CN102899326A - MiRNA-GhmiRnE coming from cotton and application thereof - Google Patents
MiRNA-GhmiRnE coming from cotton and application thereof Download PDFInfo
- Publication number
- CN102899326A CN102899326A CN2012103988409A CN201210398840A CN102899326A CN 102899326 A CN102899326 A CN 102899326A CN 2012103988409 A CN2012103988409 A CN 2012103988409A CN 201210398840 A CN201210398840 A CN 201210398840A CN 102899326 A CN102899326 A CN 102899326A
- Authority
- CN
- China
- Prior art keywords
- sequence
- mirna
- cotton
- ghmirne
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses miRNA-GhmiRnE coming from cotton and application thereof. GhmiRnE protected by the invention is RNA (ribonucleic acid) as shown by a sequence 1 in a sequence table. Pre-GhmiRnE protected by the invention is RNA as shown by a sequence 2 in the sequence table. The invention additionally protects the application of the RNA shown by the sequence 1 to inhibiting the expression of an acetylcoenzyme A carboxylase beta subunit gene and/or promoting mRNA degradation of the acetylcoenzyme A carboxylase beta subunit gene. An acetylcoenzyme A carboxylase beta subunit is as shown by a sequence 3 in the sequence table. The acetylcoenzyme A carboxylase beta subunit gene is as shown by a sequence 4 in the sequence table. Through the application of the miRNA-GhmiRnE, plants with important expression of cotton fiber length and strength are expected to be obtained, the biological significance and the potential application value are important, precious gene resources can be provided for quality breeding of cotton such as breeding of stress-resistant cotton, certain research values and social benefits are brought and the application to practical production is realized finally.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of miRNA-GhmiRnE and application thereof that derives from cotton.
Background technology
MiRNA(microRNA, Microrna) is the endogenous strand non-coding microRNA that a class length is about 20-24nt, in organism, extensively there is (Bartel D P.MicroRNAs:genomics, biogenesis, mechanisms, and function.Cell, 2004,116:281-297.).Studies show that in a large number in recent years, miRNA can regulate and control to be permitted polygenic expression in the organism, at growth regulation, cell proliferation, apoptosis, resist all many-sides such as environment-stress (Bushati N that plays a significant role, Cohen S M.MicroRNA functions.Annu.Rev.Cell Dev.Biol., 2007,23:175-205.; Jin Longguo, Wang Chuan, Liu Jinyuan. Plant MicroRNA. Chinese biological chemistry and molecular biosciences journal, 2006,22:609-614.).Mirnas of plant is mainly by cutting target gene mRNA, or suppress said target mrna and translate, come the regulating plant individual growth to grow and affect its physiological process, it is a kind of new gene regulating pattern, have important Research Significance (Voinnet O.Origin, biogenesis, and activity of plant microRNAs.Cell, 2009,136:669-687.).
Cotton is one of most important cash crop in the world, and cotton fiber also is the good model of the unicellular elongation of research simultaneously.With Arabidopis thaliana, paddy rice isotype biophase ratio, the cotton miRNA quantity that has been found that at present is very few, therefore pass through high throughput sequencing technologies, be expected to excavate more cotton miRNA, this forming process, constructional feature and functional mechanism for overall understanding cotton and even whole Mirnas of plant has realistic meaning.In addition, miRNA may be at many physiological processs (such as the initial of fiber and elongation etc.) performance critical function in the cotton, but the biological function research about miRNA in the cotton is very few, therefore, by paying close attention to the miRNA in specific developmental stage, the particular organization, be expected to illustrate the physiological process that cotton miRNA participates in, and the effect of concrete performance in this process.
China is main in the world Cotton Production and country of consumption, and cotton has very important status for China.Both at home and abroad except utilizing the conventional breeding means, progressively use genetic engineering technique to cotton fiber output, quality, pest-resistant etc. carry out genetic improvement and become a kind of trend.Because miRNA has widely regulating and controlling effect to plant, probably become one of primary study gene of genetic modification of plants, therefore in the urgent need to fully excavating and develop the new miRNA gene that belongs to national intellecture property by the large scale sequencing method, thereby lay the foundation for later stage orderly improvement and the cotton variety of cultivating the high-quality proterties.
Summary of the invention
The purpose of this invention is to provide the miRNA-GhmiRnE and the application thereof that derive from cotton.
