CN101921845B - Molecular marker of liver fatty acid binding protein (L-FABP) as pork quality character and application thereof - Google Patents
Molecular marker of liver fatty acid binding protein (L-FABP) as pork quality character and application thereof Download PDFInfo
- Publication number
- CN101921845B CN101921845B CN 201010230086 CN201010230086A CN101921845B CN 101921845 B CN101921845 B CN 101921845B CN 201010230086 CN201010230086 CN 201010230086 CN 201010230086 A CN201010230086 A CN 201010230086A CN 101921845 B CN101921845 B CN 101921845B
- Authority
- CN
- China
- Prior art keywords
- fabp
- pig
- molecular marker
- fatty acid
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of animal genetic engineering and particularly relates to a molecular marker of liver fatty acid binding protein (L-FABP) as pork quality character and application thereof. The pork quality character relates to relevant characters such as inter-muscle fat content, eye muscle area, cooked ratio, drip loss, muscle fibre diameter and the like. The molecular marker of the invention is cloned from an L-FABP gene of a pig; a nucleotide sequence of the molecular marker is shown in SEQUENCE LISTING; at the 25th bp place (including a sub-place) of the SEQUENCE LISTING, base mutation of a T-C exists so that single strand conformation polymorphism is caused. The invention also discloses a primer for amplifying DNA sequence of L-FABP gene part and a polymorphism detection method, thereby providing a novel molecular marker for marker-assisted selection of the pig.
Description
Technical field
The invention belongs to animal gene engineering technology field, relate to the application of pig flesh characters candidate gene in marker assisted selection, specifically a kind of liver fatty acid binding protein (L-FABP) gene is as molecule marker and the application in pig flesh characters.
Background technology
[the Ockner such as Ocker of California, USA university in 1972, R.K., J.A.Manning, R.B.Poppenhanusen, and W.K.Ho.A binding protein for fatty acids in cvtosol of intestinal mucosa, liver, myocardium and other tissue.Science, 1972,177:56-58.] found fatty acid binding protein (Fatty Acid-Binding Proteins, FABPs) at the small intestinal mucosa of rat, it extensively is present in mammiferous small intestine, liver, the heart, in the various kinds of cell of brain and skeletal muscle, and rich content accounts for the 3%-8% of total soluble protein in the cell.FABPs generally contains 126-137 amino acid, shows simultaneously the homology of 38%-70% aminoacid sequence.[the Hanhoff T such as Hanhoff in 2002, Lucke C, Spener F.Insights into binding of fatty acids by fatty acid binding proteins.Mol.Cell Biochem, 2002,239 (1-2): 45-54] study and find that FABPs has nine kinds of tissue-specific types, respectively liver fatty acid binding protein (Liver FABP, L-FABP), visible peristalsis visible intestinal peristalsis fatty acid binding protein (Intestinal FABP, I-FABP), H-FABP (Heart FABP, H-FABP), adipocyte type fatty acid binding protein (Adipocyte FABP, A-FABP), epidermis type fatty acid binding protein (Epidermal FABP, E-FABP), ileum type fatty acid binding protein (Ileal FABP, I1-FABP), brain type fatty acid binding protein (Brain FABP, B-FABP), myelin type fatty acid binding protein (Myelin FABP, M-FABP) and testis type fatty acid binding protein (Testis FABP, T-FABP).
L-FABP expresses in mammiferous liver and small intestine, a small amount of expression is also arranged in people's kidney, Hera etc. (2003) [Hera GM, Chinaga CC, Cheb WY, Wu JL.In vivo studies of liver-type fatty acid binding protein (L-FABP) gene expression in liver of transgenic zerbrafish.Elsevier Science BV 2003; 13:125-133] and (2004) [the Gertow K such as Gertow, Bellanda M, Eriksson P, et al.Genetic and structural evaluation of fatty acid transport protein-4 in relation to markers of the insulin resistance syndrome.J Clin Endocrinol Metab, 2004,89:392-399] research finds L-FABP by longer chain fatty acid and very-long-chain fatty acid absorbs and transhipment is necessary.[the Newbeny EP such as Newbeny in 2003, Xie Y, Kennedy S, et al.Decreased hepatic triglyceride accumulation and altered fatty aciduptake in mice with deletion of the liver fatty acid binding protein.J Biol Chem2003,278:51664-51672.] find the rat of L-FABP gene knockout, its lipid acid transhipment obviously reduces.
Jiang Yanzhi [JIANG Yan-Zhi, LI Xue-Wei, YANG Guang-Xi.Sequence Characterization, Tissue-specific Expression and Polymorphism of the Porcine (Sus scrofa) Liver-type Fatty Acid Binding Protein Gene.Acta Genetica Sinica.2006,33 (7): 598-606] etc. utilize the terminal rapid amplifying (RACE) of cDNA and round pcr, be cloned into full length cDNA sequence 518bp (the GenBank accession number: AY960623) and portion gene group sequence (GehBank accession number: DQ182323) of pig liver type fatty acid-binding protein gene (L-FABP).Pig L-FABP gene is the same with other FABPs genes, formed by 4 exons (67bp, 173bp, 93bp and 51bp) and 3 introns, introne 1 and 3 size are 1679 decorations and 565bP, do not obtain the sequence of intron 2, and exon and intron montage place meet the GT/AG rule.Analyze also and find, clone the coding region nucleotide sequence that obtains and there is certain variation in the coding region nucleotide sequence of known pig L-FABP gene, be respectively T → C in the exon 2 (116), C → T (231), C → A (236) and A → C (258), deduce into amino acid and there are differences at Leu74Met.For further confirming these mutational sites necessary being in swinery, utilize the PCR-SSCP detection method exon 2 complete sequence of 157 individualities of 4 pig kinds (hiding pig, Dahe Pig, Persia nanmu pig and Yorkshire) to be carried out the genotyping of SNP loci polymorphism fragment, found that the single nucleotide polymorphism of a C → T, there is extremely significant difference in gene frequency between Chinese native pig breed (hiding pig, Dahe Pig, Persia nanmu pig) and external Yorkshire kind.Linkage analysis finds that the intramuscular fat content of genotype CC (4.86 ± 0.22%) is higher than the intramuscular fat content of genotype CT (4.16 ± 0.22%) and TT (4.05 ± 0.27%) significantly.Therefore, infer the L-FABP gene may be affect the pig intramuscular fat content major gene or with the closely linked marker gene of major gene, and can be for the genetic improvement to the pig intramuscular fat content in molecular marker assisted selection.
Summary of the invention
The purpose of this invention is to provide a kind of liver fatty acid binding protein (L-FABP) gene as the molecule marker of pig flesh characters.The invention reside in and obtain the L-FABP Gene Partial fragment relevant with pig flesh characters, and this fragment is carried out polymorphism analysis, for the marker assisted selection of pig provides molecule marker.
Another object of the present invention provides the PCR-SSCP detection method of identifying as the L-FABP gene of pig molecule mark.
The 3rd purpose of the present invention provides the application of related molecule marker in the pig flesh characters association analysis.
The present invention is achieved through the following technical solutions.
Pig liver type fatty acid-binding protein gene (L-FABP) fragment that a kind of clone obtains, its nucleotide sequence such as table 1:
Table 1 pig liver type fatty acid-binding protein gene (L-FABP) cloned sequence
CCCCTCAGCCTCCAATGCCTTTCA
CAGGTCTGCCCGACGAACACATCCAGAAGGGGAAGGACATCAAGGGGACATCGGAAATCGTGCAGAATGGGAAGCACTTCAAGTTGACCATCACTACCGGGTCCAAGGTCGTCCAGAATGAGTTCACCTTGGGAGAGGAGTGTGAGATGGAGACCCTGACTGGGGAGAAGGTCAAG
Wherein,
Two of the mutational site kinds of mononucleotides in the sequence fragment for this reason only exist in this sequence that T or C's is a kind of.
The nucleotide sequence length of the L-FABP gene fragment that obtains is 201bp, is the part of introne 1 and exon 2.
The 25th bit base place of sequence table 1 has a base mutation, causes the generation of single strand conformation polymorphism (single-strand conformation polymorphism).As a molecule marker, the method by PCR-SSCP detects this mutational site, and detected result is associated with pig flesh characters with this mutational site, for the seed selection and breeding of pig provides experiment basis and theoretical foundation.
Molecular marker identification method of the present invention and proterties association analysis process are as shown in figure 11.
Molecular marker identification method of the present invention, realize by following step:
One, the acquisition of pig L-FABP gene purpose fragment
1. collection pig blood
Carry out blood collection when live body or meat quality determination.For in subsequent experimental, being convenient to from blood, to extract genomic dna, should using EDTA anticoagulation method to process, and not use the heparin anti-coagulating method.
2. from pig blood, extract genomic dna and electrophoresis detection
After EDTA anticoagulation method is processed, use the AxyPrepTM Multisourse Genomic DNA Miniprep Kit test kit of AXYGEN company to extract genomic dna the blood that gathers.Concrete operation step is as follows: pig frozen blood specimen chamber temperature is melted, with operating scissors it is shredded; Add 350 μ l Buffer PBS and 0.9 μ lRNaseA; Collect the blood sample tissue that 350 μ l shred and change the 2ml centrifuge tube over to; Such as volume less than 350 μ l, replenish PBS to 350 μ l; Add 150 μ lBuffer C-L and 20 μ l Proteinase K, whirlpool concussion 1min mixes immediately, of short duration centrifugal after, centrifuge tube is put 56 ℃ of water-bath 10min; Add 350 μ l Buffer P-D, whirlpool concussion 30s mixes the centrifugal 10min of 12000 * g; DNA is prepared pipe place the 2ml centrifuge tube, then mixed solution is moved in the preparation pipe the centrifugal 1min of 12000 * g; Abandon filtrate, the preparation pipe is put got back in the original 2ml centrifuge tube, add 500 μ l Buffer W1, the centrifugal 1min of 12000 * g; Abandon filtrate, the preparation pipe is put got back in the original 2ml centrifuge tube, add 700 μ l Buffer W2, the centrifugal 1min of 12000 * g with same method, washs once with 700 μ l Buffer W2 again; Abandon filtrate, the preparation pipe is put got back in the original 2ml centrifuge tube the centrifugal 1min of 12000 * g; DNA is prepared pipe place another clean 1.5ml centrifuge tube, add 100-200 μ lEluent or deionized water in the film central authorities that prepare pipe, room temperature leaves standstill 1min, the centrifugal 1min eluted dna of 12000 * g.
Get 5 μ l DNA sample to be detected and 1 μ l sample-loading buffer mixes, be splined on 1.5% sepharose (containing 0.05%EB), simultaneously loading DL2000Marker.120V voltage electrophoresis 10min observes electrophoresis result under the ultraviolet lamp, and band is bright and clear, and without the traction phenomenon, illustrates that genome concentration and the quality extracted are better, can carry out next step experimental implementation, as shown in Figure 1.
3. go forward side by side performing PCR amplification of design Auele Specific Primer
Utilize software Oligo6.0 to design a pair of special primer, primer sequence upstream primer: 5 '-CCCCTCAGCCTCCAATGCCT-3 ', downstream primer: 5 '-CTTGACCTTCTCCCCAGTCA-3 ', expanding fragment length are 201bp, and primer is synthetic by Shanghai biotechnology company limited.PCR reaction totally is 50 μ l, 10 * reaction buffer, 5 μ l wherein, 2.5mmol/L dNTP 4 μ l, 1.0umol/L upstream primer and each 1 μ l of downstream primer, 1U Taq archaeal dna polymerase, 20-50 nanogram genomic dna heats up in a steamer water with four at last and complements to 50 μ l.
