CN101962656B - Application of TT1 gene in improving saline alkali tolerance of plants - Google Patents
Application of TT1 gene in improving saline alkali tolerance of plants Download PDFInfo
- Publication number
- CN101962656B CN101962656B CN2009103047263A CN200910304726A CN101962656B CN 101962656 B CN101962656 B CN 101962656B CN 2009103047263 A CN2009103047263 A CN 2009103047263A CN 200910304726 A CN200910304726 A CN 200910304726A CN 101962656 B CN101962656 B CN 101962656B
- Authority
- CN
- China
- Prior art keywords
- ala
- leu
- gene
- glu
- asp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the technical field of organisms, in particular to application of a TT1 gene in improving the saline alkali tolerance of plants, aiming to solve the technical problem on how to provide a new effective selection for the technical field of transgenosis for improving the saline alkali tolerance of the plants. In order to solve the technical problem, the invention adopts the technical scheme that the application of the TT1 gene in improving the saline alkali tolerance of the plants is provided; and proved by experiments, the seed germination rate of the plants with the TT1 genes in saline alkali environment is obviously improved, and the content of proline in grown plants is also improved, which proves that the TT1 genes can effectively improve the saline alkali tolerance of the plants. A method for cultivating the plants with the saline alkali tolerance is also simple, convenient and effective and provides a new effective selection for improving the saline alkali tolerance of the plants.
Description
Technical field
The invention belongs to biological technical field, be specifically related to the purposes of TT1 gene in improving plant salt tolerance alkalescence.
Background technology
Constantly perfect with gene clone technology of developing rapidly along with molecular biotechnology, plant genetic engineering research just develops in depth, and resistant gene research is shifted to the contrary property (as cold-resistant, drought resisting, anti-salt etc.) of resisting abiotic by the contrary property (as disease-resistant, pest-resistant) of antibiont.
There is in the world at present more than 100 country to have dissimilar saltings 1,000,000,000 hm
2, account for 10% of global arable area.China's saltings area reaches 9,913 ten thousand hm
2, mainly be distributed in arid, the semiarid zones such as North China, northwest and northeast.China's West of The Northeast China song-Nen plain has saltings area more than 370 ten thousand hm
2, be one of three sodium thiosulfate saltings areal concentrations in the world.Simultaneously, due to the reason such as industrial pollution, unreasonable irrigation and fertilizer application be improper, the Secondary Saline soil erosion is also increasing sharply.Saltings affects vegetation growth, makes crop production reduction or total crop failure, and indirectly causes the deterioration of the ecological environment, and energy corrosion damage job facilities, and the loss caused reaches 25.11 hundred million yuan every year.
Therefore, how to alleviate the harm of salting of soil to crop, taking full advantage of limited land resources becomes one of agricultural sustainable development important topic urgently to be resolved hurrily.Carry out the comprehensive regulation except measures such as utilizing traditional physics, chemistry, biology, apply up-to-date molecular biology method, improving crop patience by genetically engineered will be one of most economical effective means.
Saline-alkali soil is containing too much NaCl, Na
2SO
4, Na
2CO
3And NaHCO
3Soil Deng salt.Saline-alkali soil mainly comprises to the murder by poisoning of plant the compound murder by poisoning that salt stress and high pH coerce and these two factors act on each other produces.The main injury that Saline Alkali Stress causes plant shows following three aspects: the one, and a large amount of accumulation of metal ion in tenuigenin (being mainly Na), it can destroy the interior ionic equilibrium of cell and suppress Physiological and Biochemical Metabolism process in cell, the photosynthesis of plant ability is descended, finally hungry dead because of carbon; The 2nd, salt affected soil is a high environment that oozes, and it can stop root system of plant to absorb moisture, thereby makes plant dead because of " arid "; The 3rd, salt affected soil pH value is higher, and this makes plant materials and external environment acid base imbalance, and then destroys the structure of cytolemma, causes the cell Dissolve things inside exosmose and make plant death.Thereby, be subject to the plant of Saline Alkali Stress on the one hand will reduce the tenuigenin intermediate ion and accumulate, also by cumulative process, produce some special product on the other hand, as protein, amino acid, carbohydrate etc. strengthen the osmotic pressure of cell, stop the cell dehydration, stablize the structure of plasma membrane and enzyme.
Because saltings extensively exists, the research in this field is becoming a new focus.Now domestic research mainly concentrates on the saltings plant and how to respond pH and coerce, to physiology phenotype and genetic expression, it is only all desk study, main research object is some saline alkali tolerant plants, as flower of Stinkgrass, sheep's hay, Sunflower Receptacle, white thorn etc., but every kind of plant has its special metabolic process, does not have general directive significance.In addition, because the genomic informations of these plants it be unclear that, also can hinder the process that the high pH of research plant responding coerces on molecular level.
Using genetic engineering technique to improve plant is focus in recent years.Use genetic engineering technique to improving the salt tolerant alkalescence of plant, cultivating the Salt And Alkali Tolerance strain is also a feasible road.But, the rarely seen report that is improved the gene of plant salt tolerance alkalescence also at present.Put down in writing in the Chinese patent application 200810045667.8 of submitting before the applicant and separated the new gene from rape, called after TT1.
The alternative gene that can improve plant salt tolerance alkalescence need to be developed in this area, and uses genetic engineering technique to improve the method for the salt tolerant alkalescence of plant.
Summary of the invention
The technical problem to be solved in the present invention is that the field of transgenic technology for improving plant salt tolerance alkalescence provides a kind of new effective selection.
The technical scheme that the present invention solves this technical problem has been to provide the purposes of TT1 gene in improving plant salt tolerance alkalescence.
Wherein, above-mentioned TT1 gene has following nucleotide sequence:
(1): as nucleotide sequence as shown in SEQ ID NO:1; Or (2): the nucleotide sequence in (1) is through replacing, lack or add the derived sequence of one or several Nucleotide gained, and this derived sequence polypeptide identical with the sequence encoding function of SEQ ID NO:1.
The aminoacid sequence of the polypeptide that the nucleotide sequence of SEQ ID NO:1 is coded is as shown in SEQ ID NO:2.
The present invention also provides the purposes of polypeptide in improving plant salt tolerance alkalescence of TT1 genes encoding.Above-mentioned TT1 gene has following nucleotide sequence:
(1): the nucleotide sequence as shown in SEQ ID NO:1; Or (2): in the nucleotide sequence limited in (1), process replaces, lacks or adds the nucleotide sequence of the derivative gained of one or several Nucleotide, and the polypeptide identical with the sequence encoding function of SEQ ID NO:1.Also can improve plant salt tolerance alkalescence.
In addition, the present invention also provides a kind of method of cultivating saline alkali tolerant plant.The method comprises the following steps:
(1), after above-mentioned TT1 gene operationally is connected in to the expression regulation sequence on carrier, form the recombinant vectors containing nucleotide sequence shown in SEQ ID NO:1;
(2) recombinant vectors in step (1) is proceeded to vegetable cell;
(3) obtain transformant through screening, then transformant is cultivated into to transgenic salt-tolerant wheat alkali plant and offspring thereof, described offspring comprises plant seed and plant tissue.
