CN101565701A - Two new microRNA genes in cotton fiber growth and application - Google Patents

Abstract

MicroRNAs (miRNAs) are a class of new discovered endogenic micromolecule RNA of which non-coding length is about 21nt. The microRNAs can be complemented and combined with a specific target gene mRNA, and the expression of genes is adjusted by causing degradation or translational suppression of the target gene. The invention establishes two micromolecule RNA libraries of cotton wild type ovule (Xuzhou-142) and fuzzless-lintless fiber mutant ovule (bare seed, Xuzhou 142 fuzzless-lintless) thereof, adopts current international most-advanced high-throughput order checking technology (Solexa) to obtain two unknown miRNAs genes which are temporarily named as ghr-MIR3 and ghr-MIR9, and researches different expression abundances of the miRNAs genes in the initial growth process of cotton fibers. Twelve target genes are predicted through information biology, wherein the ghr-MIR3 target gene codes chloroplast omega 3-fatty acid desaturase, while the ghr-MIR9 target gene codes alcohol dehydrogenase. The research result is not yet reported so far; and gene engineering measures and methods lay a foundation for deeply researching, adjusting and controlling the growth of the cotton fibers and improving the quality of the fibers.

Description

Two new microRNA gene and purposes in the cotton fiber development

One, technical field

The present invention relates to grow clone, evaluation and the purposes of relevant two unknown miRNA (ghr-MIR3 and ghr-MIR9) gene with upland cotton fiber.Set up two microRNA libraries of wild-type (WT) and lint-free nothing wadding fiber mutant (M), adopted the present world state-of-the-art high-flux sequence row technology, obtained above-mentioned two new miRNA gene orders.Further analyzed two target genes of this miRNA, encode respectively chloroplast(id) omega 3-fatty acid desaturation enzyme and ethanol dehydrogenase, both distinguish the elongation growth of controlling fiber and the formation and the thickening of cell walls.The invention belongs to biological technical field.If as goal gene cotton is carried out deep functional study with this miRNA and target gene thereof, can improve the quality of cotton fibre to a certain extent effectively, have certain economic and social benefit.

Two, background technology

MicroRNAs (miRNAs) is the strand microRNA that the newfound non-coding of a class, length are about 21nt.Studies show that in a large number in recent years, miRNA grows in coordinate plant growth, cell increment, coerces in the process such as response and plays an important role.Cotton is a kind of important cash crop, and its fiber is the main source of natural textile materials.China is maximum in the world Cotton Production and country of consumption, also is an important cotton trading country, and therefore, cotton has critical role (http://www.emergingtextiles.com) as economic conduct especially in China.The development mechanism of cotton fiber becomes the focus that receives much concern, because being related to, it how to improve production of cotton fibers (improving the quantity of unit surface cotton fibre elongation), the fibres modified quality, and all these are and textile industry and the closely-related realistic problem of the people's livelihood.

Along with the development of modern molecular biology technique, except utilizing the conventional breeding means, progressively use genetic engineering technique that cotton fibre quality is carried out genetic improvement both at home and abroad.Utilize genetically engineered fibres modified quality to depend on understanding to fiber development related gene and controlling element thereof.Therefore, carry out separation, functional gene that evaluation is relevant with cotton fiber development is to cultivate the high quality cotton fibre new species, realizes the important foundation of breeding theory and gordian technique new breakthrough, also is the crucial behave that promotes Cotton in China breeding original innovation power.

Our laboratory in 2007 takes the lead in having excavated 37miRNA in existing cotton gene group.This also is to excavate maximum miRNA both at home and abroad up to now from vegetable lamb.These important miRNA gene pairs regulation and control cotton growths and fiber are grown and are had important biological significance and potential production exploitation value.There are thousands of though known the gene relevant at present, these expression of gene mechanism and network regulation are known little about it with cotton fiber development.Therefore, press for existing characteristic cotton resource to China, fully excavate and develop new miRNA (comprising other sRNA) gene that belongs to national intellecture property by extensive cloning process, for later stage orderly improvement and the cotton germplasm of cultivating the high-quality proterties lay the foundation.

Two new miRNA that this patent is cloned into come from the upland cotton kind, and only in mutant, express, show that these two miRNA do not express in wild-type, so their cuttings after can not transcribing the transcription product mRNA of chloroplast(id) omega-3-fatty acid desaturase and alcohol dehydrogenase gene suppress.Omega-3-fatty acid desaturase catalysis fatty acid desaturation in plant generates triethenoid fatty acid, and the latter plays an important role to keeping function of plasma membrane.The more important thing is that triethenoid fatty acid is a jasmonic synthetic precursor, and jasmonic pair cell wall be formed with regulating effect.Ethanol dehydrogenase is the hinge of substrate catalysis xylogen with numerous metabolites in cell walls, forms the composition of cell walls.Therefore, both may be to the synthetic important influence of fiber finer cell wall.

In fact, fatty acid desaturation enzyme and ethanol dehydrogenase are multifunctional enzymes, and these two kinds of enzyme involved in plant are to damaging to plants caused by sudden drop in temperature the adjusting of coercing reaction, and transgenation causes plant to cold coerce extremely sensitive.Both may bloom vegetable lamb and weave silk the later stage because growth is stretched in the low life of regulating cotton fibre of temperature.But the concrete function of above-mentioned two target genes in the adjusting cotton fiber is synthetic is not clear.Therefore, regulatory function systematic study fatty acid desaturation enzyme and the effect of ethanol dehydrogenase in cotton fiber development by research miRNA has important biological significance and potential using value.

Three, summary of the invention

Technical problem the objective of the invention is to clone two important miRNA (ghr-MIR3 and ghr-MIR9) in the upland cotton fiber growth course, analyze and identified secondary structure, analyze simultaneously and obtained two target genes, chloroplast(id) omega-3-fatty acid desaturase and alcohol dehydrogenase gene, they have participated in the synthetic of cell walls in the cotton fiber development process analysis revealed.Based on this gene, change the quality characteristic of present cotton fibre by engineered method, obtain certain economic and social benefit, for the quality breeding of cotton provides genetic resources, improve the fibrous quality of Cotton in China kind as early as possible.

Technical scheme

Upland cotton pre-ghr-MIR3 (genetic expression precursor), length is 205bp, sequence is as follows:

AACTAATCCTTGTACATTAGATCAAAGAGCAAACTTATCATTTCTATTAAAAACTAACGTGATTGATGGA

TTAACCAGACAGTTACACGTAGCGTGCCACATGTATCTCATTTGAGAGGTAGGCACAAGTTTTTAGCAA

TAGAAATAGATGGGATTTCAACAGAAGGACCAATTTGCTCTTTGATCTAGTATACAATGACTAATT

Upland cotton pre-ghr-MIR9 (genetic expression precursor), length is 296bp, sequence is as follows:

TTCTTCTCTTTAGATTCATTGGCTGAGTTAAAACAGCAGCACAAATTTCGGGGTCAAGAATTTTATATG

CAGGTGAAAAAACCACTTTTAACTTAAAAATATTCTTTTTCCGCAAAAATACCGGAAAACGCTAGTGT

TTTAAAGTTAAATATGCGATTAAAAAAACCTTTCTACCCAAATATTGAGAAGTTGGTTAAAAGAATTTT

AAACTCGACATCGAGTCAAAGTCATCGAGTTTAAGACCTAAAACCAAATATCTGAATATTAACTCAGCT

AATGAATCAAAAGAGAAGAAA

1. according to Illumina Sample Preparation Protocol library constructing method, made up upland cotton Xuzhou-142 (WT) and Xuzhou-142 light seed mutant (M) bloom the back (0,1,2,3,4,5,6,8,10 days, DPA) two libraries of ovule cDNA.

2. picking clone from the library transforms, and the high-quality length that analysis is obtained is that the RNA of 18-30nt carries out high-flux sequence.According to sequencing result, further carry out the BLAST compare of analysis, screening meets the sequence of miRNA standard.Information biology is predicted its target gene.Beneficial effect

1. mRNA clonal analysis technical efficiency commonly used at present is low, insensitive, and some is expressed the low basic survey of microRNA of abundance and does not come out.

State-of-the-art in the world at present extensive high-flux sequence is adopted in this research, and its advantage is:

(1) highly sensitive, the accuracy height can be measured a microRNA, the base accuracy rate height of the RNA molecule of mensuration;

(2) high-throughput, scale are big, can measure all genomic transcriptons.The order-checking amount in two libraries is forgiven all microRNA sequences up to 1,300,000 more than the base sequence;

(3) measure the expression abundance of microRNA simultaneously, so can compare the difference of small molecules rna expression spectrum in two gene libraries.

2. the present invention two miRNA (ghr-MIR3 and ghr-MIR9) of being cloned into regulate and control the target gene of chloroplast(id) omega-3-fatty acid desaturase and ethanol dehydrogenase respectively, the latter there are some researches show the synthetic of participation cell walls, promptly relevant with the thickening of cell walls, and the thickness of cell walls and fibre strength have substantial connection., as target gene cotton is transformed in theory and can directly improve its intensity effectively with this gene, break the negative correlation of yield and quality, obtain high-quality cotton, bring considerable economic and social benefits.

3. present genetically modified foreign gene major part derives from microorganism, and these class genetically modified crops are strict to safety evaluation.The gene source of this patent report imports cotton again and does not have the safety evaluation problem in cotton.Simultaneously, at home and abroad the patent of application is very few at present for relevant with cotton fiber development miRNA gene.

4. pass through the function prediction and the analysis of this gene, show that above-mentioned two target genes participate in the cotton fiber development process, by agrobacterium-mediated transformation this gene is imported cotton, make its overexpression, the transfer-gen plant that obtains will the cotton fibre elongation or and thickening phase great expression, obtain certain economic and social benefit,, improve the fibrous quality of Cotton in China kind as early as possible for the quality breeding of cotton provides genetic resources.

Four, description of drawings

Fig. 1 .ghr-MIR3 and ghr-MIR9 precursor secondary structure figure.MiRNA clones from lint-free nothing wadding fiber mutant and obtains, and has higher relative expression's abundance.Structure is identified and is shown that ripe miRNA segment is positioned at 5 ' end (The Scarlet Letter black line part).

Five, Fa Ming specific embodiment

1. cotton ovule collection: cotton planting ground is experimental plot, academy of agricultural sciences, Jiangsu Province, and list flowering period.Liquid nitrogen freezing immediately after ovule is gathered ,-80 ℃ of refrigerators are preserved, and are standby.

2. according to Illumina SamplePreparationProtocol library constructing method, made up upland cotton Xuzhou-142 (WT) and Xuzhou-142 light seed mutant (M) and bloomed back 0,1,2,3,4,5, two libraries of 6,8,10 days (DPA) ovule mixing cDNA.

3. picking clone from the library carries out isolation identification, and the high-quality length that analysis is obtained is that the RNA of 18-30nt carries out high-flux sequence.According to sequencing result, further carry out the BLAST compare of analysis, screening meets the sequence of miRNA standard.Information biology is predicted its target gene.

SEQUENCE?LISTING

＜110〉Agricultural University Of Nanjing

＜120〉two new microRNA gene and purposes in the cotton fiber development

＜130〉specification sheets

<160>2

<170>PatentIn?version?3.1

<210>1

<211>205

<212>DNA

<213>Gossypium?hirsutum

<220>

＜221〉ghr-MIR3 precursor-gene

<222>(1)..(205)

<223>

<400>1

aactaatcct?tgtacattag?atcaaagagc?aaacttatca?tttctattaa?aaactaacgt 60

gattgatgga?ttaaccagac?agttacacgt?agcgtgccac?atgtatctca?tttgagaggt 120

aggcacaagt?ttttagcaat?agaaatagat?gggatttcaa?cagaaggacc?aatttgctct 180

ttgatctagt?atacaatgac?taatt 205

<210>2

<211>296

<212>DNA

<213>Gossypium?hirsutum

<220>

＜221〉ghr-MIR9 precursor-gene

<222>(1)..(296)

<223>

<400>2

ttcttctctt?tagattcatt?ggctgagtta?aaacagcagc?acaaatttcg?gggtcaagaa 60

ttttatatgc?aggtgaaaaa?accactttta?acttaaaaat?attctttttc?cgcaaaaata 120

ccggaaaacg?ctagtgtttt?aaagttaaat?atgcgattaa?aaaaaccttt?ctacccaaat 180

attgagaagt?tggttaaaag?aattttaaac?tcgacatcga?gtcaaagtca?tcgagtttaa 240

gacctaaaac?caaatatctg?aatattaact?cagctaatga?atcaaaagag?aagaaa 296

Claims (3)

1. the ripe segment of two newfound miRNA genes (ghr-MIR3 and ghr-MIR9) is respectively 21 and 22 bases (table 1).

2. according to claim 1, these two miRNA genes are only expressed in mutant (M), and do not express (table 2) in wild-type (WT), show that these two miRNA gene pairs fibers growth functions have indispensable effect.

3. according to claim 1, predict 12 target genes (table 3) by information biology.

The ripe segment of the newfound miRNA of table 1. upland cotton (Gossypium hirsutum).M: mutant

MiRNA that table 2. upland cotton (Gossypium hirsutum) is new and expression abundance (Reads).5p and 3p refer to respectively ripe miRNA 5 ' and 3 ' end.WT: wild-type

The target gene of table 3.ghr-MIR3 and ghr-MIR9