The invention provides miRNA-GhmiRnE, be single stranded RNA, be the RNA shown in the sequence 1 of sequence table, the following (5' → 3'): UUGGUAUGGAGGAUGGAAAAG of sequence.
The present invention also provides miRNA-GhmiRnE precursor (pre-GhmiRnE), be single stranded RNA, be the RNA shown in the sequence 2 of sequence table, the following (5' → 3'): AAGCCUUGCUUUGGUAUGGAGGAUGGAAAAGAGUGAAGAUGGAAAAUUUAUUAAUC AAAAGGCCAAGAUUCACAAUCACUUUCCUACUUUGUAACUUAACCAUUAGAUUGAC AAAUUUUCUAUCCUACCUCUUUUCCAUCCUUCGUACCAAACAAAGCUUA of sequence.
The application of RNA shown in RNA shown in the sequence 1 or the sequence 2 in suppressing acetyl-CoA carboxylase beta subunit gene (TC229767) expression also is the scope of protection of the invention; The aminoacid sequence of described acetyl-CoA carboxylase β subunit is the sequence 3 of sequence table.The nucleotides sequence of described acetyl-CoA carboxylase beta subunit gene is classified in the sequence 4 of sequence table or the sequence table sequence 4 as from 5 ' terminal 708-2201 position Nucleotide.
The application of RNA shown in RNA shown in the sequence 1 or the sequence 2 in the mRNA degraded that promotes the acetyl-CoA carboxylase beta subunit gene also is the scope of protection of the invention; The aminoacid sequence of described acetyl-CoA carboxylase β subunit is the sequence 3 of sequence table; The nucleotides sequence of described acetyl-CoA carboxylase beta subunit gene is classified in the sequence 4 of sequence table or the sequence table sequence 4 as from 5 ' terminal 708-2201 position Nucleotide.Wherein, promote the mRNA of acetyl-CoA carboxylase beta subunit gene to be degraded to the mRNA of cutting acetyl-CoA carboxylase beta subunit gene.
The application of RNA shown in RNA shown in the sequence 1 or the sequence 2 in the cotton fiber quality improvement also is the scope of protection of the invention.
Solexa has overcome the shortcoming of conventional miRNA clone technology, has advantages of highly sensitively, can detect a minimum small RNA molecular, and accuracy is high, and the small RNA molecular base error rate that detects is extremely low.HiSeq 2000 is a new sequenators that Illumina company 2010 releases, adopt stable reversible cessation method while synthesizing sequencing technologies.4 kinds of bases that contain terminal blocking group and different fluorescent signals of this utilization are carried out the synthetic of template complementary strand, have not only guaranteed high precision and the high succession of order-checking, and have got rid of the order-checking mistake that is caused by tumor-necrosis factor glycoproteins and homopolymer.Up-to-date optical system and manufacturing process have been merged, this optical system adopts 2 laser sources that Flowcell is scanned, and using 4 photographic cameras that 4 kinds of bases are carried out respectively record, the signal that has significantly reduced between the different bases disturbs the accuracy that has improved sequencing system.Simultaneously, HiSeq 2000 has used novel two surperficial imaging technique, has increased the useful area of Flowcell, thereby improves order-checking output and reduce cost.The order-checking amount in each library reaches more than 1,500 ten thousand little RNA sequences at least.Based on this up-to-date order-checking means, will be expected to identify the new miRNA of specific developmental stage particular organization specifically expressing in the cotton.
Of the present invention experimental results show that, the present invention adopts advanced in the world Solexa high throughput sequencing technologies, up-to-date HiSeq 2000 sequenators are in conjunction with various biological means such as bioinformatic analysis, 5 ' RACE, identify miRNA-GhmiRnE from genomic level first, and the target gene that confirms GhmiRnE is acetyl-CoA carboxylase β subunit, and this gene has participated in the developmental regulation that cotton fiber extension and secondary wall thicken.This all will provide valuable genetic resources for the quality breeding (as improving production of cotton fibers) of cotton, bring certain researching value and social benefit, and finally be used for actual production.MiRNA wide participation provided by the invention the adjusting of the multiple vital movement of cotton, have important biological significance and potential using value.
Description of drawings
Fig. 1 is the schema that separates and identify new miRNA in the little RNA sequencing data.