TT1 gene described in the present invention, its basic nucleotide sequence is as shown in SEQ ID NO:1 in sequence table, this gene source is in Cruciferae (Brassicaceae, also name Cruciferae) in, mustard belongs to the plant rape (Brassicanapus) of (Brassica), the atp6 gene of take in rape is bait protein, according to the yeast two-hybrid method, screen an est sequence in rape, the sequence screened according to this section again, by the nucleotide sequence shown in SEQ ID NO:1 in the method acquisition sequence table of 5 ' RACE.Then according to the design of the nucleotide sequence shown in SEQ ID NO:1 one couple of PCR primers, the nucleotide sequence shown in SEQ ID NO:1 can increase from rape cDNA.
Recombinant vectors of the present invention, be that the TT1 gene operationally is inserted in carrier and obtains, and above-mentioned carrier can be selected various carrier, especially carrier for expression of eukaryon known in the art (as pBI121 or pCAMBIA2301).The present invention transforms host plant cell with above-mentioned recombinant vectors, and screening obtains transformant.Then transformant is cultivated into to transgenic salt-tolerant wheat alkali plant and offspring thereof, described offspring comprises plant seed and plant tissue.
In the present invention, the TT1 gene order of " the nucleotide sequence process in SEQ ID NO:1 replaces, lacks or add one or several Nucleotide derived sequence " generally refers to that coding has nucleotide sequence and the degenerate sequence thereof of the polypeptide of the coded protein-active of SEQ ID NO:1.This degenerate sequence refers in described sequence the sequence that has one or more codons to be encoded to produce after the degenerate codon of same amino acid replaces.Due to the degeneracy of codon, so be low to moderate approximately 89% the degenerate sequence described aminoacid sequence of SEQ ID NO:2 of also encoding out with SEQ ID NO:1 homology.In addition, the implication of " nucleotide sequence in SEQ ID NO:1 is through replacing, lack or adding at least one Nucleotide derived sequence " also comprises can be under the rigorous condition of moderate, better under highly rigorous condition with the nucleotide sequence of SEQ ID NO:1 nucleotide sequence hybridization.This term also comprise with SEQ ID NO:1 in the homology at least 80% of nucleotide sequence, preferably at least 89%, more preferably at least 90%, at least 95% nucleotide sequence best.And the polypeptide that this nucleotide sequence is identical with sequence encoding function with SEQ ID NO:1, identical function in the present invention refers to the salt tolerant alkalescence that improves plant.
This term also comprises encoding to have the variant form of open reading frame sequence in the SEQ ID NO:1 with the albumen of natural SEQ ID NO:2 identical function.These variant forms comprise (but being not limited to): several (are generally 1～90, preferably 1～60, more preferably 1～20,1～10 best) disappearance, insertion and/or the replacement of Nucleotide, and add several (being generally in 60 at 5 ' and/or 3 ' end, being preferably in 30, is more preferably in 10, is in 5 best) Nucleotide.Such as the nucleotide sequence shown in SEQ ID NO:3, the polypeptide of its coding also can improve the salt tolerant alkalescence of plant.
Recombinant vectors of the present invention, be that the TT1 gene is inserted in carrier and obtains, and above-mentioned carrier can be selected various carrier, especially carrier for expression of eukaryon known in the art (as pBI121 or pCAMBIA2301).The present invention transforms host plant cell with above-mentioned recombinant vectors, and screening obtains transformant.Then transformant is cultivated into to transgenic salt-tolerant wheat alkalescence plant and offspring thereof, described offspring comprises plant seed and plant tissue.
" operationally being connected in " described in the present invention is expressed as follows situation: some part of linear DNA sequence can affect the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjacent, for the secretion leader sequence, means in reading frame adjacent.
Beneficial effect of the present invention is: the invention provides the purposes of TT1 gene aspect raising plant salt tolerance alkalescence, also confirmed by experiment that in an embodiment of the present invention plant its seed germination rate under the saline alkali environment that has proceeded to the TT1 gene is significantly improved, proline content in plant after growth also is improved, and has proved that TT1 gene TT1 gene can effectively improve plant salt tolerance alkalescence.The method that the present invention cultivates saline alkali tolerant plant is also easy and effective, for improving plant salt tolerance alkalescence, provides new effective selection, the application prospect had.
The accompanying drawing explanation
Whether Fig. 1, agarose electrophoresis testing goal gene have proceeded to Arabidopis thaliana, and 1～12 road is the transgenic arabidopsis genomic dna, and 13 roads are the overexpression recombinant plasmid dna containing SEQ ID NO:1.
Fig. 2, different concns (mmol/L) NaCl are on the non-impact that turns TT1 gene Seed Germination of Arabidopsis Pumila rate.
Fig. 3, different concns (mmol/L) the NaCl impact on TT1 gene overexpression transgenic arabidopsis seed germination rate.
The proline content of Fig. 4, different treatment group (μ g/g).Wherein RLD is wild-type, and OEa, OEb, OEc, OEd were expression TT1 gene Arabidopis thaliana strain, and ordinate zou is proline content (μ g/g).
Fig. 5, the color of the red toluene solution of different treatment group proline(Pro) in cuvette.Wherein RLD is wild-type, and OEa, OEb, OEc, OEd were expression TT1 gene Arabidopis thaliana strain.
Embodiment
Below in conjunction with embodiment, the invention will be further described.In following embodiment, all unreceipted concrete experiment conditions, be according to normal condition well known to those skilled in the art, Sambrook for example, the molecular cloning of Russell: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.In following embodiment, used carrier pET28, pGEX-2T, pGEM-T is purchased from Qiagen company, and bacterial strain BL21 is purchased from Qiagen company, and bacterial strain EHA105, carrier pBI121 are purchased from Clontech company.All the other chemical reagent are commercially available analytical pure.
In following embodiment, " SEQ ID NO:1 ", while occurring separately, those skilled in the art can understand 1 its abbreviation that is " nucleotide sequence shown in SEQ IDNO:1 ",
Embodiment mono-: the clone of TT1 gene and obtaining
Atp6 (genebank gi:89279377) gene of take in rape is bait protein, according to yeast two-hybrid method (seeing the disclosed data of Clontech company), screen an est sequence in rape (shown in SEQ ID NO:3, the aminoacid sequence of coding is as shown in SEQ ID NO:4), the sequence screened according to this section again, method by 5 ' RACE (seeing disclosed 5 ' the RACE method data of Takara company) obtains raising plant of the present invention and microorganism thermotolerance gene, and its nucleotide sequence is as shown in SEQ ID NO:1 in sequence table.According to the design of nucleotide sequence shown in SEQ ID NO:1 primer,
Upstream primer (SEQ ID NO:7): 5 '-ATGTCGGATCATTTGAGTTTATG-3 ',
Downstream primer (SEQ ID NO:8): 5 '-TCAGACTGGTGTTGGGTTGGATAT-3 '.
