CN101955946A - MicroRNA for regulating and controlling fiber growth in cotton - Google Patents

Abstract

MicroRNAs(miRNAs) are internal-growing and non-coding single-chain small molecule RNAs which are mainly found in higher animals and plants. The MicroRNAs are complemented and combined with specific target gene mRNAs in the horizontal direction after transcription, and regulate the gene expression by causing the degradation or translational suppression of the target gene. The invention establishes RNA libraries of two small ovule molecules of a cotton wild type (Xuzhou-142) and a fuzzless-lintless fiber mutant (peeled seeds, Xuzhou 142 fuzzless-lintless), adopts the existing international most advanced high-flux sequencing technology (Solexa), obtains one unknown miRNA gene which is named as ghr-MIR4 temporarily, and studies on different expression abundances of the cotton fiber in the process of initial growth. The invention predicts the target gene by the bioinformatics, and lays the basis for deeply studying on regulating and controlling the growth of cotton seeds and improving the fiber quality by gene engineering means and methods.

Description

MicroRNA that the regulation and control fiber is grown in the cotton

One, technical field

The present invention relates to grow clone, evaluation and the purposes of a relevant unknown miRNA (ghr-MIR4) gene with upland cotton fiber.Upland cotton Xuzhou 142 ovules are set up wild-type (WT) and two microRNA libraries of lint-free nothing wadding fiber mutant (M) respectively, adopted the present world state-of-the-art small RNA high-flux sequence row technology, obtained above-mentioned new miRNA gene order.Further analyzed the target gene of this miRNA, its proteins encoded Unknown Function.The invention belongs to biological technical field.The abundance great disparity is cloned into and is expressed to ghr-MIR4 in WT and M in cotton fiber, as seen this miRNA has the effect that can not be ignored in the fiber growth course, but this miRNA target gene Unknown Function, the function of therefore studying this miRNA and target gene thereof will have pushing effect to the mechanism of probing into cotton fiber development.

Two, background technology

MicroRNAs (miRNAs) be a class mainly in high moving planting newfound endogenous, non-coding, length be the strand microRNA of 20-25nt.Studies show that in a large number miRNA grows in coordinate plant growth as the main negative regulatory factor that eukaryotic gene is expressed, the cell increment, coerce in the process such as response and play an important role.Cotton is a kind of global important cash crop, also is topmost textile fibres crop, accounts for critical role in national economy.China is maximum in the world Cotton Production and country of consumption, also is an important cotton trading country, and therefore, cotton has critical role (http://www.emergingtextiles.com) as cash crop especially in China.The development mechanism of cotton fiber is not clear so far, therefore become the focus that receives much concern, because being related to, it how to improve production of cotton fibers (improving the quantity of unit surface cotton fibre elongation), the fibres modified quality, and all these are and textile industry and the closely-related realistic problem of the people's livelihood.

Along with the development of modern molecular biology technique, except utilizing the conventional breeding means, progressively use genetic engineering technique that cotton fibre quality is carried out genetic improvement both at home and abroad.Utilize genetically engineered fibres modified quality to depend on understanding to fiber development related gene and controlling element thereof.Therefore, carry out separation, functional gene that evaluation is relevant with cotton fiber development is to cultivate the high quality cotton fibre new species, realizes the important foundation of breeding theory and gordian technique new breakthrough, also is the crucial behave that promotes Cotton in China breeding original innovation power.

According to estimates, there are thousands of specific genes to express in the cotton fiber development process, but up to the present, the separated evaluation of minority gene only arranged, these expression of gene mechanism and network regulation are known little about it.The relation of miRNA and cotton fiber development rarely has the people to study especially.Our laboratory in 2007 takes the lead in having excavated 37miRNA in existing cotton gene group.This also is to excavate maximum miRNA both at home and abroad up to now from vegetable lamb.These important miRNA gene pairs regulation and control cotton growths and fiber are grown and are had important biological significance and potential production exploitation value.Therefore, press for existing characteristic cotton resource to China, fully excavate and develop new miRNA (comprising other sRNA) gene that belongs to national intellecture property by extensive cloning process, for later stage orderly improvement and the cotton germplasm of cultivating the high-quality proterties lay the foundation.

The new miRNA that this patent is cloned into comes from the upland cotton kind, all express in mutant and wild-type, but it shows as rise with respect to wild-type in mutant, the target gene Unknown Function of prediction.The expression abundance difference of ghr-MIR4 in WT and M shows that there are certain unknown relation in itself and cotton fiber development, therefore, has important biological significance and potential using value by research miRNA and the effect of target gene in cotton fiber development thereof.

Three, summary of the invention

Technical problem the objective of the invention is to clone an important miRNA (ghr-MIR4) in the upland cotton fiber growth course, analyzes and identified secondary structure, analyzes simultaneously and has obtained a target gene, target gene Unknown Function.To the functional study of this target gene and based on this gene, mechanism by engineered method research cotton fiber development and change the quality characteristic of present cotton fibre, can obtain certain economic and social benefit, for the quality breeding of cotton provides genetic resources, improve the fibrous quality of Cotton in China kind as early as possible.