Fig. 2 be cotton bloomed rear 5 days, 10 days, 15 days, 20 days and the 25 days little RNA of fiber storehouses in the order-checking number of GhmiRnE; All numerals all represent the number that is normalized in per 1,000 ten thousand " totally " sequence (" totally " sequence: see the explanation in the evaluation part of miRNA new in the little RNA library).
Fig. 3 is the precursor secondary structure figure of GhmiRnE.
Fig. 4 is target gene 5 ' RACE checking of GhmiRnE; The arrow of sequence top represents the site of cutting, and clone's number and the total ratio of clone of cutting occurs at numeric representation this place, point of contact.
Fig. 5 is the expression that real-time quantitative RT-PCR detects target gene; Error line represents relative standard deviation.
Embodiment
Employed experimental technique is ordinary method if no special instructions among the following embodiment.
Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.
% among the following embodiment if no special instructions, is the quality percentage composition.
Used cotton variety is cotton 35(Gossypium hirsutum cv.CRI35 in the upland cotton in following examples), cotton seeds derives from the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute.Numbering: state examines cotton 990005.
The discovery of embodiment 1, miRNA-GhmiRnE
One, sample collecting
Cotton was planted in the field the annual last ten-days period in April, routine work, and petal bagging the day before yesterday of blooming prevents that pollen transmission from causing cross-pollination, the same day of blooming is except bag, and listing mark.Collect respectively bloom after 5,10,15,20,25 days cotton boll, remove cotton boll hull, seed and fiber is frozen in liquid nitrogen rapidly, be stored in-80 ℃ for subsequent use.
Two, the discovery of miRNA-GhmiRnE
1, RNA extracts
In being housed, knocks by the mortar of liquid nitrogen cotton fiber and seed with pestle, and then fiber and seed peeled off, take out seed, milled fibre, add PVP (by 1/5 mass ratio) in the process of lapping to prevent the phenols oxidation, extract total RNA with PureLinkTMPlant RNA Reagent (Invitrogen), operation steps following (take the 0.1g material as example, the corresponding reagent amount can be adjusted in proportion according to quantity of material):
1. the fiber dust of milled joins in the 1ml Extraction buffer, adds 20 μ l beta-mercaptoethanols, and mixing is placed on room temperature 10-15 minute.Centrifugal 5 minutes of 12000 rev/mins of 4 degree go to new centrifuge tube with supernatant, add 100 μ l 5MNaCl, add 300 μ l chloroforms behind the mixing, abundant mixing, and centrifugal 10 minutes of 12000 rev/mins of 4 degree go to new centrifuge tube with supernatant;
2. the solution that produces is used chloroform, phenol, phenol successively: chloroform (1:1), chloroform extracting, supernatant liquor after four extractings changes new centrifuge tube over to, add 100 μ l polysaccharide removers (Beijing CHMC ocean bio tech ltd), add 200 μ l chloroforms behind the mixing, abundant mixing, 4 the degree 12000 rev/mins centrifugal 10 minutes, supernatant is gone to new centrifuge tube;
3. add isopyknic Virahol, rearmounted-20 degree of mixing are more than 1 hour, and centrifugal 10 minutes of 12000 rev/mins of 4 degree are abandoned supernatant, and the centrifugal precipitation that obtains is dissolved in after drying in an amount of DEPC water with 75% washing with alcohol, obtains total RNA.
Use Ultrospec 3000 type ultraviolet spectrophotometers (Amersham Biosciences) to measure the RNA of extraction at 260nm(OD
260) and 280nm(OD
280) absorbance of wavelength to be to determine purity and the concentration of RNA.Up-to-standard RNA concentration should be more than 1 μ g/ μ l, OD
260/ OD
280Ratio between 1.8-2.0, and clear through the electrophoresis detection band, pollute without obvious degradation and DNA.
2, the structure in little RNA library
The total RNA of the cotton fiber that quality test is qualified is used for making up little RNA library.The RNA that the fiber sample of 5 different times extracts respectively gets 10 μ g, is respectively applied to make up little RNA library.The structure in little RNA library carries out according to Illumina Sample Preparation Protocol library constructing method, the high-flux sequence instrument HiSeq of a new generation of Illumina company 2000 order-checkings (Huada Gene Research Center, Beijing) are adopted in the library that builds, and obtain the little RNA sequence of high-quality 18-30nt.