Then the nucleotide sequence shown in SEQ ID NO:1 increases from rape cDNA through PCR.
The PCR program is as follows:
1.95 ℃ 4min (denaturation)
2.95 ℃ 30s (sex change)
3.53 ℃ 30s (renaturation)
4.72 ℃ 50s (extension)
5.2-4 step cycle 30 times
6.72 ℃ 5min (extending eventually)
7.4 ℃ preservation.
To PCR product purification (seeing Qiagen company disclosed PCR product purification data), through sequence verification, obtain the gene fragment of sequence SEQ ID NO:1.
Replacement and the disappearance of nucleotide sequence SEQ ID NO:1: according to nucleotide sequence shown in SEQ ID NO:1, design upstream primer (SEQ ID NO:9) 5-ATGGCTGATGATTTCAGTTTATGTAC-3 ' and downstream primer (SEQ ID NO:10) 5-' TTGGGTTGGATATTGGCGGCGGCTG-3 ', do template with the carrier pET28 that is connected with SEQ ID NO:1, pcr amplification goes out SEQ ID NO:5 sequence, and (peptide sequence of coding is shown in SEQ ID NO:6, that the leucine that second Serine at SEQ ID NO:2 sequence N end replaces to L-Ala and the 5th replaces to phenylalanine, and three amino acid of C end disappearance), then connect the pGEM-T carrier.
Design amplifies the primer of complete S EQ ID NO:5 sequence
Upstream primer (SEQ ID NO:11):
5’-CCGGAA TTC ATGGCTGATGATTTCAG TTTATGTAC-3’，
Downstream primer (SEQ ID NO:12):
5’-CCGGAGCTC TTG GGT TGG ATATTG GCG GCG GCT G-3’
The nucleotide sequence of SEQ ID NO:3 increases from the pGEM-T carrier that is connected with SEQ ID NO:5 through PCR.
The PCR program is as follows:
1.95 ℃ 4min (denaturation)
2.95 ℃ 30s (sex change)
3.53 ℃ 30s (renaturation)
4.72 ℃ 50s (extension)
5.2～4 step cycle 30 times
6.72 ℃ 5min (extending eventually)
7.4 ℃ preservation.
To the PCR product purification, then with BamH1 and Sac1 enzyme, to cut, glue reclaims, and is connected (connection site: BamH1 and Sac1) with pET28, obtains the recombinant plasmid containing SEQ ID NO:4.To, containing the recombinant plasmid transformed E.coli of SEQ ID NO:4, coat on the LB solid medium containing Amp.Through sequence verification, obtain the E.colipET28 bacterial strain containing the recombinant plasmid of SEQ ID NO:3.
Embodiment bis-, turn the acquisition of TT1 gene Arabidopis thaliana plant preparation and seed
1, the acquisition of transgenic arabidopsis plant and seed
According to the design of nucleotide sequence shown in SEQ ID NO:1 primer,
Upstream primer (SEQ ID NO:13): 5 '-CGC GGATCCATGTCGGATCATTTGAGTTTATG-3 ',
Downstream primer (SEQ ID NO:14): 5 '-CCGGAGC TCTCAGACTGGTGTTGGGTTGGATAT-3 '.
Through PCR, the nucleotide sequence shown in complete SEQ ID NO:1 that increases from rape cDNA,
The PCR program is as follows:
1.95 ℃ 4min (denaturation)
2.95 ℃ 30s (sex change)
3.53 ℃ 30s (renaturation)
4.72 ℃ 50s (extension)
5.2～4 step cycle 30 times
6.72 ℃ 5min (extending eventually)
7.4 ℃ preservation.
To PCR product purification (seeing the PCR of Qiagen company product purification test kit specification sheets), then with BamH1 and Sac1 enzyme, cut, glue reclaims, and with carrier pBI121, is connected (connection site: BamH1 and Sac1), obtains the overexpression recombinant plasmid containing SEQ ID NO:1.To proceed in Agrobacterium containing the overexpression recombinant plasmid of SEQ ID NO:1, utilize inflorescence dip method arabidopsis thaliana transformation.Detailed step is as follows:
A, picking are inoculated in the Str containing 20mg/L containing the Agrobacterium of the overexpression recombinant plasmid of SEQ ID NO:1,50mg/LKan, in the LB liquid nutrient medium of 40mg/L Rif, 28 ℃ are shaken the bacterium rear collection thalline that spends the night, be resuspended in containing in the MS liquid nutrient medium of 0.01% Surfactant silwet-77 to OD
600=0.4-0.6,28 ℃ are shaken bacterium 1-2h, and bacterium liquid is stand-by.
The inflorescence that B, the Arabidopis thaliana that will cultivate 60 days have grown is cut, by the Agrobacterium bacterium immersion flower bulb order of the overexpression recombinant plasmid that contains SEQ ID NO:1 2 minutes, secretly cultivate afterwards 48 hours, Arabidopis thaliana seedling after dark the cultivation can move into the normal illumination ambient growth, and the pod grown subsequently is and turns TT1 gene T0 for seed.
2, transgenosis is identified
By the plantation of the seed of results, after growing to 50 days, get a little blade and carry out the PCR detection
Upstream primer (SEQ ID NO:15): 5 ' ATTTCATTTGGAGAGAACACGG 3 '
Downstream primer (SEQ ID NO:16): 5 ' TCAGACTGGTGTTGGGTTGGATAT 3 '
According to the design of nucleotide sequence shown in SEQ ID NO:1 primer,
The PCR program is as follows:
1.95 ℃ 4min (denaturation)
2.95 ℃ 30s (sex change)
3.53 ℃ 30s (renaturation)
4.72 ℃ 50s (extension)
5.2～4 step cycle 37 times
6.72 ℃ 5min (extending eventually)
7.4 ℃ preservation.
Whether then agarose electrophoresis detects has target stripe to occur, represents that if having goal gene has proceeded to Arabidopis thaliana.Detected result is shown in Fig. 1:
1～12 road is the transgenic arabidopsis genomic dna, 13 roads are the overexpression recombinant plasmid dna containing SEQ ID NO:1, the purpose band of DNA to be detected is consistent with the band of overexpression plasmid DNA, is illustrated as SEQ ID NO:1 Nucleotide overexpression transgenic positive plant and makes its seed.
3,, after transgenic positive plant maturation, collect seed standby.In like manner, making SEQ ID NO:3 sequence, to cross Arabidopis thaliana plant preparation and the seed of expression standby.
Embodiment tri-, the different concns NaCl impact on the Seed Germination of Arabidopsis Pumila rate
The salt of saline-alkali soil is generally NaCl, Na2SO, Na2CO and NaHCO3 etc., the ion that salt stress also has the rising of Na ion to cause except also causing flow of water reduction is coerced, affected the absorption of plant to nutrition such as K ion and Ca ions, thereby plant has been damaged.Therefore, this experiment adopts NaCl analog salt stress conditions.