Technical scheme

Upland cotton pre-ghr-MIR4 (genetic expression precursor), length is 89bp, sequence is as follows:

TGGAGGCAGCGGTTCATCGATCTCTTCCTGAGAATTTTGTTGTGAGAATAACACAAATACATGAATCGATCGATAAACCTCTGCATCCA

1. according to the IlluminaSamplePreparationProtocol library constructing method, made up upland cotton Xuzhou-142 (WT) and Xuzhou-142 light seed mutant (M) respectively and bloomed back (0,1,2,3,4,5,6,8,10 days, DPA) two libraries of ovule cDNA.

2. picking clone from the library transforms, and the high-quality length that analysis is obtained is that the small fragment RNA of 18-30nt carries out high-flux sequence.According to sequencing result, further carry out the BLAST compare of analysis, screening meets the sequence of miRNA standard.Information biology is predicted its target gene.

Beneficial effect

1. sRNA clonal analysis technology at present commonly used waste time and energy and also efficient low, insensitive, some is expressed the low or specific expressed basic survey of microRNA of abundance and is not come out.State-of-the-art in the world at present extensive high-flux sequence is adopted in this research, and its advantage is:

(1) highly sensitive, the accuracy height can be measured the microRNA of a copy, the base accuracy rate height of the RNA molecule of mensuration;

(2) high-throughput, scale are big, can measure nearly all genomic transcripton.The order-checking amount in two libraries is forgiven all microRNA sequences up to 1,300,000 more than the base sequence;

(3) measure the expression abundance of microRNA simultaneously, so can compare the difference of small molecules rna expression spectrum in two gene libraries.

2. the present invention's agnoprotein gene of miRNA ghr-MIR4 regulation and control of being cloned into may find a new cotton fiber development regulatory gene to the research of this gene, and adds one again for finding out the mechanism that fiber grows.With this gene as goal gene, cotton is carried out gene transformation can directly change fiber quality or quantity etc. in theory, and may improve its plantation growth efficiency effectively, break the negative correlation of yield and quality, for the quality breeding of cotton provides genetic resources, obtain high-quality cotton, bring considerable economic and social benefits.

3. present genetically modified foreign gene major part derives from microorganism, and these class genetically modified crops are strict to safety evaluation.The gene source of this patent report imports cotton again and does not have the safety evaluation problem in cotton.Simultaneously, at home and abroad the patent of application is very few at present for relevant with cotton fiber development miRNA gene.

Four, description of drawings

Fig. 1 .ghr-MIR4 precursor secondary structure figure.MiRNA clones from lint-free nothing wadding fiber mutant and wild-type upland cotton and obtains, and has higher relative expression's abundance.5 ' and 3 ' end all can detect different abundance fragments (The Scarlet Letter black line part), 3 ' hold fragment into miRNA*.

Five, Fa Ming specific embodiment

1. cotton ovule collection: cotton planting ground is experimental plot, academy of agricultural sciences, Jiangsu Province, and list flowering period.Liquid nitrogen freezing immediately after the different times ovule is gathered ,-80 ℃ of refrigerators are preserved, and are standby.

2. according to Illumina SamplePreparationProtocol library constructing method, made up upland cotton Xuzhou-142 (WT) and Xuzhou-142 light seed mutant (M) and bloomed back 0,1,2,3,4,5, two libraries of 6,8,10 days (DPA) ovule mixing cDNA.

3. picking clone from the library carries out isolation identification and transforms, and the high-quality length that analysis is obtained is that the RNA of 18-30nt carries out high-flux sequence.According to sequencing result, further carry out the BLAST compare of analysis, screening meets the sequence of miRNA standard.Information biology is predicted its target gene.

ghr-MIR4.ST25

SEQUENCE?LISTING

＜110〉Agricultural University Of Nanjing

 

＜120〉microRNA that the regulation and control fiber is grown in the cotton

 

＜130〉specification sheets

 

<160>1

 

<170>PatentIn?version?3.1

 

<210>1

<211>89

<212>DNA

<213>Gossypium?hirsutum

 

<220>

＜221〉ghr-MIR4 precursor-gene

<222>(1)..(89)

<223>

 

<400>1

tggaggcagc?ggttcatcga?tctcttcctg?agaattttgt?tgtgagaata?acacaaatac 60

atgaatcgat?cgataaacct ctgcatcca 89

Claims (3)

1. newfound miRNA gene ghr-MIR4 all is cloned in mutant M and wild-type WT in the upland cotton (Gossypium hirsutum), its ripe segment is 22 bases, 5 ' be TGGAGGCAGCGGTTCATCGATC to 3 ' sequence, precursor-gene is 109864995.

2. according to claim 1, the ghr-MIR4 gene is all expressed in mutant M and wild-type WT upland cotton, but the expression abundance difference in the two, its ripe fragment in mutant is respectively 38 and 16 in the expression abundance of 5 ' end and 3 ' end respectively, and ripe fragment is respectively 14 and 18 in the expression abundance of 5 ' end and 3 ' end respectively in wild-type, the expression abundance of this miRNA in mutant raises with respect to wild-type, shows that this miRNA gene pairs fiber growth plays a part certain.

3. according to claim 1, by information biology this miRNA is predicted target gene, and predicts a target gene that ID is DW493972, this gene function the unknown.

Images