3, the evaluation of new miRNA in the little RNA library
Foreign literature is to successful methods (the Jones-Rhoades M W of high-flux sequence data analysis before the reference, Bartel D P.Computational identification of plant miRNAs and their targets, including a stress-induced miRNA.Mol.Cell, 2004,14:787-799.), set up a cover computer analysis method be used for finding and identify in the sequencing data cotton miRNA(analysis process as shown in Figure 1).Original series in 5 little RNA libraries that 1. will obtain removes 3 ' joint by computer approach, and filters out the sequence of sequence length below 18nt, obtains so-called " totally " sequence library; 2. the sequence of " totally " and the middle miRNA mature sequence of announcing of miRNA database miRBase (19) (http://microrna.sanger.ac.uk/sequences/) of internal authority are carried out BLAST, thereby find which sequence comes from known miRNA, the sequence that known miRNA surpasses 2 mispairing enters next step analysis again; 4. will get rid of the sequence of conservative miRNA and carry out sequence alignment with other non-coding RNA database Rfam (10.1) again, thereby find which sequence comes from the non-coding RNAs such as rRNA, tRNA, snRNA and snoRNA, filter out these sequences, may contain new miRNA in the remaining sequence, be called potential miRNA sequence storehouse; 5. the sequence in the potential miRNA sequence storehouse and existing cotton database are carried out BLAST, database comprises the genome sequence of cotton EST (http://compbio.dfci.harvard.edu), cotton GSS (NCBI) and existing part Lei Mengdeshi cotton (Gossypium raimondii).Sequence corresponding in the cotton database that finds is carried out next step analysis.6. use miRNA front body structure forecasting software mireap 0.2 (http://sourceforge.net/projects/mireap), to there being sequence corresponding to little RNA to carry out secondary structure analysis in the cotton database that obtains, if the good loop-stem structure that can form similar miRNA precursor (pre-miRNA) then this sequence can think candidate's new miRNA; 7. candidate's new miRNA proceeded screening, the little RNA distribution characteristics of the loop-stem structure precursor at investigation candidate's new miRNA sequence place, if mainly be distributed in candidate's new miRNA zone and corresponding miRNA* zone, think that then this candidate's new miRNA sequence height is credible, real miRNA sequence (Meyers B C, Axtell M J, Bartel B, Bartel D P, Baulcombe D, Bowman J L, Cao X, Carington J C, Chen X, Green P J, et al.Criteria for annotation of plant microRNAs.Plant Cell, 2008,20:3186-3190.).
Identify 1 new miRNA, called after GhmiRnE.
The sequence of GhmiRnE following (5 ' → 3 '): UUGGUAUGGAGGAUGGAAAAG(sequence 1).
After blooming 5,10,15,20 and 25 days 5 independently can characterization in the little RNA of the cotton fiber library to the GhmiRnE sequence, the order-checking number is respectively 187,645,516,332 and 33(number in per 1,000 ten thousand order-checking number after normalized).The results are shown in Figure 2.
The secondary loop-stem structure of miRNA precursor (pre-miRNA) sequence is one of outstanding feature of miRNA gene, also is all impassable important rule of all miRNA authentication methods.
GhmiRnE precursor (pre-GhmiRnE) sequence following (5 ' → 3 '): the sequence 2 of AAGCCUUGCUUUGGUAUGGAGGAUGGAAAAGAGUGAAGAUGGAAAAUUUAUUAAUC AAAAGGCCAAGAUUCACAAUCACUUUCCUACUUUGUAACUUAACCAUUAGAUUGAC AAAUUUUCUAUCCUACCUCUUUUCCAUCCUUCGUACCAAACAAAGCUUA(sequence table).
Pre-GhmiRnE can form good loop-stem structure, and ripe miRNA produces from the stem of miRNA precursor, meets constitutional features (Fig. 3, the position at the ripe miRNA of red part (left side intensification) indication place of miRNA precursor fully.）。
Target gene prediction and the checking of embodiment 2, miRNA
Because Mirnas of plant and target gene mRNA are close to complete complementary, therefore can predict by bioinformatics method the target gene of GhmiRnE.Adopt online software psRNATarget (http://plantgrn.noble.org/psRNATarget/) in cotton est database CGI11, to search out cDNA or the gene that can be close to miRNA sequence complete complementary, be the target of miRNA; Parameter is set to: the psRNATarget program parameter is default setting, and the function of target is by NCBI (http://www.ncbi.nlm.nih.gov/) homology search, and the known function gene the highest with homology carries out note.
Predict the outcome and see Table 1.
Target gene and the function of table 1GhmiRnE
The target gene of GhmiRnE is that acetyl-CoA carboxylase β subunit (ACCD) gene TC229767(gene order is the sequence 4 of sequence table, its encoding gene is that sequence 4 is from 5 ' terminal 708-2201 position Nucleotide in the sequence table, and the albumen of its coding is seen the sequence 3 of sequence table).It is synthetic that this genoid can be regulated fatty acid biological, promote the elongation of cotton fiber and developmental regulation (the Peng L that secondary wall thickens, Kawagoe Y, Hogan P, Delmer be as primer for cellulose synthesis in plants.Science 295:147-150. D.2002.Sitosterol-beta-glucoside; Sasaki Y, Nagano is acetyl-CoA carboxylase:structure Y.2004.Plant, biosynthesis, regulation, and gene manipulation for plant breeding.Biosci Biotechnol Biochem 68:1175-1184.; Gou JY, Wang LJ, Chen SP, Hu WL, Chen XY.2007.Gene expression and metabolite profiles of cotton fiber during cell elongation and secondary cell wall synthesis.Cell Res 17:422-434.).
Embodiment 3, miRNA are to the cutting of target gene mRNA
GhmiRnE sees the sequence 4 of sequence table to target gene TC229767() cutting of mRNA verifies (Jones-Rhoades M W with 5 ' RACE method, Bartel D P.Computational identification of plant miRNAs and their targets, including a stress-induced miRNA.Mol.Cell, 2004,14:787-799.).After target gene mRNA was cut by miRNA, its comparatively stable 3 ' cleaved products, 5 ' terminal nucleotide phosphate group exposed, with T4 RNA ligase enzyme 5 ' RACE special joint on this cleaved products 5 ' end connects; By the synthetic cDNA of reverse transcription reaction; By the special nido outer primer of target gene and test kit with the nido outer primer carry out first round PCR, the nido inner primer that target gene is special and test kit with the nido inner primer carry out second and take turns PCR; The PCR product that 5 ' RACE is obtained is connected to the rear order-checking of pMD 19-T carrier (TaKaRa), just can know accurate target gene mRNA cleavage site.
1, extracts respectively total RNA of various cotton fiber samples of the step 1 preparation of embodiment 1.
2, carry out 5 ' RACE by Firstchoice RLM-RACE test kit (Ambion) operation instructions, the sequence of the nido outer primer that target gene is special is: ACCTTTTTCGTAAAATCTCGTCTA, the sequence of the nido inner primer that target gene is special is: GGATGGGTAGAAGAAGTTGTGATGCT.
3, obtain 90bp PCR product and carry out agarose electrophoresis, reclaim specific band.
4, the PCR product that reclaims is connected to pMD 19-T carrier (TaKaRa), and transforms bacillus coli DH 5 alpha.
5, choose the mono-clonal order-checking, determine the cleavage site of target gene mRNA according to sequencing result.
The cleavage site that sequencing result shows is seen Fig. 4.Cutting has occured in the zone with its complementation in the target gene of GhmiRnE, and the strong TC229767 that proved of this result is the target gene of real regulation and control in the GhmiRnE body really.
The expression analysis of embodiment 4, target gene
In order further to investigate the function of GhmiRnE, with the expression in real-time quantitative RT-PCR detect respectively target gene TC229767 after blooming 5,10,15,20 and 25 days the cotton fiber.
1, extracts respectively total RNA of each cotton fiber sample of the step 1 preparation of embodiment 1.
2, total RNA adds DNase I (TaKaRa), and room temperature is placed 30min to remove the pollution of genomic dna.
3, behind the adding stop buffer (50mM EDTA), 70 ℃ of heating 10min are with sex change DNase I and RNA.
4, adopt TaKaRa RNA PCR Kit, with the synthetic cDNA template of RNA, operation is undertaken by the test kit specification sheets.
5, adopt Power SYBR Green PCR Master Mix (Applied Biosystems) at the enterprising performing PCR amplified reaction of iCycler iQ5 Multicolor real-time quantitative PCR detector (Bio-Rad), by comparing CT value method (Δ Δ CT value method) (Schmittgen T D.Real-Time Quantitative PCR.Methods, 2001,25:383-385.) calculate the relative expression quantity (expression amount of control group gene be set as 1) of target gene in different samples.The detection of target gene arranges 3 repetitions, results averaged.With cotton UBQ10 gene as confidential reference items (Walford S A., Wu Y R., Llewellyn D J and Dennis E S. (2011) GhMYB25-like:a key factor in early cotton fibre development.Plant J, 65 (5), 785-97).
The primer of amplified target gene TC229767 following (5 ' → 3 '):
Upstream primer: AATAAAAGACTAAACACAACTC;
Downstream primer: GCCAAAAGGACAACATACAGGA.
Amplification UBQ10 gene primer following (5 ' → 3 '):
Upstream primer: CCAGAAGGAATCCACTTTGC;
Downstream primer: CCAGCTCACATCAGCATACG.
The results are shown in Figure 5, obvious variation has occured in Fibre Development Expression In The Process amount in target gene TC229767, by check order in 5 the little RNA storehouses expression (Fig. 2) of number compares with GhmiRnE, find that the expression of TC229767 and the expression of GhmiRnE present negative correlation, GhmiRnE expresses the trend that mainly is obvious rise in 5 days to 15 days the fiber after blooming, and the expression amount of TC229767 presents the trend of obvious downward modulation; 15 days to 20 days, GhmiRnE presented the trend of downward modulation, and the TC229767 expression amount raises; This and miRNA are on all four to the negative regulation effect of target gene, and after 20 days, secondary wall is initial, and it is synthetic that the metabolism in the cotton fiber cell flows to Mierocrystalline cellulose, and miRNA and TC229676 descend simultaneously.The result of real-time quantitative PCR has proved that further TC229767 is the target gene of GhmiRnE really.
Claims (7)
1. the RNA shown in the sequence 1 of sequence table.
2. the RNA shown in the sequence 2 of sequence table.
3. claim 1 or the 2 described RNA application in suppressing the expression of acetyl-CoA carboxylase beta subunit gene; The aminoacid sequence of described acetyl-CoA carboxylase β subunit is the sequence 3 of sequence table.
4. application as claimed in claim 3 is characterized in that: the nucleotides sequence of described acetyl-CoA carboxylase beta subunit gene is classified in the sequence 4 of sequence table or the sequence table sequence 4 as from 5 ' terminal 708-2201 position Nucleotide.
5. claim 1 or the 2 described RNA application in the mRNA degraded that promotes the acetyl-CoA carboxylase beta subunit gene; The aminoacid sequence of described acetyl-CoA carboxylase β subunit is the sequence 3 of sequence table.
6. application as claimed in claim 5 is characterized in that: the nucleotides sequence of described acetyl-CoA carboxylase beta subunit gene is classified in the sequence 4 of sequence table or the sequence table sequence 4 as from 5 ' terminal 708-2201 position Nucleotide;
The mRNA of described promotion acetyl-CoA carboxylase beta subunit gene is degraded to the mRNA of cutting acetyl-CoA carboxylase beta subunit gene.
7. claim 1 or the 2 described RNA application in the cotton fiber quality improvement.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210398840.9A CN102899326B (en) | 2012-10-19 | 2012-10-19 | MiRNA-GhmiRnE coming from cotton and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210398840.9A CN102899326B (en) | 2012-10-19 | 2012-10-19 | MiRNA-GhmiRnE coming from cotton and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102899326A true CN102899326A (en) | 2013-01-30 |
| CN102899326B CN102899326B (en) | 2015-01-14 |
Family
ID=47571815
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210398840.9A Expired - Fee Related CN102899326B (en) | 2012-10-19 | 2012-10-19 | MiRNA-GhmiRnE coming from cotton and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102899326B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105039337A (en) * | 2015-08-31 | 2015-11-11 | 安徽农业大学 | 5'RACE RNA adapter sequence and kit for amplifying terminal of miRNA sheared target gene cDNA 5' |
| CN108154009A (en) * | 2017-12-26 | 2018-06-12 | 重庆佰诺吉生物科技有限公司 | A kind of tiny RNA sequencing data expression quantity computational methods |
-
2012
- 2012-10-19 CN CN201210398840.9A patent/CN102899326B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| MINGXION PANG ET.AL: "Geome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum l.)", <GENOME BILOLGY> * |
| QIN LI ET.AL: "Identification and analyses of mirna genes in allotetraploid gossypium hirsutum fiber cells based on the sequenced diploid G. raimondii genome.", <JOURNAL OF GENETICS AND GENOMICS> * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105039337A (en) * | 2015-08-31 | 2015-11-11 | 安徽农业大学 | 5'RACE RNA adapter sequence and kit for amplifying terminal of miRNA sheared target gene cDNA 5' |
| CN108154009A (en) * | 2017-12-26 | 2018-06-12 | 重庆佰诺吉生物科技有限公司 | A kind of tiny RNA sequencing data expression quantity computational methods |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102899326B (en) | 2015-01-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Identification of miRNAs and their target genes in developing maize ears by combined small RNA and degradome sequencing | |
| Zhang et al. | Sequencing of allotetraploid cotton (Gossypium hirsutum L. acc. TM-1) provides a resource for fiber improvement | |
| Zhang et al. | Genome-wide identification of conserved microRNA and their response to drought stress in Dongxiang wild rice (Oryza rufipogon Griff.) | |
| Zhang et al. | Identification of miRNAs and their target genes using deep sequencing and degradome analysis in trifoliate orange [Poncirus trifoliate (L.) Raf] | |
| Xue et al. | Genome-wide analysis of small RNAs reveals eight fiber elongation-related and 257 novel microRNAs in elongating cotton fiber cells | |
| Kim et al. | Identification and profiling of novel microRNAs in the Brassica rapa genome based on small RNA deep sequencing | |
| Wang et al. | Genome-wide identification and characterization of novel lncRNAs in Ginkgo biloba | |
| Xu et al. | Transcriptome-wide identification and characterization of microRNAs from castor bean (Ricinus communis L.) | |
| CN102277357A (en) | miRNA (Micro Ribonucleic Acid)-GhmiR156 from cotton and application thereof | |
| Dhaka et al. | Small RNA profiling from meiotic and post-meiotic anthers reveals prospective miRNA-target modules for engineering male fertility in sorghum | |
| Wu et al. | Comparative analysis of miRNAs and their target transcripts between a spontaneous late-ripening sweet orange mutant and its wild-type using small RNA and degradome sequencing | |
| Sun et al. | Advances in identification and validation of plant microRNAs and their target genes | |
| Fang et al. | Identification of differentially expressed microRNAs from a male sterile Ponkan mandarin (Citrus reticulata Blanco) and its fertile wild type by small RNA and degradome sequencing | |
| Cao et al. | Drought stress-induced changes of microRNAs in diploid and autotetraploid Paulownia tomentosa | |
| CN103361346A (en) | Method for cloning and analyzing populus diversifolia micro RNAs (ribonucleic acids) precursor | |
| CN102899326B (en) | MiRNA-GhmiRnE coming from cotton and application thereof | |
| CN102925442B (en) | Cotton-derived miRNA (microribonucleic acid)-GhmiRnC and application thereof | |
| Chen et al. | Genetic variants in micro RNA biogenesis genes as novel indicators for secondary growth in Populus | |
| CN101565701A (en) | Two new microRNA genes in cotton fiber growth and application | |
| Liu et al. | A comparative analysis of small RNAs between two Upland cotton backcross inbred lines with different fiber length: Expression and distribution | |
| Qin et al. | MicroRNA profile of silk gland reveals different silk yields of three silkworm strains | |
| Miao et al. | Genome-wide identification and characterization of microRNAs differentially expressed in fibers in a cotton phytochrome A1 RNAi line | |
| Meng et al. | Gene expression analysis revealed Hbr-miR396b as a key piece participating in reaction wood formation of Hevea brasiliensis (rubber tree) | |
| CN101892232B (en) | miRNA-n3 derived from rice and application thereof | |
| Sun et al. | Genome-wide analysis of miRNAs in Carya cathayensis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150114 Termination date: 20151019 |
|
| EXPY | Termination of patent right or utility model |