(formula is in Table 1 for the MS substratum prepared, pH is adjusted to 5.8 with KOH) before sterilizing, respectively NaCl is added, make the NaCl final concentration be respectively 0mmol/L (control group), 50mmol/L, 100mmol/L, 150mmol/L, 200mmol/L, 250mmol/L, 300mmol/L, after high pressure steam sterilization, divide and install in culture dish.Proceed on substratum with 2mL sterilized water suspension seed after culture medium solidifying, treat that seed evenly after planting removes unnecessary sterilized water, open the ware lid, place 1h to surface drying in gnotobasis, the sealing, then be put into culturing room (22 ℃, intensity of illumination 6000～8000lx, the 16h/8h light dark period, relative humidity 70%) cultivate, each processes 3 repetitions, observes every day and sprouts and other phenotypes, statistics is sprouted number, gets its mean value.
Table 1MS culture medium prescription
Experimental result shows:
By result, found out, non-transgenic Arabidopis thaliana seed is more responsive to the change in concentration of NaCl, even at 250mM, 300mM, all substantially do not germinate (the results are shown in Figure 2); And turn TT1 gene Arabidopis thaliana seed, the tolerance of NaCl better (be the results are shown in Figure to 3, under 50mM, 100mM, 150mM concentration, the final germination rate of seed is all higher, even under 200mM, 250mM, 300mM concentration, still keep certain germination rate, and its germination rate is apparently higher than the non-transgenic type.
2, the mensuration (ninhydrin solution development process) of proline(Pro) (Pro) content
2.1 the drafting of typical curve
(1) accurately take the 25mg proline(Pro) on analytical balance, pour in small beaker, dissolve with a small amount of distilled water, then pour in the 250ml volumetric flask, adding distil water is settled to scale, and in this reference liquid, every ml is containing proline(Pro) 100 μ g.
(2) get 6 test tubes, draw respectively proline(Pro) solution and 2ml Glacial acetic acid and the 2ml acid ninhydrine solution of 2ml series standard concentration, every pipe heats 30min in boiling water bath.
(3) cooling rear each test tube accurately adds 4ml toluene, and vibration 30S, in standing a moment, make pigment all go to toluene solution.
(4) respectively manage upper strata proline(Pro) toluene solution to cuvette by the syringe gentle aspiration, take toluene solution as blank, carry out colorimetric (Beijing TU-1800 of Pu Xitong instrument company type ultraviolet spectrophotometer) in 520nm wavelength place.
(5) drafting of typical curve: first obtain the regression equation that absorbance (Y) becomes according to concentration of proline (X), then, by regression equation drawing standard curve, calculate the content (μ g/2ml) that 2ml measures proline(Pro) in liquid.
2.2 the mensuration of sample
(1) extraction of proline(Pro): accurately take and cultivate Arabidopis thaliana (four strains of transgenosis and the wild-type) seedling 0.2～0.5g after 20 days under same growth conditions, put respectively in bassoon, then add respectively the sulphosalicylic acid solution of 5ml 3% to each pipe, extract 10min in boiling water bath, (in leaching process, will often shake), cooled and filtered is in clean test tube, and filtrate is the extracting solution of proline(Pro).
(2) draw in the band glass plug test tube that the 2ml extracting solution is clean in another, add 2ml Glacial acetic acid and 2ml acid ninhydrine reagent, heat 30min in boiling water bath, solution take on a red color.
(3) add 4ml toluene after cooling, sway 30S, in standing a moment, get upper strata liquid to the 10ml centrifuge tube, centrifugal 5min under 3000rpm.
(4) use proline(Pro) red toluene solution in suction pipe gentle aspiration upper strata in cuvette, take toluene as blank, on spectrophotometer, 520nm wavelength place colorimetric, try to achieve absorbance.
2.3 result is calculated
Find the content (X μ g/2ml) that 2ml measures proline(Pro) in liquid, the then percentage ratio of proline content in calculation sample from typical curve.Calculation formula: proline content (μ g/g)=[X * 5/2]/sample heavy (g).Try to achieve mean value, mean value the results are shown in Figure 4.
Experimental result is as follows:
As Fig. 5 can intuitively find out, after the triketohydrindene hydrate colour developing, RLD is more of light color than OEa, OEb, OEc, OEd, and wherein the color of OEa and OEd is obviously dark than other colors, and the proline(Pro) expression amount of overexpression strain is than the height of wild RLD type.
Through measuring and calculating, find to turn the Arabidopis thaliana of TT1 gene, the content of its proline(Pro) is greater than wild RLD type really, wherein the content of OEa and OEd high (the results are shown in Figure 4).
Because proline(Pro) plays an important role in process is coerced in the vegetable cell adaptation, acidity and adjusting redox-potential etc. in the protective material that its effect main manifestations is intracellular Osmolyte regulator, reductive agent or energy derive, N element reserve substance, scavenger, desmo enzyme and reduction cell.Therefore under normal culture condition, the wild RLD type of energy force rate of the saline and alkaline osmotic stress caused of reply that turns TT1 gene Arabidopis thaliana is strong.
Embodiment tetra-TT1 genes improve the preliminary study of plant salt tolerance alkalescence mechanism
E.coli CHIP Version 2.0 gene chips that the present invention uses precious biotechnology (Dalian) company limited to sell, operated (the genescreen standard is in Table 2) by its monologue story-telling with gestures, express the intestinal bacteria of TT1 gene with the colibacillary genomic expression of blank compares to crossing, with the mechanism of Primary Study TT1 gene raising salt tolerant alkalescence.
Reference group: proceed to the intestinal bacteria (Cy3) of sky pET28a, experimental group: TT1-pET28a (Cy5).
Table 2 genescreen standard
| Cy5/Cy3_ratio(G) | Cy5/Cy3_ratio(G) | Cy3_S-B(G) | Cy5_S-B(G) | Cy3_posi | Cy5_posi |
| ＞＝2 | ＞＝200 | 1 | |||
| ＞＝2 | ＞＝200 | 1 | |||
| ＞＝2 | ＞＝200 | 1 | |||
| ＞＝2 | ＞＝200 | 1 | |||
| ＜＝0.5 | ＞＝200 | 1 | |||
| ＜＝0.5 | ＞＝200 | 1 | |||
| ＜＝0.5 | ＞＝200 | 1 | |||
| ＜＝0.5 | ＞＝200 | 1 |
The genechip detection data results: the full genome of E coli. approximately has 4400 different encoding genes, and in order to study in intestinal bacteria the gene with the TT1 gene interaction, the present invention carries out gene microarray analysis.Analyze to find, yabF wherein, rhsE, yhcP, yzpK, the yhiR gene is expressed and is subject to up-regulated expression because TT1 crosses.By further investigation, yabF in these genes of discovery up-regulated expression, rhsE, yhcP is the gene relevant to ionic channel, be that TT1 is likely by the effect with some ionic channel associated protein of regulation and control, and make the inside and outside iontophoretic injection balance of cell, reduce the too much and infringement that causes of ion.The above results the improves salt tolerant alkalescence mechanism of action for disclosing the TT1 gene provides strong foundation.
SEQUENCE LISTING
<110 > Sichuan Biodesign Biology gene engineering Co., Ltd.
<120 > purposes of TT1 gene in improving plant salt tolerance alkalescence
<130>A090227k
<160>16
<170>PatentIn version 3.4
<210>1
<211>861
<212>DNA
<213>Brassica napus
<220>
<221>CDS
<222>(1)..(861)
<223 > TT1 gene cDNA sequence
<400>1
atg tcg gat gat ttg agt tta tgt acc gat cgt ctg ata acg gcc gag 48
Met Ser Asp Asp Leu Ser Leu Cys Thr Asp Arg Leu Ile Thr Ala Glu
1 5 10 15
agc ttg gaa tca gaa aag gat tct gga gaa agt tcc agg ctt caa ggc 96
Ser Leu Glu Ser Glu Lys Asp Ser Gly Glu Ser Ser Arg Leu Gln Gly
20 25 30
aaa gat gtg gct tct tct tca tct gcg gat gaa gct gaa gat gct agg 144
Lys Asp Val Ala Ser Ser Ser Ser Ala Asp Glu Ala Glu Asp Ala Arg
35 40 45
aag tac tat gct gtt gtt gca gaa gag gag ccg ctt ctg caa tct gtt 192
Lys Tyr Tyr Ala Val Val Ala Glu Glu Glu Pro Leu Leu Gln Ser Val
50 55 60
gag tgc cgt att tgc cag gag gaa gat atc act aag aac ttg gag act 240
Glu Cys Arg Ile Cys Gln Glu Glu Asp Ile Thr Lys Asn Leu Glu Thr
65 70 75 80
cct tgt gct tgc aat ggc agt ttg aag tat gct cac cgc aag tgt gtt 288
Pro Cys Ala Cys Asn Gly Ser Leu Lys Tyr Ala His Arg Lys Cys Val
85 90 95
cag cgt tgg tgt aat gag aaa ggc gac ata atc tgc gaa ata tgc cac 336
Gln Arg Trp Cys Asn Glu Lys Gly Asp Ile Ile Cys Glu Ile Cys His
100 105 110
cag cct tat caa tct gga tat aca gca cct cca cct cct cct cct gat 384
Gln Pro Tyr Gln Ser Gly Tyr Thr Ala Pro Pro Pro Pro Pro Pro Asp
115 120 125
gaa act ata att cac att ggt gac gac tgg gag gat gga gtt cac ttg 432
Glu Thr Ile Ile His Ile Gly Asp Asp Trp Glu Asp Gly Val His Leu
130 135 140
gac tcg agc gac ccg cgc att cta gca atg gct gcg gcg gaa cga cat 480
Asp Ser Ser Asp Pro Arg Ile Leu Ala Met Ala Ala Ala Glu Arg His
145 150 155 160
ttc ttg gaa gct gac tat gac gag tac tct gag tct aac tct agc ggt 528
Phe Leu Glu Ala Asp Tyr Asp Glu Tyr Ser Glu Ser Asn Ser Ser Gly
165 170 175
gct gcc ttc tgt cgc tct gct gct ctc atc ctg atg gca ctt tta ctg 576
Ala Ala Phe Cys Arg Ser Ala Ala Leu Ile Leu Met Ala Leu Leu Leu
180 185 190
tta cgt gat gca cta aac ctc aca act aac cca gat gac gag gac gat 624
Leu Arg Asp Ala Leu Asn Leu Thr Thr Asn Pro Asp Asp Glu Asp Asp
195 200 205
ccc act gcc ttc ttc tct ctt ttc ctt ctt cgt gct gct ggt ttt ctc 672
Pro Thr Ala Phe Phe Ser Leu Phe Leu Leu Arg Ala Ala Gly Phe Leu
210 215 220
ctc cca tgt tat atc atg gca tgg gcc atc ggt att ctc cag cgc cgg 720
Leu Pro Cys Tyr Ile Met Ala Trp Ala Ile Gly Ile Leu Gln Arg Arg
225 230 235 240
agg caa aga cag gaa gca gct gcg cta gct gcg gcg gaa gtt gcc ttc 768
Arg Gln Arg Gln Glu Ala Ala Ala Leu Ala Ala Ala Glu Val Ala Phe
245 250 255
atg ata cac ggt ggt gtg cca caa cgc agg gga cta cac ttt gct gta 816
Met Ile His Gly Gly Val Pro Gln Arg Arg Gly Leu His Phe Ala Val
260 265 270
gca cca gag cag ccg ccg cca ata tcc aac cca aca cca gtc tga 861
Ala Pro Glu Gln Pro Pro Pro Ile Ser Asn Pro Thr Pro Val
275 280 285
<210>2
<211>286
<212>PRT
<213>Brassica napus
<400>2
Met Ser Asp Asp Leu Ser Leu Cys Thr Asp Arg Leu Ile Thr Ala Glu
1 5 10 15
Ser Leu Glu Ser Glu Lys Asp Ser Gly Glu Ser Ser Arg Leu Gln Gly
20 25 30
Lys Asp Val Ala Ser Ser Ser Ser Ala Asp Glu Ala Glu Asp Ala Arg
35 40 45
Lys Tyr Tyr Ala Val Val Ala Glu Glu Glu Pro Leu Leu Gln Ser Val
50 55 60
Glu Cys Arg Ile Cys Gln Glu Glu Asp Ile Thr Lys Asn Leu Glu Thr
65 70 75 80
Pro Cys Ala Cys Asn Gly Ser Leu Lys Tyr Ala His Arg Lys Cys Val
85 90 95
Gln Arg Trp Cys Asn Glu Lys Gly Asp Ile Ile Cys Glu Ile Cys His
100 105 110
Gln Pro Tyr Gln Ser Gly Tyr Thr Ala Pro Pro Pro Pro Pro Pro Asp
115 120 125
Glu Thr Ile Ile His Ile Gly Asp Asp Trp Glu Asp Gly Val His Leu
130 135 140
Asp Ser Ser Asp Pro Arg Ile Leu Ala Met Ala Ala Ala Glu Arg His
145 150 155 160
Phe Leu Glu Ala Asp Tyr Asp Glu Tyr Ser Glu Ser Asn Ser Ser Gly
165 170 175
Ala Ala Phe Cys Arg Ser Ala Ala Leu Ile Leu Met Ala Leu Leu Leu
180 185 190
Leu Arg Asp Ala Leu Asn Leu Thr Thr Asn Pro Asp Asp Glu Asp Asp
195 200 205
Pro Thr Ala Phe Phe Ser Leu Phe Leu Leu Arg Ala Ala Gly Phe Leu
210 215 220
Leu Pro Cys Tyr Ile Met Ala Trp Ala Ile Gly Ile Leu Gln Arg Arg
225 230 235 240
Arg Gln Arg Gln Glu Ala Ala Ala Leu Ala Ala Ala Glu Val Ala Phe
245 250 255
Met Ile His Gly Gly Val Pro Gln Arg Arg Gly Leu His Phe Ala Val
260 265 270
Ala Pro Glu Gln Pro Pro ProI le Ser Asn Pro Thr Pro Val
275 280 285
<210>3
<211>696
<212>DNA
<213>Brassica napus
<220>
<221>CDS
<222>(1)..(696)
The nucleotide sequence of the coding<223 > screened and atp6 interaction protein
<400>3
gaa gag gag ccg ctt ctg caa tct gtt gag tgc cgt att tgc cag gag 48
Glu Glu Glu Pro Leu Leu Gln Ser Val Glu Cys Arg Ile Cys Gln Glu
1 5 10 15
gaa gat atc act aag aac ttg gag act cct tgt gct tgc aat ggc agt 96
Glu Asp Ile Thr Lys Asn Leu Glu Thr Pro Cys Ala Cys Asn Gly Ser
20 25 30
ttg aag tat gct cac cgc aag tgt gtt cag cgt tgg tgt aat gag aaa 144
Leu Lys Tyr Ala His Arg Lys Cys Val Gln Arg Trp Cys Asn Glu Lys
35 40 45
ggc gac ata atc tgc gaa ata tgc cac cag cct tat caa tct gga tat 192
Gly Asp Ile Ile Cys Glu Ile Cys His Gln Pro Tyr Gln Ser Gly Tyr
50 55 60
aca gca cct cca cct cct cct cct gat gaa act ata att cac att ggt 240
Thr Ala Pro Pro Pro Pro Pro Pro Asp Glu Thr Ile Ile His Ile Gly
65 70 75 80
gac gac tgg gag gat gga gtt cac ttg gac tcg agc gac ccg cgc att 288
Asp Asp Trp Glu Asp Gly Val His Leu Asp Ser Ser Asp Pro Arg Ile
85 90 95
cta gca atg gct gcg gcg gaa cga cat ttc ttg gaa gct gac tat gac 336
Leu Ala Met Ala Ala Ala Glu Arg His Phe Leu Glu Ala Asp Tyr Asp
100 105 110
gag tac tct gag tct aac tct agc ggt gct gcc ttc tgt cgc tct gct 384
Glu Tyr Ser Glu Ser Asn Ser Ser Gly Ala Ala Phe Cys Arg Ser Ala
115 120 125
gct ctc atc ctg atg gca ctt tta ctg tta cgt gat gca cta aac ctc 432
Ala Leu Ile Leu Met Ala Leu Leu Leu Leu Arg Asp Ala Leu Asn Leu
130 135 140
aca act aac cca gat gac gag gac gat ccc act gcc ttc ttc tct ctt 480
Thr Thr Asn Pro Asp Asp Glu Asp Asp Pro Thr Ala Phe Phe Ser Leu
145 150 155 160
ttc ctt ctt cgt gct gct ggt ttt ctc ctc cca tgt tat atc atg gca 528
Phe Leu Leu Arg Ala Ala Gly Phe Leu Leu Pro Cys Tyr Ile Met Ala
165 170 175
tgg gcc atc ggt att ctc cag cgc cgg agg caa aga cag gaa gca gct 576
Trp Ala Ile Gly Ile Leu Gln Arg Arg Arg Gln Arg Gln Glu Ala Ala
180 185 190
gcg cta gct gcg gcg gaa gtt gcc ttc atg ata cac ggt ggt gtg cca 624
Ala Leu Ala Ala Ala Glu Val Ala Phe Met Ile His Gly Gly Val Pro
195 200 205
caa cgc agg gga cta cac ttt gct gta gca cca gag cag ccg ccg cca 672
Gln Arg Arg Gly Leu His Phe Ala Val Ala Pro Glu Gln Pro Pro Pro
210 215 220
ata tcc aac cca aca cca gtc tga 696
Ile Ser Asn Pro Thr Pro Val
225 230
<210>4
<211>231
<212>PRT
<213>Brassica napus
<400>4
Glu Glu Glu Pro Leu Leu Gln Ser Val Glu Cys Arg Ile Cys Gln Glu
1 5 10 15
Glu Asp Ile Thr Lys Asn Leu Glu Thr Pro Cys Ala Cys Asn Gly Ser
20 25 30
Leu Lys Tyr Ala His Arg Lys Cys Val Gln Arg Trp Cys Asn Glu Lys
35 40 45
Gly Asp Ile Ile Cys Glu Ile Cys His Gln Pro Tyr Gln Ser Gly Tyr
50 55 60
Thr Ala Pro Pro Pro Pro Pro Pro Asp Glu Thr Ile Ile His Ile Gly
65 70 75 80
Asp Asp Trp Glu Asp Gly Val His Leu Asp Ser Ser Asp Pro Arg Ile
85 90 95
Leu Ala Met Ala Ala Ala Glu Arg His Phe Leu Glu Ala Asp Tyr Asp
100 105 110
Glu Tyr Ser Glu Ser Asn Ser Ser Gly Ala Ala Phe Cys Arg Ser Ala
115 120 125
Ala Leu Ile Leu Met Ala Leu Leu Leu Leu Arg Asp Ala Leu Asn Leu
130 135 140
Thr Thr Asn Pro Asp Asp Glu Asp Asp Pro Thr Ala Phe Phe Ser Leu
145 150 155 160
Phe Leu Leu Arg Ala Ala Gly Phe Leu Leu Pro Cys Tyr Ile Met Ala
165 170 175
Trp Ala Ile Gly Ile Leu Gln Arg Arg Arg Gln Arg Gln Glu Ala Ala
180 185 190
Ala Leu Ala Ala Ala Glu Val Ala Phe Met Ile His Gly Gly Val Pro
195 200 205
Gln Arg Arg Gly Leu His Phe Ala Val Ala Pro Glu Gln Pro Pro Pro
210 215 220
Ile Ser Asn Pro Thr Pro Val
225 230
<210>5
<211>852
<212>DNA
<213>artificial
<220>
<223>artificial
<220>
<221>CDS
<222>(1)..(852)
<223 > improve plant and the stable on heating nucleotide sequence of microorganism
<400>5
atg gct gat gat ttc agt tta tgt acc gat cgt ctg ata acg gcc gag 48
Met Ala Asp Asp Phe Ser Leu Cys Thr Asp Arg Leu Ile Thr Ala Glu
1 5 10 15
agc ttg gaa tca gaa aag gat tct gga gaa agt tcc agg ctt caa ggc 96
Ser Leu Glu Ser Glu Lys Asp Ser Gly Glu Ser Ser Arg Leu Gln Gly
20 25 30
aaa gat gtg gct tct tct tca tct gcg gat gaa gct gaa gat gct agg 144
Lys Asp Val Ala Ser Ser Ser Ser Ala Asp Glu Ala Glu Asp Ala Arg
35 40 45
aag tac tat gct gtt gtt gca gaa gag gag ccg ctt ctg caa tct gtt 192
Lys Tyr Tyr Ala Val Val Ala Glu Glu Glu Pro Leu Leu Gln Ser Val
50 55 60
gag tgc cgt att tgc cag gag gaa gat atc act aag aac ttg gag act 240
Glu Cys Arg Ile Cys Gln Glu Glu Asp Ile Thr Lys Asn Leu Glu Thr
65 70 75 80
cct tgt gct tgc aat ggc agt ttg aag tat gct cac cgc aag tgt gtt 288
Pro Cys Ala Cys Asn Gly Ser Leu Lys Tyr Ala His Arg Lys Cys Val
85 90 95
cag cgt tgg tgt aat gag aaa ggc gac ata atc tgc gaa ata tgc cac 336
Gln Arg Trp Cys Asn Glu Lys Gly Asp Ile Ile Cys Glu Ile Cys His
100 105 110
cag cct tat caa tct gga tat aca gca cct cca cct cct cct cct gat 384
Gln Pro Tyr Gln Ser Gly Tyr Thr Ala Pro Pro Pro Pro Pro Pro Asp
115 120 125
gaa act ata att cac att ggt gac gac tgg gag gat gga gtt cac ttg 432
Glu Thr Ile Ile His Ile Gly Asp Asp Trp Glu Asp Gly Val His Leu
130 135 140
gac tcg agc gac ccg cgc att cta gca atg gct gcg gcg gaa cga cat 480
Asp Ser Ser Asp Pro Arg Ile Leu Ala Met Ala Ala Ala Glu Arg His
145 150 155 160
ttc ttg gaa gct gac tat gac gag tac tct gag tct aac tct agc ggt 528
Phe Leu Glu Ala Asp Tyr Asp Glu Tyr Ser Glu Ser Asn Ser Ser Gly
165 170 175
gct gcc ttc tgt cgc tct gct gct ctc atc ctg atg gca ctt tta ctg 576
Ala Ala Phe Cys Arg Ser Ala Ala Leu Ile Leu Met Ala Leu Leu Leu
180 185 190
tta cgt gat gca cta aac ctc aca act aac cca gat gac gag gac gat 624
Leu Arg Asp Ala Leu Asn Leu Thr Thr Asn Pro Asp Asp Glu Asp Asp
195 200 205
ccc act gcc ttc ttc tct ctt ttc ctt ctt cgt gct gct ggt ttt ctc 672
Pro Thr Ala Phe Phe Ser Leu Phe Leu Leu Arg Ala Ala Gly Phe Leu
210 215 220
ctc cca tgt tat atc atg gca tgg gcc atc ggt att ctc cag cgc cgg 720
Leu Pro Cys Tyr Ile Met Ala Trp Ala Ile Gly Ile Leu Gln Arg Arg
225 230 235 240
agg caa aga cag gaa gca gct gcg cta gct gcg gcg gaa gtt gcc ttc 768
Arg Gln Arg Gln Glu Ala Ala Ala Leu Ala Ala Ala Glu Val Ala Phe
245 250 255
atg ata cac ggt ggt gtg cca caa cgc agg gga cta cac ttt gct gta 816
Met Ile His Gly Gly Val Pro Gln Arg Arg Gly Leu His Phe Ala Val
260 265 270
gca cca gag cag ccg ccg cca ata tcc aac cca aca 852
Ala Pro Glu Gln Pro Pro Pro Ile Ser Asn Pro Thr
275 280
<210>6
<211>284
<212>PRT
<213>artificial
<220>
<223>Synthetic Construct
<400>6
Met Ala Asp Asp Phe Ser Leu Cys Thr Asp Arg Leu Ile Thr Ala Glu
1 5 10 15
Ser Leu Glu Ser Glu Lys Asp Ser Gly Glu Ser Ser Arg Leu Gln Gly
20 25 30
Lys Asp Val Ala Ser Ser Ser Ser Ala Asp Glu Ala Glu Asp Ala Arg
35 40 45
Lys Tyr Tyr Ala Val Val Ala Glu Glu Glu Pro Leu Leu Gln Ser Val
50 55 60
Glu Cys Arg Ile Cys Gln Glu Glu Asp Ile Thr Lys Asn Leu Glu Thr
65 70 75 80
Pro Cys Ala Cys Asn Gly Ser Leu Lys Tyr Ala His Arg Lys Cys Val
85 90 95
Gln Arg Trp Cys Asn Glu Lys Gly Asp Ile Ile Cys Glu Ile Cys His
100 105 110
Gln Pro Tyr Gln Ser Gly Tyr Thr Ala Pro Pro Pro Pro Pro Pro Asp
115 120 125
Glu Thr Ile Ile His Ile Gly Asp Asp Trp Glu Asp Gly Val His Leu
130 135 140
Asp Ser Ser Asp Pro Arg Ile Leu Ala Met Ala Ala Ala Glu Arg His
145 150 155 160
Phe Leu Glu Ala Asp Tyr Asp Glu Tyr Ser Glu Ser Asn Ser Ser Gly
165 170 175
Ala Ala Phe Cys Arg Ser Ala Ala Leu Ile Leu Met Ala Leu Leu Leu
180 185 190
Leu Arg Asp Ala Leu Asn Leu Thr Thr Asn Pro Asp Asp Glu Asp Asp
195 200 205
Pro Thr Ala Phe Phe Ser Leu Phe Leu Leu Arg Ala Ala Gly Phe Leu
210 215 220
Leu Pro Cys Tyr Ile Met Ala Trp Ala Ile Gly Ile Leu Gln Arg Arg
225 230 235 240
Arg Gln Arg Gln Glu Ala Ala Ala Leu Ala Ala Ala Glu Val Ala Phe
245 250 255
Met Ile His Gly Gly Val Pro Gln Arg Arg Gly Leu His Phe Ala Val
260 265 270
Ala Pro Glu Gln Pro Pro Pro Ile Ser Asn Pro Thr
275 280
<210>7
<211>23
<212>DNA
<213>artificial
<220>
<223>artificial
<400>7
atgtcggatc atttgagttt atg 23
<210>8
<211>24
<212>DNA
<213>artificial
<220>
<223>artificial
<400>8
tcagactggt gttgggttgg atat 24
<210>9
<211>26
<212>DNA
<213>artificial
<220>
<223>artificial
<400>9
atggctgatg atttcagttt atgtac 26
<210>10
<211>25
<212>DNA
<213>artificial
<220>
<223>artificial
<400>10
ttgggttgga tattggcggc ggctg 25
<210>11
<211>35
<212>DNA
<213>artificial
<220>
<223>artificial
<400>11
ccggaattca tggctgatga tttcagttta tgtac 35
<210>12
<211>34
<212>DNA
<213>artificial
<220>
<223>artificial
<400>12
ccggagctct tgggttggat attggcggcg gctg 34
<210>13
<211>32
<212>DNA
<213>artificial
<220>
<223>artificial
<400>13
cgcggatcca tgtcggatca tttgagttta tg 32
<210>14
<211>33
<212>DNA
<213>artificial
<220>
<223>artificial
<400>14
ccggagctct cagactggtg ttgggttgga tat 33
<210>15
<211>22
<212>DNA
<213>artificial
<220>
<223>artificial
<400>15
atttcatttg gagagaacac gg 22
<210>16
<211>24
<212>DNA
<213>artificial
<220>
<223>artificial
<400>16
tcagactggt gttgggttgg atat 24
Claims (6)
1.TT1 the purposes of gene in improving plant salt tolerance alkalescence, described TT1 gene is the gene that encoding amino acid sequence is the polypeptide shown in SEQ ID NO:2, and described plant is Arabidopis thaliana.
2. purposes according to claim 1, is characterized in that, the nucleotides sequence of described TT1 gene is classified as shown in SEQ ID NO:1.
3.TT1 the purposes of the polypeptide of genes encoding in improving plant salt tolerance alkalescence, the aminoacid sequence of the polypeptide of described TT1 genes encoding is shown in SEQ ID NO:2, and described plant is Arabidopis thaliana.
4. purposes according to claim 3, is characterized in that the nucleotides sequence of described TT1 gene is classified as shown in SEQ ID NO:1.
5. a method of cultivating saline alkali tolerant plant is characterized in that comprising the following steps:
(1), after the TT1 gene operationally is connected in to the expression regulation sequence on carrier, form the recombinant vectors of described TT1 gene;
(2) recombinant vectors in step (1) is proceeded to vegetable cell;
(3) obtain transformant through screening, then transformant is cultivated into to transgenic salt-tolerant wheat alkali plant and offspring thereof, described offspring comprises plant seed and plant tissue;
Described TT1 gene is the gene that encoding amino acid sequence is the polypeptide shown in SEQ ID NO:2, and described plant is Arabidopis thaliana.
6. method according to claim 5, it is characterized in that: the nucleotides sequence of described TT1 gene is classified as shown in SEQ ID NO:1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009103047263A CN101962656B (en) | 2009-07-23 | 2009-07-23 | Application of TT1 gene in improving saline alkali tolerance of plants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009103047263A CN101962656B (en) | 2009-07-23 | 2009-07-23 | Application of TT1 gene in improving saline alkali tolerance of plants |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101962656A CN101962656A (en) | 2011-02-02 |
| CN101962656B true CN101962656B (en) | 2013-12-04 |
Family
ID=43515709
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009103047263A Active CN101962656B (en) | 2009-07-23 | 2009-07-23 | Application of TT1 gene in improving saline alkali tolerance of plants |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101962656B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114656544B (en) * | 2020-12-23 | 2023-09-19 | 中国农业大学 | Protein GH3.9, biological material thereof and method for cultivating high stress tolerance plant |
| CN116590314B (en) * | 2023-07-11 | 2023-09-29 | 烟台吉恩生物科技发展有限公司 | Gene for improving salt and alkali tolerance of wheat and application thereof |
-
2009
- 2009-07-23 CN CN2009103047263A patent/CN101962656B/en active Active
Non-Patent Citations (6)
| Title |
|---|
| "耐盐碱植物研究概述";付莉 等;《林业科技》;20010730;第26卷(第4期);第16-17页 * |
| 付莉 等."耐盐碱植物研究概述".《林业科技》.2001,第26卷(第4期),第16-17页. |
| 路小春 等."甘蓝型油菜TT1基因反义植物表达载体的构建".《生物技术通报（增刊）》.2006,第305-309页. |
| 路小春 等."甘蓝型油菜TT1基因反义植物表达载体的构建".《生物技术通报(增刊)》.2006,第305-309页. * |
| 路小春."甘蓝型油菜编码WIP-锌指蛋白的TT1基因家族的克隆及在黄、黑籽之间的差异表达".《中国优秀硕士学位论文全文数据库（电子期刊）农业科技辑》.2006,(第11期),D047-76. |
| 路小春."甘蓝型油菜编码WIP-锌指蛋白的TT1基因家族的克隆及在黄、黑籽之间的差异表达".《中国优秀硕士学位论文全文数据库(电子期刊)农业科技辑》.2006,(第11期),D047-76. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101962656A (en) | 2011-02-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102112613B (en) | Genes, proteins and vectors for increaseing tolerance of plants and microbes to abiotic stresses and use thereof | |
| CN109456982B (en) | Application of rice OsMYB6 gene and encoding protein thereof in drought resistance and salt resistance | |
| CN109627302B (en) | Soybean photosynthesis related gene GmGRF5-1 and encoding protein and application thereof | |
| CN105802933A (en) | Herbicide tolerance protein and coding gene and application thereof | |
| CN113150097B (en) | Plant stress tolerance related protein OsERF096 and encoding gene and application thereof | |
| CN107383179A (en) | A kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application | |
| CN109797157A (en) | A kind of resisting abiotic adverse circumstance transcription factor PbrbHLH92 and its primer, the albumen of coding and application | |
| CN102168097B (en) | Gene for encoding protein capable of improving heat resistances of plants and microorganisms and application thereof | |
| CN109536516A (en) | The clone of drought-resistant maize gene ZmDSR and its application | |
| CN110804090B (en) | Protein CkWRKY33 and coding gene and application thereof | |
| CN101503690B (en) | The method that plant seed increases and cotton fiber increases is promoted with RDL1 gene | |
| CN112430584B (en) | Du pear ubiquitin ligase gene, encoding protein and application thereof in plant drought-resistant genetic improvement | |
| CN109825482A (en) | Anti-herbicide gene and its application in plant breeding | |
| CN101748144B (en) | Torch pear haloduric gene PpGST and application thereof | |
| CN106749580B (en) | Plant salt tolerance GAP-associated protein GAP TaPUB15-D and its encoding gene and application | |
| CN101962656B (en) | Application of TT1 gene in improving saline alkali tolerance of plants | |
| CN104610439A (en) | Abiotic stress response related protein, and encoding gene and application thereof | |
| CN102477435A (en) | Method for improving plant drought resistance using Poncirus trifoliata transcription factor gene PtrABF | |
| CN108409846B (en) | Soybean salt tolerance related MYB transcription factor and coding gene and application thereof | |
| CN103421104A (en) | Application of OsLEA3-2 in improvement of stress resistance of crop | |
| CN102449154A (en) | Methods and compositions for stress tolerance in plants | |
| CN101962655B (en) | Application of TT1 gene in improving drought resistance of plants | |
| CN114410650A (en) | Rice salt sensitive mutant gene SS2, mutant SS2 and application | |
| CN109371036B (en) | An alfalfa salt tolerance gene MsPIP 2; 2 and uses thereof | |
| CN101818168A (en) | Application of AtNRT1.8 gene to strengthening resistance of crops to stress of heavy metals or salts |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |