CN101899498A

CN101899498A - Standard substance for detecting allergen almond components in foods

Info

Publication number: CN101899498A
Application number: CN2009100688491A
Authority: CN
Inventors: 高旗利; 张霞; 陈颖; 刘培; 张莹; 张海滨; 张海英; 吴冬雪
Original assignee: Tianjin Entry Exit Inspection and Quarantine Bureau of Animals Plants and Food Inspection Center
Current assignee: Tianjin Entry Exit Inspection and Quarantine Bureau of Animals Plants and Food Inspection Center
Priority date: 2009-05-15
Filing date: 2009-05-15
Publication date: 2010-12-01

Abstract

The invention discloses a standard substance for detecting allergen almond components in foods, which is a necessary reference object for detecting allergen almond components in foods by a molecular biology technology and belongs to a matching product for a detection method, in particular to a reference object for utilizing fluorescence PCR reaction to detect allergen almond components. The technical scheme thereof is as follows: amplifying a Pru dul gene in a detected object to obtain an objective fragment; connecting the objective fragment into a plasmid vector, cloning, transforming and feeding into an escherichia coli cell; and extracting the plasmid vector, carrying out quantitative analysis on the plasmid vector, preparing into the standard substance and utilizing the standard substance to draw a standard curve. The standard substance established in the invention can be used for quantitative analysis detecting the allergen almond components in the foods, serve as a positive control for the detection and has practical significance to improve the accuracy and specificity of the detection.

Description

The employed standard substance of anaphylactogen almond component in a kind of detection food

Technical field

The invention belongs to a kind of detection standard substance, the employed standard substance of anaphylactogen almond component in a kind of specifically detection food, these standard substance are to detect the necessary object of reference of anaphylactogen almond component in the food by Protocols in Molecular Biology, the auxiliary products that belong to detection method particularly use fluorescent PCR to react the object of reference that detects the anaphylactogen almond component.

Background technology

Food anaphylaxis is a kind of untoward reactions of people to the food generation, belongs to a kind of transformation reactions of body to exogenous material.Recent two decades comes, and food anaphylaxis is much accounted of gradually, has been considered to serious public health problem, and WHO prediction food anaphylaxis may become one of modal prevailing disease from now on.According to the U.S. FDA statistics, in the U.S., 2% grownup and 5% infant suffer from phagopyrism, and annual about 30000 people need clinical emergency treatment, and 150 people die from the anaphylaxis that food causes.In all anaphylaxis, peanut and tree nut allergy account for 10-47%.

Set up at present fluorescence PCR detecting method at almond component Pru du 1.06B DNA, this research has promptly been set up and the supporting standard substance of this method, these standard substance can be used for detecting the quantitative analysis of food anaphylactogen almond component and use as the positive control that detects, and have practical significance to improving the accuracy and the specificity that detect.

Summary of the invention

At above-mentioned situation, the invention provides and to be used for detecting the quantitative analysis of food anaphylactogen almond component and the standard substance that use as the positive control that detects, be exactly concretely, by quantitative dilution to standard substance, obtain diluent, diluent is carried out the C that the fluorescent PCR reaction obtains fluorescent PCR as template _T, application of mathematical method base of calculation curve obtains the C that target fragment concentration and fluorescent PCR react _TRelation between the value.Convert the concentration of unknown sample under same reaction system condition with this.

Its technology contents comprises: the concentration conversion method of the ordered sequence of standard substance and unknown concentration sample.

Use the full sequence of the employed primer of this method, probe as follows:

Primer:

The primer sequence one: TTTGGTTGAAGGAGATGCTC

The primer sequence two: TAGTTGCTGGTGCTCTTTATG

Probe:

Used probe sequence: TCCATCAGCAGATGCCACCAAC

The present invention is achieved by the following technical solutions:

1.PCR the recovery purifying of amplification and product

Use primer amplification almond component sample gene group, the purpose fragment length is 108bp.

PCR reaction cumulative volume is 50 μ L, and each component composition is as follows in the PCR reaction system:

2 times of 25 μ L of PCR system premixture

Probe method the primer sequence one 10 μ mol/L 2 μ L

Probe method the primer sequence 2 10 μ mol/L 2 μ L

DNA sample 2 μ L

Distilled water 19 μ L

Cumulative volume 50 μ L

The pcr amplification program is as follows

(1) 94 ℃ 2 minutes

(2) 95 ℃ 30 seconds

(3) 50 ℃ 30 seconds

(4) 72 ℃ 30 seconds

(5) got back to for the 2nd step, repeat 35 times

(6) 72 ℃ 10 minutes

Above-mentioned PCR product is carried out 2.0% agarose gel electrophoresis, adopt gel to reclaim the test kit by specification and reclaim the purpose band.The sequence of this band checks order, and sequencing result is TTTTGGTTGAAGGAGATGCTCTTTCAGACAAGGTTGAGAAAATCACTTATGAGATT AAGTTGGTGGCATCTGCTGATGGAGGTTCCATCATAAAGAGCACCAGCAACTA.

2. purpose fragment and carrier is connected

Use TA Cloing test kit, in 10 μ L total reaction systems, undertaken: 2 μ L PCR, 2.1 linear carrier DNA by following condition, the purpose fragment 4 μ L of purifying, 10 * T4DNA connects damping fluid 1 μ L, T4DNA ligase enzyme 1 μ L, sterilized water 2 μ L, mixings gently, of short duration centrifugal, 14 ℃ of insulation 24h.

3. competent cell transforms

From-70 ℃ of refrigerators, get 100 μ L competent cell E.coli JM109, put on ice immediately after thawing under the room temperature.Add and connect product solution 5 μ L, shake up gently, place 5min on ice.Thermal shock is 90 seconds in 42 ℃ of water-baths, places cooled on ice behind the thermal shock rapidly 3 to 5 minutes.Xiang Guanzhong adds 1mL LB liquid nutrient medium (not containing penbritin), and 37 ℃ of shaking culture are 1 hour behind the mixing, makes the bacterium state that restore normal growth.Get 100 μ L after above-mentioned bacterium liquid shaken up and coat the LB solid medium of handling through 2%X-gal and 20%IPTG that contains 100 μ g/mL penbritins, cultivated 16 hours to 24 hours for 37 ℃.

4. contain the screening and the evaluation of recombinant plasmid bacterial strain

With the single colony inoculation of aseptic toothpick picking white in the 5mL LB liquid nutrient medium that contains penbritin 50 μ g/mL, 37 ℃ of shaking culture 12 hours.Use plasmid extraction kit and extract PCR2.1/ purpose fragment plasmid.Identify positive recombinant by PCR, the PCR the primer is the pulsating primer of the purpose that increased originally.The positive recombinant that PCR is tentatively determined further checks order with conclusive evidence.

5. the preparation of gradient concentration reference standard

The DNA/RNA/ protein analyzer is measured the concentration and the A260/A280 value of recombinant plasmid.Do the continuous gradient dilution after calculating its copy number.Copy number=plasmid quality * Avogadro constant number/plasmid molecule amount, wherein the A Shi constant is 6.02 * 10 ²³, the total length of the molecular-weight average * recombinant plasmid of plasmid molecule amount=one base pair.With ultrapure water recombinant plasmid solution is done 10 times of gradient serial dilutions ,-20 ℃ of preservations are standby.

6. the foundation of typical curve

Be reflected on the 7000 type quantitative real time PCR Instruments of American AB I company and carry out, amplification curve according to the plasmid standard of different concns, response data is collected and is stored in the computer by ABI 7000 type PCR instrument, and this computer was according to the automatic drawing standard curve of the amplification situation of quantitative criterion template after reaction finished.C by typical curve equation and sample _TValue just can calculate the content of institute's cls gene in the sample.

Each component composition is as follows in the fluorescent PCR reaction system:

Constituent concentration application of sample amount

2 times of 25 μ L of PCR system premixture

Probe method the primer sequence one 10 μ mol/L 2 μ L

Probe method the primer sequence 2 10 μ mol/L 2 μ L

The used probe sequence one 10 μ mol/L of probe method 1.5 μ L

DNA sample 5 μ L

Distilled water 14.5 μ L

Cumulative volume 50 μ L

The fluorescent PCR amplification program is as follows

(1) 50 ℃ 2 minutes

(2) 95 ℃ 10 minutes

(3) 95 ℃ 15 seconds

(4) 60 ℃ 1 minute

(5) got back to for the 3rd step, repeat 45 times

In selecting reaction system for use, contain 2.08 * 10 ¹～2.08 * 10 ⁸When copying the serial dilutions of a target gene fragment, amplified reaction C _TThe linear R of logarithm of value and copy number ²Be 0.99, typical curve regression equation y=-2.840lx+40.800, wherein y is C _T, x is the copy number of the target gene fragment in the sample corresponding under this system.

Description of drawings

The typical curve that the standard substance that Fig. 1 the present invention is set up obtain.

Reference material DNA in Fig. 2 sample, the fluorescence signal intensity amplification curve.

Embodiment

Below in conjunction with accompanying drawing and embodiment the present invention is described in further detail.

Embodiment 1

Sample: make the international almond anaphylactogen reference material DNA of purchase, as template.

1. sample preparation

Get 1 μ L sample, put into the 1.5mL centrifuge tube, add 200 μ L TE dissolving, detect its purity and concentration with the DNA analysis instrument.

2.PCR amplification

Constituent concentration application of sample amount

2 times of 25 μ L of PCR system premixture

Probe method the primer sequence one 10 μ mol/L 2 μ L

Probe method the primer sequence 2 10 μ mol/L 2 μ L

The used probe sequence one 10 μ mol/L of probe method 1.5 μ L

DNA sample 5 μ L

Distilled water 14.5 μ L

Cumulative volume 50 μ L

The fluorescent PCR amplification program is as follows

(1) 50 ℃ 2 minutes

(2) 95 ℃ 10 minutes

(3) 95 ℃ 15 seconds

(4) 60 ℃ 1 minute

(5) got back to for the 3rd step, repeat 45 times

3. detected fluorescent PCR collection of illustrative plates is observed

Can observe sample in the fluorescent PCR process at 25.2 (C _T) circulating has produced tangible FAM fluorescence, result such as Fig. 2.

C according to generation fluorescence _TContain 1.7 * 10 approximately in the former DNA sample of value conversion ⁶Individual genome copy.Identical with the copy number that shows in the sample.

Claims

1. one kind is detected the employed standard substance of anaphylactogen almond component in the food, it is characterized in that a kind of employed standard substance of anaphylactogen almond component that detect in the food are meant in by round pcr or fluorescent PCR technology for detection food employed standard substance in the anaphylactogen almond component.

2. the employed standard substance of anaphylactogen almond component in a kind of detection food according to claim 1 is characterized in that, these standard substance are an annular enclosed dna molecular, and this dna molecular sequence is by constituting with the lower section:

The sequence of TA vector plasmid, this sequence comprises the site of plasmid replication and transcription initiation at least;

The special product of pcr amplification.

3. according to claim 2 one annular enclosed dna molecular, the dna sequence dna of the special product of this pcr amplification is:

TTTTGGTTGAAGGAGATGCTCTTTCAGACAAGGTTGAGAAAATCACTTATGAGATTAAGTTGGTGGCATCTGCTGATGGAGGTTCCATCATAAAGAGCACCAGCAACTA。

4. according to claim 2 one annular enclosed dna molecular uses this molecule construction typical curve, carries out the detection of anaphylactogen almond component in the food as standard substance.