Cycling program is as follows: 95 ℃ of denaturation 5min, and 95 ℃ of sex change 30see, 59 ℃ of renaturation 45sec, 72 ℃ are extended 30sec, totally 35 circulations.After the circulation, 72 ℃ are extended 10min.After total overall reaction was finished, pcr amplification product detected with 1.5% agarose gel electrophoresis.
Two, set up PCR-SSCP detection method and identify the mutational site
The present invention detects the PCR product through 12% native polyacrylamide gel electrophoresis, the result detects three kinds of genotype: TT type, TC type and CC type, and as shown in Figure 3, swimming lane 3 and 6 is the TT type, swimming lane 1,2,5,7 is the TC type, swimming lane 4 is the CC type.Then the purpose fragment with two kinds of homozygote TT types and CC type is cloned on the pMD18-T carrier, then transforms recombinant plasmid, extracts plasmid and carries out the PCR evaluation, at last identifying checking order of correct plasmid.
Three, mark property is carried out association analysis
The present invention is by Meat Quality association analysis process, and pig part Meat Quality is carried out association analysis and predicts that corresponding gene type body portion divides the potentiality of meat proterties.Meat Quality association analysis process realizes by following step.
Use the General Linear Model process in SPSS 13.0 softwares, set up following Statistic analysis models and eliminate systemic effect and analyze the related of different genotype and part Meat Quality.
Statistic analysis models is: Y
i=μ+G
j+ e
iWherein, Y
iFor being observed individual Meat Quality phenotypic number, μ is the least square average of Meat Quality, G
jBe the effect value of genotype to Meat Quality, e
iBe the random residual corresponding to observed value.
Pleomorphism site and Meat Quality to pig the 1st intron carry out association analysis, and genotype detection result shows that TT type genotype has 48 in 156 individualities, and TC genotype individuality has 82, and CC type genotype individuality has 26.Analytical results is as shown in table 2, wherein, has different letter representation significant differences (P＜0.05) after same proterties least square average and the standard deviation, has different lowercase alphabet differential heteropoles significantly (P＜0.01).As shown in Table 2, C allelotrope is the favorable allels of pig flesh characters, CC genotype mark can be used as for the selective marker (molecule marker) that improves lipid content between pig marble grain and flesh, and to some proterties proposition predictors, the least square means standard deviation is same or different varieties pig flesh characters.This mutational site as a molecule marker, is identified by the method for PCR-SSCP in this mutational site, and qualification result is associated with pig flesh characters, for the seed selection and breeding of pig is provided fundamental basis.
The PCR-SSCP method of utilizing the present invention to set up can detect the pig L-FABP genotype of any kind and assess, and proposes the estimated value of part Meat Quality.
Effect of the present invention is as follows:
1. obtain pig L-FABP gene purpose fragment
Primer amplified pig genomic dna with the present invention's design obtains 201bp specific amplified fragment.Utilize round pcr that the purpose fragment is carried out amplification in vitro, amplified production detects through 1.5% agarose gel electrophoresis, and the result is shown as the specific PCR product, as shown in Figure 2.Sequencing result shows that there are two allelotrope of T, C in this polymorphic bands, then the purpose fragment with two kinds of homozygote TT types and CC type is cloned on the pMD18-T carrier, then transform recombinant plasmid, extract plasmid and carry out the PCR evaluation, identifying checking order of correct plasmid, order-checking peak figure as shown in Figure 4 at last.
2. set up pig L-FABP gene mononucleotide polymorphism PCR-SSCP diagnostic method
The purpose fragment of amplification is mixed with deionized formamide, and then 95 ℃ of sex change are unwind, and quenching snapback in frozen water makes it to become the single strand dna with certain space structure again; An amount of single stranded DNA is carried out native polyacrylamide gel electrophoresis; Dye by radioactive automatic developing, silver at last or ethidium bromide chromogenic assay result.The result can produce three kinds of genotype, i.e. TT type, TC type and CC type, and concrete genotype is as shown in Figure 3.
3. mark property is carried out association analysis
The present invention uses the General Linear Model process in the SPSS13.0 software, and the Meat Qualities of different genotype and 156 pigs is carried out correlation analysis, analyzes proterties and comprises the part Meat Quality.Analytical results sees Table 2, analytical results shows that this polymorphism has remarkably influenced (P＜0.05) to the pig marble grain that detects, and lipid content between flesh (IMF) is had utmost point remarkably influenced (P＜0.01), marble grain is that the CC type is significantly higher than TC type (P＜0.05), and the TC type is significantly higher than TT type (P＜0.05); IMF content is that CC type and the TC type utmost point are significantly higher than TT type (P＜0.01), and CC type and TC type difference not significantly (P＞0.05); The different genotype difference of other Meat Quality is remarkable (P＞0.05) not.
Table 2 part Meat Quality is in TT, TC and the genotypic least square mean value of CC and standard deviation
Description of drawings
Fig. 1 is that poba gene group DNA is through 1.0% agarose gel electrophoresis detected result.Wherein the M swimming lane is standard molecular weight Marker, and the 1-6 swimming lane is poba gene group DNA.
Fig. 2 is that the L-FABP gene amplification product is through 1.5% agarose gel electrophoresis detected result.Wherein the M swimming lane is standard molecular weight DL2000Marker, and the 1-7 swimming lane is 7 detected PCR products.
Fig. 3 is that the L-FABP gene amplification product is through 12% native polyacrylamide gel electrophoresis detected result figure.Swimming lane 3 and 6 is the TT type, swimming lane 1,2, and 5 and 7 is the TC type, swimming lane 4 is the CC type.
Fig. 4 is the L-FABP gene TT type that increases of the present invention and the cloning and sequencing peak figure of CC type dna sequence dna.
Fig. 5 is 1.5% sepharose detected result of pcr amplification product among the embodiment 1.Wherein the M swimming lane is standard molecular weight DL2000 Marker, and the 1-2 swimming lane is 2 detected PCR products.
Fig. 6 be among the embodiment 1 the L-FABP gene amplification product through 12% native polyacrylamide gel electrophoresis detected result figure.Swimming lane 1 is the TC type, and swimming lane 2 is the TT type.
Fig. 7 is 1.5% sepharose detected result of pcr amplification product among the embodiment 2.Wherein the M swimming lane is standard molecular weight DL2000 Marker, and the 1-2 swimming lane is 2 detected PCR products.
Fig. 8 be among the embodiment 2 the L-FABP gene amplification product through 12% native polyacrylamide gel electrophoresis detected result figure.Swimming lane 1 is the TC type, and swimming lane 2 is the CC type.
Fig. 9 is 1.5% sepharose detected result of pcr amplification product among the embodiment 3.Wherein the M swimming lane is standard molecular weight DL2000 Marker, and the 1-2 swimming lane is 2 detected PCR products.
Figure 10 be among the embodiment 3 the L-FABP gene amplification product through 12% native polyacrylamide gel electrophoresis detected result figure.Swimming lane 1 is the TT type, and swimming lane 2 is the TC type.
Figure 11 is molecular marker identification method of the present invention and proterties association analysis procedure chart.
Embodiment
In order more clearly to understand the present invention, describe particular content in detail with embodiment.
The L-FABP gene order that utilization of the present invention has been announced and the pig genomic dna that has extracted, the design Auele Specific Primer is a pair of, the about 201bp of a part of clone's introne 1 and exon 2, utilize the PCR-SSCP method to detect, with native polyacrylamide gel electrophoresis somatotype and different genotype is related with Meat Quality as a result, and to the prediction of the Part Traits of different genotype individuality, for the seed selection and breeding of pig is provided fundamental basis.
One, the clone of pig L-FABP gene purpose fragment
1 design of primers
Take pig L-FABP gene as reference, NCBI (National Center for Biotechnology Information, the American National biotechnology information center) number of including is DQ182323, utilizes 1 pair of Auele Specific Primer of Oligo6.0 software design.Primer sequence is as follows:
Upstream primer: 5 '-CCCCTCAGCCTCCAATGCCT-3 '
Downstream primer: 5 '-CTTGACCTTC TCCCCAGTCA-3 '
Amplified production length is 201bp, and primer is synthetic by Shanghai biotechnology company limited.
2PCR (polymerase chain reaction) system and amplification condition
PCR reaction totally is 50 μ l, 10 * reaction buffer, 5 μ l wherein, 2.5mmol/L dNTP 4 μ l, 1.0umol/L upstream primer and each 1 μ l of downstream primer, 1U Taq archaeal dna polymerase, 20-50 nanogram genomic dna heats up in a steamer water with four at last and complements to 50 μ l.
Cycling program is as follows: 95 ℃ of denaturation 5min, and 95 ℃ of sex change 30sec, 59 ℃ of renaturation 45sec, 72 ℃ are extended 30sec, totally 35 circulations.After the circulation, 72 ℃ are extended 10min.After total overall reaction was finished, pcr amplification product detected with 1.5% agarose gel electrophoresis, and electrophoresis detection result is shown as the specific PCR product, sees Fig. 1, and wherein the M swimming lane is standard molecular weight Marker DL2000, and the 1-7 swimming lane is 7 detected PCR products.
Two, the foundation of PCR-SSCP method
112% non-denaturing polyacrylamide gel is made and electrophoresis
At first clean sheet glass that glue uses and clean with distilled water flushing, after the oven dry, with the slit between 1% agarose closed glass plate and adhesive tape, static 30min replenishes 1% agarose again in order thoroughly gap sealing is needed at room temperature; In the 100ml beaker, add 30% acrylamide 12.0ml, 50% glycerine of 5.0ml, 5 * TBE 10.0ml, 10% ammonium persulphate, 350 μ l, TEMED 8 μ l add distilled water 13.0ml, rapid encapsulating after mixing; Fill with to stop encapsulating during along 1.0cm on sheet glass when glue, insert and continue encapsulating edge to the sheet glass behind the comb again, polymerized at room temperature 30min observes the gel polymerisation situation at any time, and adds acrylamide; After gel polymerisation is good, add 1 * TBE to electrophoresis chamber, use the irrigation with syringe well; At 4 ℃ of lower 130V prerunning 10min, prepare simultaneously point sample; Get 1 μ l PCR product and place the PCR pipe, add 5 μ l sex change Buffer, centrifugal mixing, 98 ℃ of sex change 10min; Ice bath 10min uses the microsyringe point sample rapidly; Opening power, 4 ℃ of lower 130V electrophoresis 14～16h.
2 cma stainings
Electrophoresis is shut electrophoresis apparatus after finishing, and emits electrophoresis liquid, carefully takes off gel, places 70% ethanol, and the water-bath oscillator slowly shakes up fixes 10～15min; Deionization washing glue 2 times, each 2min, flush away ethanol; With 200ml staining fluid dyeing 30min; Deionization washing glue 3 times, each 2min, the staining fluid that flush away is unnecessary; With 200ml nitrite ion colour developing, about 10～30min when the intensity of DNA band is suitable, outwells nitrite ion; Deionized water is washed unnecessary nitrite ion off, scanography or preservation.
There is the sudden change of T/C equipotential in this 25bp position to primer, thereby causes the generation of single strand conformation polymorphism (single-strand conformation polymorphism).When this site is the T base, be 2 bands through 12% native polyacrylamide gel electrophoresis detected result banding pattern, this 2 band lays respectively at the top and below; When this site is the C base, they also be 2 bands through 12% native polyacrylamide gel electrophoresis detected result banding pattern, but banding pattern is different during from the T base, the top when 1 pillar location is positioned at the T base below it; When heterozygote is to be 3 bands; As shown in Figure 3, wherein 3 and 6 swimming lanes are the TT type, and 1,2,5 and 7 swimming lanes are the TC type, and 4 swimming lanes are the CC type.
Three, the recovery of polymorphic bands, purifying and order-checking
The gel of 1PCR amplified production reclaims, purifying
Among the present invention to 2 homozygotes be that TT genotype and the genotypic pcr amplification product of CC reclaim, purifying and order-checking, gel reclaims and purifying use ordinary method gets final product.Among the present invention for reclaiming fast and efficiently pcr amplification product, use the Axygen AxyPrep of company genomic dna small volume of reagent box, concrete operations are carried out with reference to its specification sheets, and using reagent to be in the test kit the water except 1 * TAE Buffer damping fluid and two heats up in a steamer provides.Under fresh 1 * TAE Buffer, separate target DNA fragment fully with 2.0% agarose/Ethidum Eremide gel electrophoresis.Under long-wave ultra violet lamp, cut fast with clean knife blade and contain the target DNA fragment gel strips.The weight of blob of viscose that weighing is cut in clean 1.5ml centrifuge tube, the volume that calculates blob of viscose (is that 1ml calculates by 1g, for guaranteeing yield, the blob of viscose weight that reclaims should be between 50mg to 350mg), the Extraction Buffer that adds 1: 3 volume, hatch 7min or until blob of viscose melts fully, it is even that every 2-3min shakes mixed once for 55 ℃-65 ℃; In 1: 1 ratio (gel quality affects milligram number: Virahol volume microlitre number) add Virahol, and mix.Mixed solution is all transferred in the Spin column, in 6000g centrifugal one minute, and discard liquid in the adapter.In Spin column, add 500 μ l Extraction Buffer, in the centrifugal 30-60sec of 12000g, and discard liquid in the adapter.In Spin column, add 750 μ l Wash Buffer, in the centrifugal 30-60sec of 12000g, and discard liquid in the adapter.Abandon filtrate, with the centrifugal 1min of Spin Column 12000g of sky, then Spin Column is put into the 1.5ml centrifuge tube of a clean sterilization.In Spin Column, add the deionized water of 30 μ l Elution Buffer or sterilization to the central authorities of pillar, and left standstill one minute in room temperature.The centrifugal 1min eluted dna of 12000g.
The preparation of 2 competence DH5 α Host Strains
Use CaCl
2Standby large intestine dust Xi Shi DH5 α (E.coli DH5 α) the competence Host Strains of legal system, whole process needs to carry out under strict aseptic condition.Method is as follows: the single bacterium colony of the E.coli DH5 α of the new activation of picking is in the LB of not ammonification benzyl liquid nutrient medium from LB (Luria-Bertani) plate culture medium of 37 ℃ of cultivations 16 to 20h, 37 ℃ of per minute 200 to 220 rotational oscillations swing cultivates 12h, then getting 300 microlitres is equipped with in the Erlenmeyer flask of LB in 50 μ l, the soft 2h that rocks, OD
600Value is 0.45 to 0.55.Get the E.coli DH5 α bacterium liquid of precooling 10min in the ice in the centrifuge tube of precooling on ice, the centrifugal 10min of rotating speed that turns at 4 ℃ of lower per minutes 4500.Get the CaCl of the 0.075Mol/L of 25ml ice bath precooling
2-Tris-Cl the precipitation that suspends places ice bath 15min.At the centrifugal 10min of rotating speed that 4 ℃ of lower per minutes 4500 turn, abandon supernatant liquor after, be inverted 1min.The CaCl that adds the precooling of 2ml ice bath
2The resuspended precipitation of-glycerine.Every pipe 200 μ l divide and are filled in the 1.5ml centrifuge tube ,-80 ℃ of preservations.
3 purpose fragments are connected with cloning vector
Can select suitable carrier according to practical situation.The present invention connects for carrying out fast and efficiently carrier, has selected the pMD18-T carrier of TaKaRa company to connect test kit and has carried out being connected of purpose fragment and cloning vector, heats up in a steamer the water except four, and other all reagent are in the test kit and provide.The target DNA fragment that gel is reclaimed is connected on the pMD-18T carrier.According to the ligation system of table 3, in the autoclaved Eppendorf tube of 200 μ l, add listed component in the table 3, mixing, 16 ℃ connect 12-16h.
Table 3 ligation system
The conversion of 4 recombinant plasmids
In the competent cell of every pipe 200 μ l freeze thawing on ice, add the connection product of 10 μ l, flick tube wall with the mixing content, ice bath 45min.2min is left standstill in 42 ℃ of waters bath with thermostatic control of centrifuge tube being put into preheating.Fast centrifuge tube is transferred in the ice ice bath 5min.In centrifuge tube, add 200 μ l LB liquid nutrient mediums, 37 ℃ of rotating speed temperature bath 1.5h that shaking table per minute 150 turns.
The screening of 5 positive colonies
With LB solid medium 15psi (1.05kg/cm
2) high pressure steam sterilization 20min, when being cooled to 60 ℃, evenly mix paved flat board behind 5-bromo-4-chloro-3-indoles-β of the penbritin (AMP) of adding 1ml 100 μ g/ μ l, the sec.-propyl of 1ml 24 μ g/ μ l-B-D-thiogalactoside (IPTG), 2 μ l, 20 μ g/ μ l-D-lactoside (X-Gal).The bacterium of getting after 100 μ l transform is evenly coated media surface, places 1h in 37 ℃ of incubators.Then flat-plate inverted is placed 37 ℃ of incubators to cultivate, behind the 12-16h flat board is moved into 4 ℃ of placements, so that blueness fully manifests.Observe blue and white colony growing state, for the converted product of the band that makes every clauses and subclauses covers 5 ' and 3 ' terminal complete sequence, the individual LB substratum that is inoculated in of positive bacterium colony (white) 5-10 of picking.
The extraction of 6 recombinant plasmids
Can use ordinary method to carry out the extraction of recombinant plasmid.The present invention selects the E.Z.N.A.Plasmid Mini Kit I test kit of Omega company to extract positive plasmid DNA for fast, efficiently carrying out the extraction of recombinant plasmid, heats up in a steamer water, the deionized water except four, and agents useful for same is in the test kit and provides.Select the LB/Ampicillin liquid nutrient medium that single positive bacterium colony is inoculated into 5ml 50 μ g/ml from plate culture medium, 37 ℃ of rotating speed constant temperature oscillations that per minute 220 turns are cultivated 12-16h.Get 5ml bacterium liquid and put into centrifuge tube, the centrifugal 1min of room temperature 10000g discards top supernatant liquor.The abundant suspension cell precipitation of Solution I that RNA removes enzyme that contains with 250 μ l.The SolutionII that adds 250 μ l spins upside down lightly and mixes 4～6 times, makes the abundant cracking of thalline, forms clear solution, and room temperature is placed 2min.The SolutionIII that adds 350 μ l spins upside down gently and mixes 5 to 6 times, until form consolidation aggegation piece, the centrifugal 10min of room temperature 10000g.With the HiBind in the test kit
TMDNA Minicolumn is positioned on the Collection Tube of 2ml, and above-mentioned supernatant liquor with aggegation piece mixed solution is transferred to HiBind
TMAmong the DNA Minicolumn, the centrifugal 1min of room temperature 10000g.Discard filtrate, add the Buffer HB of 500 μ l to HiBind
TMDNA Minicolumn, the then centrifugal 1min of room temperature 10000g.Centrifugally discard filtrate after complete, add the DNA Wash Buffer that 700 μ l cross with alcohol dilution and clean HiBind
TMDNA Minicolumn, the centrifugal 1min of room temperature 10000g discards filtrate.Then the HiBind of the centrifugal sky of room temperature 10000g
TMDNA Minicolumn 1min, dry matrices.Dry complete after with HiBind
TMDNA Minicolumn is placed on the centrifuge tube of 1.5ml of new sterilization, at HiBind
TMThe centre of the film among the DNA Minicolumn adds the deionized water of 60 μ l sterilization, after room temperature leaves standstill 1min, and the centrifugal 1min eluted dna of 10000g, wash-out once improves output again ,-20 ℃ of storages.
The PCR of 7 positive plasmids identifies and order-checking
Carry out PCR take recombinant plasmid as template and identify that reaction system and amplification condition are constant, will identify that correct recombinant plasmid send order-checking company to carry out sequencing.Among the present invention, recombinant plasmid is served the sea and is given birth to the order-checking of worker's biotechnology Services Co., Ltd.
Four, mark property is carried out association analysis
Utilize 156 pig genome DNA samples (extracting genome DNA autoblood) of having measured Meat Quality, mark property is carried out association analysis, analyze proterties and comprise Meat Quality.Use the General Linear Model process in the SPSS13.0 software, set up such as drag and eliminate systemic effect and analyze related between different genotype and proterties.
Statistic analysis models is: Y
i=μ+G
j+ e
iWherein, Y
iFor being observed individual production performance phenotypic number; μ is the least square average of production performance; G
jBe the effect value of genotype to production performance; e
iBe the random residual corresponding to observed value.
In the Large White of herding branch of Jilin Province, China Shanxi Academy of Agricultural Sciences, randomly draw the individuality at 26 monthly ages, when meat quality determination, gather blood and carry out the extraction of genomic dna and put its relevant proterties data in order.The genomic dna that extracts is through spectrophotometric determination, and concentration is 37.19ug/ml, and OD260/OD280Ratio is 1.816.Primer, PCR reaction system and the condition of utilizing the present invention to design are carried out pcr amplification.PCR reaction totally is 50 μ l, 10 * reaction buffer [10mmol/L Tris-HCL (PH8.0), 50mmol/L KCl, 0.1%TritonX-100], 4 μ l wherein, 10mmol/L dNTP 2 μ l, 25mmol/L MgCl
23 μ l, primer concentration are 1.0umol/L, each 1 μ l of upstream primer and downstream primer, and 1 μ l (2U/ul) Taq archaeal dna polymerase, the genomic dna (containing the 31.68ng genomic dna) that 2 μ l extract, four heat up in a steamer water 36 μ l.The PCR reaction conditions is: 95 ℃ of denaturation 5min, and 95 ℃ of sex change 30sec, 59 ℃ of renaturation 45sec, 72 ℃ are extended 30sec, totally 35 circulations.At last, 72 ℃ are extended 10min.After total overall reaction was finished, amplified production detected through 1.5% agarose gel electrophoresis, and the result is shown as the specific PCR product.As shown in Figure 5, wherein the M swimming lane is standard molecular weight Marker, and swimming lane 1 and 2 is 2 detected PCR products.The SSCP method of PCR product by the present invention's design detected.Get 1 μ l PCR product and place the PCR pipe, add 5 μ l sex change Buffer, centrifugal mixing, 98 ℃ of sex change 10min; Rapid ice bath 10min, with the microsyringe point sample in the 12% non-denaturing polyacrylamide gel point sample hole for preparing in advance; Opening power, 4 ℃ of lower 130V electrophoresis 14～16h.Electrophoresis takes off gel after finishing, and places 70% ethanol, and the water-bath oscillator slowly shakes up fixes 10～15min; Deionization washing glue 2 times, each 2min, flush away ethanol; With 200ml staining fluid dyeing 30min; Deionization washing glue 3 times, each 2min, the staining fluid that flush away is unnecessary; With 200ml nitrite ion colour developing, about 10～30min when the intensity of DNA band is suitable, outwells nitrite ion; Deionized water is washed unnecessary nitrite ion off, scanography or preservation, and record its genotype.As shown in Figure 6, wherein swimming lane 1 and 2 is the SSCP results of detected 2 individualities.Through identifying that this swimming lane 1 individuality belongs to the TC type, swimming lane 2 individualities belong to the TT type.The contrast of the value that its proterties and the present invention predict sees Table 4.
The individual characters observed value that extracts among table 4 embodiment 1 and predictor contrast
Randomly draw the individuality at 25 monthly ages in the landrace of in Jilin University original seed pig farm, raising, when meat quality determination, gather blood and carry out the extraction of genomic dna and put its relevant proterties data in order.The genomic dna that extracts is through spectrophotometric determination, and concentration is 36.37ug/ml, and OD260/OD280Ratio is 1.806.Primer, PCR reaction system and the condition of utilizing the present invention to design are carried out pcr amplification.PCR reaction totally is 50 μ l, 10 * reaction buffer [10mmol/L Tris-HCL (PH8.0), 50mmol/L KCl, 0.1%TritonX-100], 4 μ l wherein, 10mmol/L dNTP 2 μ l, 25mmol/L MgCl
23 μ l, primer concentration are 1.0umol/L, each 1 μ l of upstream primer and downstream primer, and 1 μ l (2U/ul) Taq archaeal dna polymerase, the genomic dna (containing the 31.68ng genomic dna) that 2 μ l extract, four heat up in a steamer water 36 μ l.The PCR reaction conditions is: 95 ℃ of denaturation 5min, and 95 ℃ of sex change 30sec, 59 ℃ of renaturation 45see, 72 ℃ are extended 30sec, totally 35 circulations.At last, 72 ℃ are extended 10min.After total overall reaction was finished, amplified production detected through 1.5% agarose gel electrophoresis, and the result is shown as the specific PCR product.As shown in Figure 7, wherein the M swimming lane is standard molecular weight Marker, and swimming lane 1 and 2 is 2 detected PCR products.The SSCP method of PCR product by the present invention's design detected.Get 1 μ l PCR product and place the PCR pipe, add 5 μ l sex change Buffer, centrifugal mixing, 98 ℃ of sex change 10min; Rapid ice bath 10min, with the microsyringe point sample in the 12% non-denaturing polyacrylamide gel point sample hole for preparing in advance; Opening power, 4 ℃ of lower 130V electrophoresis 14～16h.Electrophoresis takes off gel after finishing, and places 70% ethanol, and the water-bath oscillator slowly shakes up fixes 10～15min; Deionization washing glue 2 times, each 2min, flush away ethanol; With 200ml staining fluid dyeing 30min; Deionization washing glue 3 times, each 2min, the staining fluid that flush away is unnecessary; With 200ml nitrite ion colour developing, about 10～30min when the intensity of DNA band is suitable, outwells nitrite ion; Deionized water is washed unnecessary nitrite ion off, scanography or preservation, and record its genotype.As shown in Figure 8, wherein swimming lane 1 and 2 is the SSCP results of detected 2 individualities.Through identifying that this swimming lane 1 individuality belongs to the TC type, swimming lane 2 individualities belong to the CC type.The contrast of the value that its proterties and the present invention predict sees Table 5.
The individual characters observed value that extracts among table 5 embodiment 2 and predictor contrast
The army that raises on Jilin University original seed pig farm herd randomly draw 27 monthly ages in No. 1 white pig treat that meat is individual, when meat, gather blood and carry out the extraction of genomic dna and put its relevant proterties data in order.The genomic dna that extracts is through spectrophotometric determination, and concentration is 37.53 μ g/ml, and the OD260/OD280 ratio is 1.834.Primer, PCR reaction system and the condition of utilizing the present invention to design are carried out pcr amplification.PCR reaction totally is 50 μ l, 10 * reaction buffer [10mmol/L Tris-HCL (PH8.0), 50mmol/L KCl, 0.1%TritonX-100], 4 μ l wherein, 10mmol/L dNTP 2 μ l, 25mmol/L MgCl
23 μ l, primer concentration are 1.0umol/L, each 1 μ l of upstream primer and downstream primer, and 1 μ l (2U/ul) Taq archaeal dna polymerase, the genomic dna (containing the 31.68ng genomic dna) that 2 μ l extract, four heat up in a steamer water 36 μ l.The PCR reaction conditions is: 95 ℃ of denaturation 5min, and 95 ℃ of sex change 30sec, 59 ℃ of renaturation 45sec, 72 ℃ are extended 30sec, totally 35 circulations.At last, 72 ℃ are extended 10min.After total overall reaction was finished, amplified production detected through 1.5% agarose gel electrophoresis, and the result is shown as the specific PCR product.As shown in Figure 9, wherein the M swimming lane is standard molecular weight Marker, and swimming lane 1 and 2 is 2 detected PCR products.The SSCP method of PCR product by the present invention's design detected.Get 1 μ l PCR product and place the PCR pipe, add 5 μ l sex change Buffer, centrifugal mixing, 98 ℃ of sex change 10min; Rapid ice bath 10min, with the microsyringe point sample in the 12% non-denaturing polyacrylamide gel point sample hole for preparing in advance; Opening power, 4 ℃ of lower 130V electrophoresis 14～16h.Electrophoresis takes off gel after finishing, and places 70% ethanol, and the water-bath oscillator slowly shakes up fixes 10～15min; Deionization washing glue 2 times, each 2min, flush away ethanol; With 200ml staining fluid dyeing 30min; Deionization washing glue 3 times, each 2min, the staining fluid that flush away is unnecessary; With 200ml nitrite ion colour developing, about 10～30min when the intensity of DNA band is suitable, outwells nitrite ion; Deionized water is washed unnecessary nitrite ion off, scanography or preservation, and record its genotype.As shown in figure 10, wherein swimming lane 1 and 2 is the SSCP results of detected 2 individualities.Through identifying that this swimming lane 1 individuality belongs to the TT type, swimming lane 2 individualities belong to the TC type.The contrast of the value that its proterties and the present invention predict sees Table 6.
The individual characters observed value that extracts among table 6 embodiment 3 and predictor contrast
Claims (2)
1. pig L-FABP gene is as the application of the relevant molecule marker of Meat Quality, it is characterized in that: its nucleotide sequence is as described in the SEQ ID NO:1, there is the base mutation of a T → C at the 25th bit base place of this sequence, thereby has caused the generation of single strand conformation polymorphism.
2. pig L-FABP gene as claimed in claim 1 is as the application of the relevant molecule marker of Meat Quality, and this application is the application in pig marble grain and intramuscular fat content genetic improvement.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010230086 CN101921845B (en) | 2010-09-18 | 2010-09-18 | Molecular marker of liver fatty acid binding protein (L-FABP) as pork quality character and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010230086 CN101921845B (en) | 2010-09-18 | 2010-09-18 | Molecular marker of liver fatty acid binding protein (L-FABP) as pork quality character and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101921845A CN101921845A (en) | 2010-12-22 |
| CN101921845B true CN101921845B (en) | 2013-01-02 |
Family
ID=43337060
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010230086 Active CN101921845B (en) | 2010-09-18 | 2010-09-18 | Molecular marker of liver fatty acid binding protein (L-FABP) as pork quality character and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101921845B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102732514B (en) * | 2012-06-29 | 2014-07-09 | 吉林大学 | Identification method for chemotactic factor acceptor 9 gene used as molecular marker for bovine excellent superovulation trait and application of same |
| CN103966209B (en) * | 2014-05-02 | 2016-04-06 | 华中农业大学 | The SNP marker relevant to pig intramuscular fat content proterties and application |
| SG10201908265UA (en) * | 2015-02-25 | 2019-10-30 | Sekisui Medical Co Ltd | L-fabp immunoassay method and assay reagent used in said method |
| CN105624310B (en) * | 2016-02-29 | 2017-07-14 | 华南农业大学 | A kind of molecular labeling for influenceing pig intramuscular fat character and application |
| CN106755447B (en) * | 2017-01-04 | 2020-06-09 | 安徽农业大学 | Molecular marker-assisted selection method for reducing abdomen fat rate of white-feather king pigeon and young pigeon |
| CN114592073B (en) * | 2022-04-01 | 2023-03-14 | 中国农业大学 | SNP (Single nucleotide polymorphism) affecting duck fatty acid composition related gene ELOVL3 |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1952664A (en) * | 2005-08-26 | 2007-04-25 | 中国科学院上海生命科学研究院 | Application of surface fatty acid-binding protein E-FABP |
-
2010
- 2010-09-18 CN CN 201010230086 patent/CN101921845B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1952664A (en) * | 2005-08-26 | 2007-04-25 | 中国科学院上海生命科学研究院 | Application of surface fatty acid-binding protein E-FABP |
Non-Patent Citations (2)
| Title |
|---|
| 张树敏等.松辽黑猪肉质特性研究.《黑龙江畜牧兽医》.2007,101-102. * |
| 李学斌等.PCR-SSCP技术及其在运行遗传变异研究中的应用.《甘肃畜牧兽医》.1999,35-37. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101921845A (en) | 2010-12-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101921845B (en) | Molecular marker of liver fatty acid binding protein (L-FABP) as pork quality character and application thereof | |
| CN102633870B (en) | Clone and molecular markers of rice broad-spectrum blast-resistance genes | |
| CN112961231B (en) | Male sterile gene ZmbHLH122 and application thereof in creating maize male sterile line | |
| CN107022604B (en) | Pig NTF3 promoter region SNP as boar breeding character molecular marker and application | |
| CN102464710B (en) | Helicoverpa armigera juvenile hormone binding protein (Ha-JHBP) and encoding gene and application thereof | |
| CN101967480B (en) | Molecular marker relevant to chicken skin color and authentication method and application thereof | |
| CN101633943A (en) | Identification method taking growth hormone receptor gene as Chinese grassland red bull excellent slaughter trait molecular marker and application thereof | |
| CN109112227A (en) | Rape bloom key gene as the rape ecotype improvement and Mature breeding molecular labeling and application | |
| CN108456735B (en) | Mytilus edulis microsatellite loci and application thereof in hybrid progeny identification | |
| CN103172716B (en) | Heat-resistant plant gene and application thereof | |
| CN109706154B (en) | CsPR3 gene and application thereof in cucumber fusarium wilt resistance | |
| CN102876687A (en) | SM gene for regulating and controlling cotton trichome, and application thereof | |
| CN110229825A (en) | The brown Leaf color mutant GBL1 gene of rice ash and its application | |
| CN108795947A (en) | A kind of detection method of Mandarin fish IL-6 genes and its disease-resistant SNP marker | |
| CN111793698B (en) | SNP locus related to rapid growth of large-sized fries of fugu rubripes and application thereof | |
| CN111118130B (en) | Method for rapidly identifying sex of macrobrachium rosenbergii | |
| CN110157809B (en) | Chicken CEL gene promoter 99bp indel polymorphism marker detection kit and application thereof | |
| CN111996197A (en) | Salt-tolerant gene and protein of pyrus betulaefolia, recombinant vector and application | |
| CN106701941B (en) | SNP molecular marker related to apple alternaria leaf spot resistance and application thereof | |
| CN104762302B (en) | The strong evoked promoter CdS2 of cadmium and its application | |
| CN114410826B (en) | InDel molecular marker co-separated from cucumber peel brightness gene and application thereof | |
| CN115247184B (en) | Grain type and yield control gene and application thereof | |
| CN107988251A (en) | Applications of the plant unsaturated fatty acid content GAP-associated protein GAP GhSAD during cold hardness evaluation | |
| CN116121435B (en) | Method for regulating and controlling length of wheat root hair, molecular marker and application thereof | |
| WO2023168691A1 (en) | Methods and compositions for modifying flowering time genes in plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |