table 2 and the table 3, " 56 " of " kind of polyamide resin " expression nylon 56, " 510 " expression nylon 510, " 512 " expression nylon 512.
(embodiment 2)
(pyrolosis operation and distillation process)
In the pyrolosis operation, to gas phase be blown into nitrogen on one side, carry out the decomposition (ii) of five methylene diamine carbonate aqueous solution on one side, carry out 1 identical operations in addition with embodiment, obtain refining five methylene diamine 959g (purity: 99.4 weight %).Yield is 91.0%.In addition, the top temperature of the interior temperature of pyrolosis operation is 180 ℃.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the resulting five methylene diamine crude product measured based on above-mentioned measuring method, and concentration is respectively 96.8 weight %, 96.8 weight %, 0.0 weight %.According to this measurement result, in the five methylene diamine crude product, with respect to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 100mol%.
(enrichment process and polycondensation operation)
Except that using refining five methylene diamine 331.2g (purity 99.4 weight %), the deionized water 798.0g that obtains by aforesaid operations, under the condition identical, concentrate and polycondensation with embodiment 1, obtain polyamide resin.The results are shown in table 2.
(embodiment 3)
(pyrolosis operation)
With above-mentioned five methylene diamine carbonate aqueous solution (ii) 5600g (total five methylene diamine concentration 18.7 weight %) add in the flask, under 102 ℃ of interior temperature (137 ℃ of oil bath temperatures), condition of normal pressure, heat and reflux, be decomposed into five methylene diamine crude product and carbonic acid gas.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the above-mentioned five methylene diamine crude product measured based on above-mentioned measuring method, and concentration is respectively 21.1 weight %, 14.9 weight %, 10.0 weight %.According to this measurement result, in the five methylene diamine crude product, with respect to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 70.5mol%.
Then, on one side recycle-water, one side is elevated temperature at leisure, and temperature reaches the moment termination decomposition of 180 ℃ (191 ℃ of oil bath temperatures) in final, obtains the five methylene diamine crude product.Need to prove that in the pyrolosis operation, the top temperature of interior temperature is 180 ℃.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the five methylene diamine crude product that is obtained by above-mentioned pyrolosis operation measured based on above-mentioned measuring method, and concentration is respectively 96.7 weight %, 96.7 weight %, 0.0 weight %.According to this measurement result, in the five methylene diamine crude product, with respect to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 100mol%.
(distillation process)
Then, the five methylene diamine crude product that obtains by aforesaid operations is distilled under the condition of 80 ℃ of interior temperature (110 ℃ of oil bath temperatures), pressure 2.67kPa, obtain refining five methylene diamine 939g (purity: 99.2 weight %).Yield is 88.9%.
(enrichment process and polycondensation operation)
The refining five methylene diamine that use obtains by aforesaid operations concentrates and polycondensation under the condition identical with embodiment 1, obtains polyamide resin.The results are shown in table 2.
(embodiment 4)
(pyrolosis operation)
With above-mentioned five methylene diamine carbonate aqueous solution (ii) 5600g (total five methylene diamine concentration 18.7 weight %) add in the flask, recycle-water under the condition of 77 ℃ of interior temperature (99 ℃ of oil bath temperatures), 40.0kPa, begin simultaneously to decompose, be decomposed into five methylene diamine crude product and carbonic acid gas.After decomposing beginning, elevated temperature at leisure, the moment that temperature reaches 134 ℃ (156 ℃ of oil bath temperatures) in final stops decomposition, obtains the five methylene diamine crude product.In addition, the top temperature of pyrolosis operation is 134 ℃.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the resulting five methylene diamine crude product measured based on above-mentioned measuring method, and concentration is respectively 91.8 weight %, 79.4 weight %, 19.9 weight %.According to this measurement result, in the five methylene diamine crude product, with respect to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 86.5mol%.
(distillation process)
Then, under the condition identical, the five methylene diamine crude product that obtains by aforesaid operations is distilled, obtain refining five methylene diamine 772g (purity: 96.7 weight %) with embodiment 1.Yield is 71.3%.
(enrichment process)
In the refining five methylene diamine 291.1g that obtains by aforesaid operations (purity: after adding deionized water 790.4g 96.7 weight %), add nonane diacid (manufacturing of COGNIS corporation society) 518.5g.Then, be heated to 70 ℃, mixture is dissolved fully after, confirm that pH is 7.8.After confirming pH, 96.7 weight %), acetate (society makes with the pure pharmaceutical worker's industry of light) 2.5g and add refining five methylene diamine 3.5g (purity:, prepare the aqueous solution of raw material that is used for polycondensation as previously prepared 0.135 weight % hydrogen phosphite, the two sodium water solution 22.7g (using hydrogen phosphite disodium pentahydrate (manufacturings of Kishida Chemical society)) of polycondensation catalyst.
Then, above-mentioned raw materials aqueous solution 1500g is added in the autoclave, carry out nitrogen replacement.Next, the temperature in autoclave is to begin to concentrate under 142 ℃, the condition of interior pressure 0.20MPaG, and continuing to concentrate until interior temperature is 152 ℃, reclaims the water that distills out.
(polycondensation operation)
Next, the sealing autoclave, temperature slowly raises in making, and the temperature in the autoclave is set at 260 ℃, interior pressure is set at 1.57MPaG.Then, after the release, be decompressed to 20.0kPa at leisure at leisure, carry out the polycondensation of five methylene diamine and nonane diacid.And, reclaim the water that distills out.
Polycondensation is made line material shape with content after stopping, and after the cooling, makes particle with rotary dicing machine in tank.Dry resulting granules is below the 0.1 weight % until water ratio under 120 ℃, the condition of 0.13kPa, obtains polyamide resin.Relative viscosity (the η of resulting polyamide resin Rel) be 2.5, fusing point (Tm) is 210 ℃.The results are shown in table 2.
(embodiment 5)
(pyrolosis operation)
With above-mentioned five methylene diamine carbonate aqueous solution (ii) 5600g (total five methylene diamine concentration 18.7 weight %) add in the flask, in the time of recycle-water, under the condition of 52 ℃ of interior temperature (78 ℃ of oil bath temperatures), 13.3kPa, begin to be decomposed into five methylene diamine crude product and carbonic acid gas.After decomposing beginning, elevated temperature at leisure, the moment that temperature reaches 113 ℃ (129 ℃ of oil bath temperatures) in final stops decomposition, obtains the five methylene diamine crude product.Need to prove that the top temperature of pyrolosis operation is 113 ℃.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the resulting five methylene diamine crude product measured based on above-mentioned measuring method, and concentration is respectively 85.4 weight %, 67.2 weight %, 29.3 weight %.According to this measurement result, in the five methylene diamine crude product, with respect to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 78.7mol%.
(distillation process)
Then, the five methylene diamine crude product that obtains by aforesaid operations is distilled under the condition identical with embodiment 1, obtain refining five methylene diamine 547g (purity: 89.2 weight %).Yield is 46.6%.
(enrichment process)
In the refining five methylene diamine 301.0g that obtains by aforesaid operations (purity: after adding deionized water 767.5g 89.2 weight %), add sebacic acid (little Cang Hechenggongyeshe makes) 531.5g.Secondly, be heated to 70 ℃, mixture is dissolved fully after, confirm that pH is 7.7.After pH confirms, add refining five methylene diamine 4.8g (purity: 89.2 weight %), acetate 3.0g, as previously prepared 0.135 weight % hydrogen phosphite, the two sodium water solution 22.7g of polycondensation catalyst, preparation is used for the aqueous solution of raw material of polycondensation.
Then, above-mentioned raw materials aqueous solution 1500g is added in the autoclave, carry out nitrogen replacement.Secondly, the temperature in autoclave is that 143 ℃, interior pressure are to begin to concentrate under the condition of 0.20MPaG, and continuing to concentrate until interior temperature is 152 ℃, reclaims the water that distills out.
(polycondensation operation)
Subsequently, the sealing autoclave, temperature slowly raises in making, and the temperature in the autoclave is set at 260 ℃, interior pressure is set at 1.57MPaG.Then, after the release, be decompressed to 33.3kPa at leisure at leisure, carry out the polycondensation of five methylene diamine and sebacic acid.And, reclaim the water that distills out.
Polycondensation is made line material shape with content after stopping, and after the cooling, makes particle with rotary dicing machine in tank.Dry resulting granules is below the 0.1 weight % until water ratio under 120 ℃, the condition of 0.13kPa, obtains polyamide resin.Relative viscosity (the η of resulting polyamide resin Rel) be 2.5, fusing point (Tm) is 218 ℃.The results are shown in table 2.
Table 2
Figure BPA00001272907600311
(embodiment 6)
(pyrolosis operation)
With above-mentioned five methylene diamine carbonate aqueous solution (ii) (total five methylene diamine concentration 18.7 weight %) 5600g add in the flask, under the condition of 39 ℃ of interior temperature (60 ℃ of oil bath temperatures), 6.67kPa, one side recycle-water is Yi Bian be decomposed into five methylene diamine crude product and carbonic acid gas.After decomposing beginning, elevated temperature at leisure, the moment that temperature reaches 89 ℃ (98 ℃ of oil bath temperatures) in final stops decomposition, obtains the five methylene diamine crude product.Need to prove that in the pyrolosis operation, the top temperature of interior temperature is 89 ℃.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the resulting five methylene diamine crude product measured based on above-mentioned measuring method, and concentration is respectively 75.7 weight %, 46.5 weight %, 46.9 weight %.According to this measurement result, in the five methylene diamine crude product, with respect to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 61.4mol%.
(distillation process)
Then, under the distillation condition identical, the five methylene diamine crude product is distilled, obtain refining five methylene diamine 522g (purity: 44.0 weight %) with embodiment 1.Yield is 22.0%.
(embodiment 7)
(pyrolosis operation)
With above-mentioned five methylene diamine carbonate aqueous solution (ii) 5600g (total five methylene diamine concentration 18.7 weight %) add in the autoclave, under the condition of 124 ℃ of interior temperature (160 ℃ of oil bath temperatures), 200kPa, begin to be decomposed into five methylene diamine crude product and carbonic acid gas in the time of recycle-water.Elevated temperature at leisure, the moment that temperature reaches 204 ℃ (212 ℃ of jacket temperatures) in final stops decomposition, obtains the five methylene diamine crude product.Need to prove that in the pyrolosis operation, the top temperature of interior temperature is 204 ℃.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the resulting five methylene diamine crude product measured based on above-mentioned measuring method, and concentration is respectively 96.6 weight %, 96.6 weight %, 0.0 weight %.According to this measurement result, in the five methylene diamine crude product, with respect to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 100mol%.
(distillation process)
Then, the five methylene diamine crude product that will obtain by aforesaid operations adds in the flask, distills under the condition identical with embodiment 1, obtains refining five methylene diamine 945g (purity: 99.1 weight %).Yield is 89.4%.
(enrichment process)
In the refining five methylene diamine 248.1g that obtains by aforesaid operations (purity: after adding deionized water 975.5g 99.1 weight %), add dodecanedioic acid (manufacturing of emerging product society of space portion) 554.1g.Then, be heated to 70 ℃, mixture is dissolved fully after, confirm that pH is 7.7.After confirming pH, add refining five methylene diamine 4.4g (purity: 99.1 weight %), acetate 3.0g, as previously prepared 0.135 weight % hydrogen phosphite, the two sodium water solution 22.7g of polycondensation catalyst, preparation is used for the aqueous solution of raw material of polycondensation.
Then, above-mentioned raw materials aqueous solution 1500g is added in the autoclave, carry out nitrogen replacement.Secondly, the temperature in autoclave is to begin to concentrate under 144 ℃, the condition of interior pressure 0.20MPaG, and continuing to concentrate until interior temperature is 152 ℃, reclaims the water that distills out.
(polycondensation operation)
Next, the sealing autoclave, temperature slowly raises in making, and the temperature in the autoclave is set at 260 ℃, interior pressure is set at 1.57MPaG.Then, after the release, slowly be decompressed to 33.3kPa at leisure, carry out the polycondensation of five methylene diamine and dodecanedioic acid.And, reclaim the water that distills out.
Polycondensation is made line material shape with content after stopping, and after the cooling, makes particle with rotary dicing machine in tank.Dry resulting granules is below the 0.1 weight % until water ratio under 120 ℃, the condition of 0.13kPa, obtains polyamide resin.Relative viscosity (the η of resulting polyamide resin Rel) be 2.5, fusing point (Tm) is 211 ℃.The results are shown in table 2.
(embodiment 8)
(pyrolosis operation and distillation process)
Use above-mentioned five methylene diamine carbonate aqueous solution (i), under the condition identical, obtain refining five methylene diamine 827g (purity: 98.4 weight %) in addition with embodiment 1.Yield is 77.7%.Need to prove that the top temperature of pyrolosis operation is 180 ℃.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the resulting five methylene diamine crude product measured based on above-mentioned measuring method, and concentration is respectively 96.2 weight %, 96.2 weight %, 0.0 weight %.According to this measurement result, in the five methylene diamine crude product, with respect to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 100mol%.
(polycondensation operation)
In the refining five methylene diamine 10.45g that obtains by aforesaid operations (purity: after adding deionized water 24.83g 98.4 weight %), add hexanodioic acid 14.71g.Then, be heated to 70 ℃, mixture is dissolved fully after, add a small amount of refining five methylene diamine, pH is adjusted into 8.4.After adjusting pH, add the previously prepared 0.2 weight % phosphorous acid aqueous solution 0.625g as polycondensation catalyst, preparation is used for the aqueous solution of raw material of polycondensation.
Then, after in the above-mentioned raw materials aqueous solution 40g adding special glass container, the special glass container is put into autoclave, carry out nitrogen replacement.Secondly, autoclave is dipped in 100 ℃ the oil bath, is heated to 270 ℃, begin polycondensation with about 1 hour temperature with oil bath.
After polycondensation begins, kept 2 hours, next, after the release, be decompressed to 61.3kPa more at leisure, kept 1 hour, stop polycondensation to press in the autoclave of 1.57MPaG.
After polycondensation stops, the interior pressure of autoclave maintained carry out naturally cooling under the decompression state, take out the polyamide resin that obtains by polycondensation behind the naturally cooling.Relative viscosity (the η of polyamide resin Rel) be 3.3, fusing point (Tm) is 255 ℃.The results are shown in table 3.
(embodiment 9)
(pyrolosis operation)
With above-mentioned five methylene diamine carbonate aqueous solution (iii) 900g (total five methylene diamine concentration 18.8 weight %) add in the flask, under 102 ℃ of interior temperature (139 ℃ of oil bath temperatures), non-pressurized condition, in the recycle-water, begin to be decomposed into five methylene diamine crude product and carbonic acid gas.Maintain normal pressure, the while is elevated temperature at leisure, and temperature reaches the moment termination decomposition of 180 ℃ (190 ℃ of jacket temperatures) in final, obtains the five methylene diamine crude product.Need to prove that in the pyrolosis operation, the top temperature of interior temperature is 180 ℃.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the resulting five methylene diamine crude product measured based on above-mentioned measuring method, and concentration is respectively 96.0 weight %, 96.0 weight %, 0.0 weight %.According to this measurement result, in the five methylene diamine crude product, with respect to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 100mol%.
(distillation process)
Then, under the condition identical, the five methylene diamine crude product that obtains by aforesaid operations is distilled, obtain refining five methylene diamine 154g (purity: 98.3 weight %) with embodiment 1.Yield is 89.3%.
(polycondensation operation)
98.3 weight %), deionized water 24.82g the refining five methylene diamine 10.47g that use obtains by aforesaid operations (purity:, in addition, under condition similarly to Example 8, carry out polycondensation, obtain polyamide resin.The results are shown in table 3.
(embodiment 10)
(pyrolosis operation and distillation process)
Use (iv) 900g (total five methylene diamine concentration 18.8 weight %) of above-mentioned five methylene diamine carbonate aqueous solution, in addition, under condition similarly to Example 8, obtain refining five methylene diamine 152g (purity: 99.2 weight %).Yield is 89.3%.Need to prove that the top temperature of pyrolosis operation is 180 ℃.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the resulting five methylene diamine crude product measured based on above-mentioned measuring method, and concentration is respectively 95.8 weight %, 95.8 weight %, 0.0 weight %.According to this measurement result, in the five methylene diamine crude product, with respect to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 100mol%.
(polycondensation operation)
The refining five methylene diamine that use obtains by aforesaid operations (purity: 99.2 weight %) 10.37g, deionized water 24.92g, in addition, under condition similarly to Example 8, carry out polycondensation, obtain polyamide resin.The results are shown in table 3.
(comparative example 1)
(pyrolosis operation)
With above-mentioned five methylene diamine carbonate aqueous solution (ii) 5600g (total five methylene diamine concentration 18.7 weight %) add in the flask, under 71 ℃ of interior temperature (74 ℃ of oil bath temperatures), non-pressurized condition, one side recycle-water, be decomposed into five methylene diamine crude product and carbonic acid gas on one side, obtain the five methylene diamine crude product.Need to prove that the top temperature of pyrolosis operation is 71 ℃.Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration in the resulting five methylene diamine crude product measured based on above-mentioned measuring method, and concentration is respectively 19.6 weight %, 4.7 weight %, 24.0 weight %.According to this measurement result, in the five methylene diamine crude product, with respect to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 24.0mol%.
(distillation process)
Next, under the condition of 40 ℃ of interior temperature (100 ℃ of oil bath temperatures), 6.7kPa, make the five methylene diamine carbonate aqueous solution dehydration that obtains by aforesaid operations, carry out the distillation of five methylene diamine simultaneously.The purified five methylene diamine is the aqueous solution (total five methylene diamine concentration: 2.0 weight %), obtain 3217g.Yield is 6.1%.
(comparative example 2)
(pyrolosis operation)
With above-mentioned five methylene diamine carbonate aqueous solution (ii) 500g (total five methylene diamine concentration 18.7 weight %) add in the flask, and add gac 50g (Mitsubishi Chemical Ka Ergang society makes, MM-11), stirred 30 minutes in 30 ℃.Secondly, remove by filter gac, the resulting aqueous solution is added in the flask, under the condition of 40 ℃ of interior temperature (65 ℃ of oil bath temperatures), 6.67kPa, utilize vaporizer to concentrate.After concentrating, obtain solidified five methylene diamine carbonate 126g (total five methylene diamine concentration 64.3 weight %), yield is 86.2%.
Total five methylene diamine concentration, five methylene diamine concentration and five methylene diamine carbonate concentration are measured based on above-mentioned measuring method, and concentration is respectively 64.3 weight %, 13.8 weight %, 81.1 weight %.According to this measurement result, in solidified five methylene diamine carbonate, with respect to five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is 21.5mol%.And, utilize and the same method of polycondensation operation described later, prepare the five methylene diamine adipate aqueous solution of 50 weight %, according to the measuring method of above-mentioned YI, measure YI, its result, YI value are 141.
(polycondensation operation)
In the solidified five methylene diamine carbonate 16.00g that obtains by aforesaid operations (total five methylene diamine concentration: add deionized water 22.77g 64.3 weight %), make solidified five methylene diamine dissolves carbonate.Next, add hexanodioic acid 14.71g, be heated to 70 ℃, mixture is dissolved fully after, add the refining five methylene diamine (purity: 99.2 weight %), pH is adjusted into 8.4 that in embodiment 1, obtains on a small quantity.After adjusting pH, add previously prepared 0.2 weight % phosphorous acid aqueous solution 0.625g as polycondensation catalyst, preparation is used for the aqueous solution of raw material of polycondensation.
Then, after in the above-mentioned raw materials aqueous solution 40g adding special glass container, the special glass container is put into autoclave, carry out nitrogen replacement.Secondly, in the oil bath with 100 ℃ of autoclave immersions, be heated to 270 ℃, the beginning polycondensation with about 1 hour temperature with oil bath.
After polycondensation begins, keep pressing 2 hours in the autoclave, next, after the release, be decompressed to 61.3kPa more at leisure, kept 1 hour, stop polycondensation with 1.57MPaG.
After polycondensation stops, the interior pressure of autoclave is maintained decompression state carry out naturally cooling, take out the polyamide resin that obtains by polycondensation behind the naturally cooling.Polyamide resin has dark brown, and more crisp.
Table 3
Figure BPA00001272907600371
Industrial applicibility
The present invention can make five methylene diamine by lysine with high yield by simple manufacturing process, uses resulting five methylene diamine to make us expecting very much to have industrial applicibility as 56 nylon of raw material etc. as the polymer of plant origin. In addition, in the operation of manufacturing five methylene diamine of the present invention, re-use after reclaiming by part or all carbon dioxide that will generate or water, can reduce the manufacturing of following them, transmit the energy and the discharge of carbon dioxide and the discharge of water that consume.
In addition, the full content of Japanese patent application 2009-109805 number of submitting on April 28th, Japanese patent application 2008-274582 number 1 of submitting on October 24th, Japanese patent application 2008-174342 number 1 of submitting on July 3rd, 2008 and Japanese patent application 2009-158806 number specification sheets, claims, accompanying drawing and summary submitting on July 3rd, 2009 is quoted so far, charged to the application as the disclosure of specification sheets of the present invention.
Figure ISB00000397835800011

Claims (29)

1. the manufacture method of a refining five methylene diamine is characterized in that, this manufacture method comprises:
Pyrolosis operation in this pyrolosis operation, by heating five methylene diamine carbonate, obtains five methylene diamine crude product and carbonic acid gas; With
Distillation process in this distillation process, will be distilled by the five methylene diamine crude product that above-mentioned pyrolosis operation obtains, and obtains five methylene diamine,
In above-mentioned five methylene diamine crude product, with respect to the summation 100mol% of five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is more than the 30mol%.
2. the manufacture method of refining five methylene diamine as claimed in claim 1 is characterized in that, in the described pyrolosis operation, the top temperature of heating is 40 ℃～300 ℃.
3. the manufacture method of refining five methylene diamine as claimed in claim 1 or 2 is characterized in that, the condition of described distillation process is following (1) and (2),
(1) distillation temperature: 40 ℃～300 ℃
(2) distillation pressure: 0.2kPa～1200kPa, absolute pressure.
4. the manufacture method of a refining five methylene diamine is characterized in that, this manufacture method comprises: pyrolosis operation in this pyrolosis operation, by heating five methylene diamine carbonate, obtains five methylene diamine crude product and carbonic acid gas; With
Distillation process in this distillation process, will be distilled by the five methylene diamine crude product that above-mentioned pyrolosis operation obtains, and obtains five methylene diamine,
The top temperature of the heating in the above-mentioned pyrolosis operation is 110 ℃～300 ℃.
5. as the manufacture method of each described refining five methylene diamine of claim 1～4, it is characterized in that in the described pyrolosis operation, five methylene diamine carbonate is the aqueous solution of five methylene diamine carbonate, by heating, obtain five methylene diamine crude product, carbonic acid gas and water.
6. as the manufacture method of each described refining five methylene diamine of claim 1～5, it is characterized in that the pressure in the described pyrolosis operation is 2kPa～1200kPa.
7. as the manufacture method of each described refining five methylene diamine of claim 1～6, it is characterized in that, in the described pyrolosis operation, Yi Bian be blown into gas, Yi Bian heat five methylene diamine carbonate.
8. the manufacture method of refining five methylene diamine as claimed in claim 7 is characterized in that, described gas is rare gas element.
9. as the manufacture method of each described refining five methylene diamine of claim 1～8, it is characterized in that, before described pyrolosis operation, has enzymatic decarboxylic reaction operation, in the described enzymatic decarboxylic reaction operation, use is selected from by lysine decarboxylase, has improved at least a kind in the group that the handled thing of lysine decarboxylase active recombinant microorganism, the cell that produces lysine decarboxylase and this cell forms, by Methionin and/or Methionin carbonate production five methylene diamine carbonate.
10. the manufacture method of refining five methylene diamine as claimed in claim 9 is characterized in that, in the described enzymatic decarboxylic reaction operation, described Methionin and/or Methionin carbonate are the aqueous solution of this Methionin and/or the aqueous solution of this Methionin carbonate.
11. the manufacture method as claim 9 or 10 described refining five methylene diamines is characterized in that, carries out described enzymatic decarboxylic reaction operation under carbon dioxide atmosphere.
12. the manufacture method as each described refining five methylene diamine of claim 9～11 is characterized in that, has the Methionin carbonate generation operation that is obtained Methionin carbonate by Methionin and carbonic acid gas before described enzymatic decarboxylic reaction operation.
13. the manufacture method of refining five methylene diamine as claimed in claim 12 is characterized in that, described Methionin carbonate generates in the operation, and Methionin is the aqueous solution.
14. the manufacture method of refining five methylene diamine as claimed in claim 11 is characterized in that, with the carbonic acid gas that generates in the described pyrolosis operation as the carbon dioxide recovery of enzymatic decarboxylic reaction operation, re-use.
15. the manufacture method of refining five methylene diamine as claimed in claim 12 is characterized in that, with the carbonic acid gas that generates in the described pyrolosis operation as being used for carbon dioxide recovery that described Methionin carbonate generates operation, re-using.
16. the manufacture method of refining five methylene diamine as claimed in claim 10 is characterized in that, the water that generates in the described pyrolosis operation water as described enzymatic decarboxylic reaction operation is reclaimed, re-uses.
17. the manufacture method of refining five methylene diamine as claimed in claim 13 is characterized in that, the water that generates in the described pyrolosis operation is reclaimed, re-uses as the water that described Methionin carbonate generates operation.
18. manufacture method as each described refining five methylene diamine of claim 5～17, it is characterized in that the weight ratio of the five methylene diamine that is contained in the described aqueous solution of the organic total content with 3 above functional groups with respect to five methylene diamine carbonate that is contained in the five methylene diamine carbonate is below 0.01.
19. the manufacture method of refining five methylene diamine as claimed in claim 18 is characterized in that, the organism with 3 above functional groups that is contained in the described aqueous solution of five methylene diamine carbonate is a Methionin.
20. the manufacture method as each described refining five methylene diamine of claim 5～19 is characterized in that, the macromolecule impurity that is contained in the aqueous solution with five methylene diamine carbonate heats after removing.
21. the manufacture method of refining five methylene diamine as claimed in claim 20 is characterized in that, uses ultra-filtration membrane to remove the macromolecule impurity that is contained in the aqueous solution of five methylene diamine carbonate.
22. the manufacture method of a polyamide resin is characterized in that, this manufacture method comprises:
Enzymatic decarboxylic reaction operation, in this enzymatic decarboxylic reaction operation, use is selected from by lysine decarboxylase, improved at least a in the group that the handled thing of lysine decarboxylase active recombinant microorganism, the cell that produces lysine decarboxylase and this cell forms, by Methionin and/or Methionin carbonate production five methylene diamine carbonate;
Pyrolosis operation in this pyrolosis operation, by the five methylene diamine carbonate that above-mentioned enzymatic decarboxylic reaction operation obtains, obtains five methylene diamine crude product and carbonic acid gas by heating;
Distillation process in this distillation process, will be distilled by the five methylene diamine crude product that above-mentioned pyrolosis operation obtains, and obtains five methylene diamine; With
The polycondensation operation in this polycondensation operation, will be carried out polycondensation as monomer component by the five methylene diamine that dicarboxylic acid and above-mentioned distillation process obtain,
In the five methylene diamine crude product that obtains in the above-mentioned pyrolosis operation, with respect to the summation 100mol% of five methylene diamine and five methylene diamine carbonate, the concentration of five methylene diamine is more than the 30mol%.
23. the manufacture method of a polyamide resin is characterized in that, this manufacture method comprises:
Enzymatic decarboxylic reaction operation, in this enzymatic decarboxylic reaction operation, use by lysine decarboxylase, improved at least a in the group that the handled thing of lysine decarboxylase active recombinant microorganism, the cell that produces lysine decarboxylase or this cell forms, by Methionin and/or Methionin carbonate production five methylene diamine carbonate;
Pyrolosis operation in this pyrolosis operation, by the five methylene diamine carbonate that above-mentioned enzymatic decarboxylic reaction operation obtains, obtains five methylene diamine crude product and carbonic acid gas by heating;
Distillation process in this distillation process, will be distilled by the five methylene diamine crude product that above-mentioned pyrolosis operation obtains, and obtains five methylene diamine; With
The polycondensation operation in this polycondensation operation, is carried out polycondensation with dicarboxylic acid with by the five methylene diamine that above-mentioned distillation process obtains as monomer component,
The top temperature of the heating in the above-mentioned pyrolysis operation is 110 ℃～300 ℃.
24. manufacture method as claim 22 or 23 described polyamide resins, it is characterized in that, before described polycondensation operation, has enrichment process, in this enrichment process, after utilizing described five methylene diamine, dicarboxylic acid and water to make the five methylene diamine dicarboxylate aqueous solution, water is removed in distillation.
25. manufacture method as each described polyamide resin of claim 22～24, it is characterized in that, in the described enzymatic decarboxylic reaction operation, described Methionin and/or Methionin carbonate are the aqueous solution of this Methionin and/or the aqueous solution of this Methionin carbonate.
26. the manufacture method as each described polyamide resin of claim 22～25 is characterized in that, before described enzymatic decarboxylic reaction operation, has the Methionin carbonate generation operation that is obtained Methionin carbonate by Methionin and carbonic acid gas.
27. the manufacture method of polyamide resin as claimed in claim 26 is characterized in that, described Methionin carbonate generates in the operation, and Methionin is the aqueous solution.
28. the manufacture method of polyamide resin as claimed in claim 25 is characterized in that, the water that generates in described polycondensation operation and/or the enrichment process water as described enzymatic decarboxylic reaction operation is reclaimed, re-uses.
29. the manufacture method of polyamide resin as claimed in claim 27 is characterized in that, the water that generates in described polycondensation operation and/or the enrichment process is reclaimed, re-uses as the water that described Methionin carbonate generates operation.
CN200980121108.3A 2008-07-03 2009-07-03 The manufacture method of five methylene diamine and the manufacture method of polyamide resin Active CN102056889B (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
JP2008-174342 2008-07-03
JP2008174342 2008-07-03
JP2008-274582 2008-10-24
JP2008274582 2008-10-24
PCT/JP2009/062218 WO2010002000A1 (en) 2008-07-03 2009-07-03 Process for production of pentamethylenediamine, and process for production of polyamide resin

Publications (2)

Publication Number Publication Date
CN102056889A true CN102056889A (en) 2011-05-11
CN102056889B CN102056889B (en) 2016-01-20

Family

ID=41466090

Family Applications (1)

Application Number Title Priority Date Filing Date
CN200980121108.3A Active CN102056889B (en) 2008-07-03 2009-07-03 The manufacture method of five methylene diamine and the manufacture method of polyamide resin

Country Status (2)

Country Link
CN (1) CN102056889B (en)
WO (1) WO2010002000A1 (en)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104762336A (en) * 2014-01-06 2015-07-08 上海凯赛生物技术研发中心有限公司 Method for preparing 1,5-pentanediamine
CN104968640A (en) * 2013-02-08 2015-10-07 味之素株式会社 Method for preserving 1,5-pentadiamine or salt thereof, method for preventing discoloration of same, and packaged 1,5-pentadiamine or salt thereof
CN104974046A (en) * 2014-04-03 2015-10-14 上海凯赛生物技术研发中心有限公司 Purifying method of pentanediamine
US9234203B2 (en) 2012-05-21 2016-01-12 Cathay Industrial Biotech Ltd. Stabilized recombinant expression plasmid vector in hafnia alvei and applications thereof
US9475792B2 (en) 2009-01-20 2016-10-25 Merck Patent Gmbh Materials for organic electroluminescence devices
JPWO2015076233A1 (en) * 2013-11-19 2017-03-16 東レ株式会社 Polyamide resin, polyamide resin pellets and method for producing polyamide resin
CN107338275A (en) * 2016-04-13 2017-11-10 宁夏伊品生物科技股份有限公司 The method for producing pentanediamine using accessory substance carbon dioxide automatic control pH whole-cell catalytic
CN107709568A (en) * 2014-12-23 2018-02-16 基因组股份公司 Method for producing and processing diamines
CN108997141A (en) * 2018-08-28 2018-12-14 河北美邦工程科技股份有限公司 A kind of preparation method of 1,5- pentanediamine
US10619148B2 (en) 2015-02-03 2020-04-14 Cathay Biotech Inc. Immobilized cell and preparation method thereof
US10759737B2 (en) 2016-02-06 2020-09-01 Cathay Biotech Inc. Method for extracting 1,5-pentanediamine from solution system containing 1,5-pentanediamine salt
TWI710638B (en) * 2017-10-18 2020-11-21 南韓商Ｃｊ第一製糖股份有限公司 Refining method of 1,5-diaminopentane
US11060080B2 (en) 2016-05-16 2021-07-13 Heilongjiang Eppen New Materials Co., Ltd. Method for fermentation-production of pentanediamine comprising carbon dioxide stripping technique
US11904306B2 (en) 2017-05-31 2024-02-20 Furukawa Electric Co., Ltd. Catalyst structure and method for producing the catalyst structure

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100421585B1 (en) 2001-10-25 2004-03-09 한국전자통신연구원 System for cell searching of mobile station in Time Division Duplex system and method thereof
JP5548864B2 (en) * 2008-07-03 2014-07-16 三菱化学株式会社 Method for producing purified pentamethylenediamine and method for producing polyamide resin
EP2415801B1 (en) * 2009-03-30 2018-06-06 Toray Industries, Inc. Polyamide resin, polyamide resin composition, and molded article comprising same
JP5630286B2 (en) * 2010-01-29 2014-11-26 東レ株式会社 Method for producing polyamide resin
JP5729085B2 (en) * 2010-03-31 2015-06-03 三菱化学株式会社 Method for producing pentamethylenediamine and method for producing polyamide resin
JP5930594B2 (en) * 2011-03-14 2016-06-08 三菱化学株式会社 Method for producing purified pentamethylenediamine and method for producing polyamide resin
JP2012201817A (en) * 2011-03-25 2012-10-22 Mitsubishi Chemicals Corp Method for producing purified pentamethylenediamine, and method for producing polyamide resin
KR101694854B1 (en) 2015-01-28 2017-01-10 서울대학교 산학협력단 Microporous polymers and fabrication methods of the same
JP2016033138A (en) * 2015-11-09 2016-03-10 三菱化学株式会社 Method for producing purified pentamethylenediamine and method for producing polyamide resin
CN111087309B (en) * 2019-12-19 2023-03-21 西安近代化学研究所 Method for preparing 2-methylbutylamine by one-step method

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS59161337A (en) * 1983-03-03 1984-09-12 Toyo Soda Mfg Co Ltd Decarboxylation of ethyleneamine carbonate
JPS59161338A (en) * 1983-03-04 1984-09-12 Toyo Soda Mfg Co Ltd Method of obtaining ethyleneamine from aqueous solution of ethyleneamine carbonate
JP4196620B2 (en) * 2002-04-08 2008-12-17 東レ株式会社 Method for producing cadaverine for polyamide raw material
WO2006123778A1 (en) * 2005-05-19 2006-11-23 Ajinomoto Co., Inc. Method for producing cadaverine carbonate, and method for producing polyamide using the same

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9475792B2 (en) 2009-01-20 2016-10-25 Merck Patent Gmbh Materials for organic electroluminescence devices
US10221407B2 (en) 2012-05-21 2019-03-05 Cathay Industrial Biotech Ltd. Stabilized recombinant expression plasmid vector in hafnia alvei and applications thereof
US9234203B2 (en) 2012-05-21 2016-01-12 Cathay Industrial Biotech Ltd. Stabilized recombinant expression plasmid vector in hafnia alvei and applications thereof
CN104968640A (en) * 2013-02-08 2015-10-07 味之素株式会社 Method for preserving 1,5-pentadiamine or salt thereof, method for preventing discoloration of same, and packaged 1,5-pentadiamine or salt thereof
US9533940B2 (en) 2013-02-08 2017-01-03 Ajinomoto Co., Inc. Method for preserving 1,5-pentanediamine or salt thereof, method for preventing discoloration of 1,5-pentanediamine or salt thereof, and 1,5-pentanediamine or salt thereof in container
CN104968640B (en) * 2013-02-08 2017-11-10 味之素株式会社 Preserve the method for 1,5 pentanediamines or its salt, prevent its method to change colour and 1,5 pentanediamines or its salt packed
JPWO2015076233A1 (en) * 2013-11-19 2017-03-16 東レ株式会社 Polyamide resin, polyamide resin pellets and method for producing polyamide resin
CN104762336B (en) * 2014-01-06 2019-10-29 上海凯赛生物技术股份有限公司 The preparation method of 1,5- pentanediamine
CN104762336A (en) * 2014-01-06 2015-07-08 上海凯赛生物技术研发中心有限公司 Method for preparing 1,5-pentanediamine
CN104974046A (en) * 2014-04-03 2015-10-14 上海凯赛生物技术研发中心有限公司 Purifying method of pentanediamine
CN104974046B (en) * 2014-04-03 2017-11-17 凯赛（金乡）生物材料有限公司 A kind of purification process of pentanediamine
CN107709568A (en) * 2014-12-23 2018-02-16 基因组股份公司 Method for producing and processing diamines
US10711289B2 (en) 2014-12-23 2020-07-14 Genomatica, Inc. Method of producing and processing diamines from an engineered microorganism
US11702682B2 (en) 2014-12-23 2023-07-18 Genomatica, Inc. Method of producing and processing diamines to a diamine free base using a carbonate intermediate and an engineered microorganism
US10619148B2 (en) 2015-02-03 2020-04-14 Cathay Biotech Inc. Immobilized cell and preparation method thereof
US10759737B2 (en) 2016-02-06 2020-09-01 Cathay Biotech Inc. Method for extracting 1,5-pentanediamine from solution system containing 1,5-pentanediamine salt
CN107338275A (en) * 2016-04-13 2017-11-10 宁夏伊品生物科技股份有限公司 The method for producing pentanediamine using accessory substance carbon dioxide automatic control pH whole-cell catalytic
US11060080B2 (en) 2016-05-16 2021-07-13 Heilongjiang Eppen New Materials Co., Ltd. Method for fermentation-production of pentanediamine comprising carbon dioxide stripping technique
US11904306B2 (en) 2017-05-31 2024-02-20 Furukawa Electric Co., Ltd. Catalyst structure and method for producing the catalyst structure
TWI710638B (en) * 2017-10-18 2020-11-21 南韓商Ｃｊ第一製糖股份有限公司 Refining method of 1,5-diaminopentane
US11098004B2 (en) 2017-10-18 2021-08-24 Cj Cheiljedang Corporation Method of purifying 1,5-diaminopentane
CN108997141A (en) * 2018-08-28 2018-12-14 河北美邦工程科技股份有限公司 A kind of preparation method of 1,5- pentanediamine
CN108997141B (en) * 2018-08-28 2021-10-19 河北美邦工程科技股份有限公司 Preparation method of 1, 5-pentanediamine

Also Published As

Publication number Publication date
CN102056889B (en) 2016-01-20
WO2010002000A1 (en) 2010-01-07

Similar Documents

Publication Publication Date Title
CN102056889B (en) The manufacture method of five methylene diamine and the manufacture method of polyamide resin
JP5812150B2 (en) Method for producing purified pentamethylenediamine and method for producing polyamide resin
JP5644037B2 (en) Polyamide resin composition
CN102131845B (en) Polyamide resin, composition containing polyamide resin, and molded articles of polyamide resin and composition
JP5656343B2 (en) Process for producing purified pentamethylenediamine
CN101443382B (en) Polyamide resin
JP2003292612A (en) Polypentamethylene adipamide resin and its producing method
CN101284906A (en) Production method of polyamide
JP4168702B2 (en) Process for producing polypentamethylene adipamide resin
US10676569B2 (en) Method for continuously producing polyamide oligomers and producing semicrystalline or amorphous polyamides that can be thermoplastically processed
KR20110055623A (en) Batch process for preparing polyamides
JP2015096552A (en) Method for manufacturing pentamethylenediamine and method for manufacturing polyamide resin
CN101578256B (en) Cadaverine salt, aqueous cadaverine salt solution, polyamide resin, molded article and process for producing cadaverine salt and aqueous cadaverine salt solution
US20160289165A1 (en) 1,5-pentamethylene diamine and production method therefor
JP5930594B2 (en) Method for producing purified pentamethylenediamine and method for producing polyamide resin
JP2009131239A (en) Method for producing pentamethylenediamine
CN102782010B (en) Process for production of polypentamethyleneadipamide resin
JP2012201817A (en) Method for producing purified pentamethylenediamine, and method for producing polyamide resin
JP5365004B2 (en) Method for producing aqueous cadaverine salt solution
JP2009096796A (en) Method for producing pentamethylene diamine
JP2016033138A (en) Method for producing purified pentamethylenediamine and method for producing polyamide resin
JP2009195202A (en) Method for manufacturing purified pentamethylene diamine
JP2003082096A (en) Polyamide prepolymer and polyamide, and method for producing the same
JP5309649B2 (en) Method for producing pentamethylenediamine dicarboxylate
JP2015096551A (en) Method of manufacturing purified pentamethylenediamine and method of manufacturing of polyamide resin

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CP01 Change in the name or title of a patent holder

Address after: Tokyo, Japan

Patentee after: MITSUBISHI CHEMICAL Corp.

Address before: Tokyo, Japan

Patentee before: MITSUBISHI RAYON Co.,Ltd.

CP01 Change in the name or title of a patent holder
TR01 Transfer of patent right

Effective date of registration: 20170919

Address after: Tokyo, Japan

Patentee after: MITSUBISHI RAYON Co.,Ltd.

Address before: Tokyo, Japan

Patentee before: MITSUBISHI CHEMICAL Corp.

TR01 Transfer of patent right