CN101724717A - Enterovirus universal nucleic acid detection kit and detection method - Google Patents

Abstract

The invention discloses an enterovirus universal nucleic acid detection kit and a detection method thereof. The kit comprises PCR reaction enzymes, PCR reaction solution, negative quality control material and positive quality control material, wherein the PCR reaction enzyme includes hot-start Tap enzyme, MLV reverse transcriptase and RNA enzyme inhibitor; and the PCR reaction solution comprises DEPC treated water, dNTPs, 10*PCR Buffer, an enterovirus universal forward primer, an enterovirus universal reverse primer and an enterovirus universal probe. The sequence of the enterovirus universal forward primier is 5'GTGTCGTAAYGGGYAACTCTTCA-3'; the sequence of the enterovirus universal reverse primer is 5'-YAATTGTCACCATAAGCCA-3'; and the sequence of the enterovirus universal probe is 5'-TAGAACCGACTACTTACGGTGTCCGT-3'. The negative quality control material is the DEPC treated water; and positive quality control material is prepared in vitro transcription RNA. The invention employs real-time fluorescence quantitative PCR technology to detect enterovirus nucleic acid sequence and has the advantages of specificity, sensitivity, fast detection and convenient operation.

Description

Enterovirus universal nucleic acid detection kit and detection method

Technical field

The invention belongs to biological technical field, disclose a kind of enterovirus universal nucleic acid detection kit and detection method.

Background technology

Hand foot mouth disease (Hand, foot and mouth disease, HFMD) be by enterovirus (Enterovirus, EV) transmissible disease that causes, pilosity is born in children below 5 years old, can cause the bleb at positions such as hand, foot, oral cavity, the minority infant can cause complication such as myocarditis, pulmonary edema, AME.Indivedual severe infant PD are fast, cause death.The enterovirus that causes hand foot mouth disease has kind more than 20,16,4,5,9,10 types of CA group, 2,5 types of B group, and enterovirns type 71 is the more common pathogenic agent of hand foot mouth disease, wherein (Coxsackieviruses 16 with coxsackie virus A 16-type, CA16) and enterovirns type 71 (Enterovirus 71, and is EV71) common.

The specificity diagnostic method of enterovirus infection has three kinds, and promptly viral isolation identification, serology detect and Protocols in Molecular Biology.The separation and Culture and the serological method of virus, numerous and diverse time-consuming, can't satisfy the needs of handling great amount of samples during the viral prevalence simultaneously.Molecular biological progress has been opened up the quick diagnosis technology, particularly round pcr of enterovirus, because its test material consumption is few, quick, highly sensitive and have very high specificity, and the increasing vital role of performance in the diagnosis of virus infection.RT-polymerase chain reaction (RT-PCR) technology has become the important means of enterovirus infection quick diagnosis.Traditional RT-PCR Technology Need two-step reaction, whole process need 6-8 hour, time loss was big, can not satisfy the outburst detection demand in period; In addition, also there is the risk of crossed contamination in this technology, and false positive results inevitably appears in the test experience chamber after for some time.The real-time fluorescence quantitative PCR technology, be in the PCR reaction system, to add fluorophor, utilize the fluorescent signal accumulation whole PCR process of monitoring in real time, by typical curve unknown template is carried out the method for quantitative analysis at last, compare with conventional PCR, it have specificity stronger, effectively solve characteristics such as PCR pollution problem, level of automation height, be used widely at present.

Summary of the invention

The objective of the invention is defective, provide a kind of and utilized the real-time fluorescence quantitative PCR technology and have enterovirus universal nucleic acid detection kit special, sensitive, quick, easy and simple to handle and detection method at above-mentioned prior art.

The technical scheme taked of the present invention is to achieve these goals: a kind of enterovirus universal nucleic acid detection kit is provided, and this test kit contains:

(1) .PCR reaction enzymes is comprising warm start Taq enzyme, MLV reversed transcriptive enzyme, RNA enzyme inhibitors;

(2) .PCR reaction solution is comprising DEPC treating water, dNTPs, 10 * PCR Buffer, enterovirus universal forward primer, enterovirus universal reverse primer, enterovirus universal probe;

Enterovirus universal forward primer sequence is shown in SEQ ID NO.1 in the sequence table: 5 '-GTGTCGTAAYGGGYAACTCTGCA-3 ',

Enterovirus universal reverse primer sequence is shown in SEQ ID NO.2: 5 '-YAATTGTCACCATAAGCAGCCA-3 ',

The enterovirus universal probe sequence is shown in SEQ ID NO.3 in the sequence table: 5 '-TAGAACCGACTACTTACGGTGTCCGT-3 ';

(3). negative quality control product is the DEPC treating water;

(4). positive quality control product, for adopting the in-vitro transcription RNA of t7 rna polymerase preparation.

Described probe 5 ' end flag F AM (fluorescence report group), 3 ' end mark ECLISPE (fluorescent quenching group).

The proportioning of each component concentration is in the described PCR reaction enzymes: concentration is the warm start Taq enzyme dosage 0.25 μ L of 5U/ μ L; Concentration is the MLV reversed transcriptive enzyme consumption 0.5 μ L of 200U/ μ L; The consumption 0.25 μ L of the RNA enzyme inhibitors of 40U/ μ L;

The proportioning of each component concentration is in the described PCR reaction solution: DEPC treating water consumption 16 μ L; 2.5mM dNTPs consumption 2 μ L; 10 * PCR Buffer consumption, 2.5 μ L; 10 μ M primer mixing solutions consumptions, 1 μ L; 10 μ M probe consumptions, 0.5 μ L.

The present invention also provides a kind of detection method of utilizing the mentioned reagent box to detect total enterovirus, comprises the following steps:

(1) RNA extracts: adopt the commercialization viral RNA to extract test kit such as QIAamp Viral RNA Mini Kit extraction;

(2) PCR Mix preparation and packing: by 22 μ L: the ratio of 1 μ L, draw PCR reaction solution and PCR reaction enzymes respectively, abundant mixing, 12, the centrifugal 10s of 000rpm is mixed with PCR Mix, take out the PCR reaction tubes, give to add the above-mentioned PCR Mix of 23 μ in each reaction tubes; Each detection need be established a positive quality control PCR reaction tubes and a negative Quality Control PCR reaction tubes, and all the other are the PCR reaction tubes of sample;

(3) application of sample: in above-mentioned reaction tubes, add the sample rna that extracts, positive quality control product and negative quality control product 2 μ L, 12, the centrifugal 10s of 000rpm respectively;

(4) pcr amplification: each reaction tubes is put into the reactive tank of quantitative fluorescent PCR instrument, mark fluorescent radical species, sample title and type are set, carry out pcr amplification by following condition;

42℃45min；

95℃2min；

95 ℃ of 10s, 60 ℃ of 30s; 40 circulations; Fluorescent value is read in the 3rd end of a period that goes on foot at response procedures;

(5) analysis and judgement: the Ct value smaller or equal to 35 positive; The Ct value greater than 37 negative; The Ct value is a gray area between 35-37, need carry out revision test, if the Ct value is otherwise negative still between 35-37 then be judged as the positive.

The invention has the beneficial effects as follows: the present invention adopts the method for the total enterovirus sequence of real-time fluorescence quantitative PCR technology for detection, has special, sensitive, quick, advantages of simple operation.

Description of drawings

Fig. 1 is embodiment 1 experimental result picture;

Fig. 2 is embodiment 2 experimental result pictures.

Embodiment

The invention will be further described below in conjunction with the drawings and specific embodiments, but not as a limitation of the invention.

The invention provides a kind of enterovirus universal nucleic acid detection kit, this test kit contains: the PCR reaction enzymes, comprising warm start Taq enzyme, MLV reversed transcriptive enzyme, RNA enzyme inhibitors; The PCR reaction solution is comprising DEPC treating water, dNTPs, 10 * PCRBuffer, enterovirus universal forward primer, enterovirus universal reverse primer, enterovirus universal probe; Negative quality control product is the DEPC treating water; Positive quality control product is for adopting the in-vitro transcription RNA of t7 rna polymerase preparation.Enterovirus is the general name of viroid, and EV71 and CA16 belong to enterovirus, and what cause hand foot mouth disease also comprises some other enterovirus.

The manufacturing of test kit:

1, reagent

Reagent used in this test kit manufacturing processed is mainly available from precious biotechnology (Dalian) company limited (Takara),

All the other are available from Pu Luomaige company, Beijing Quanshijin Biotechnology Co., Ltd, Beijing Chemical Plant.

2.PCR reaction solution preparation:

(1) design of primer and probe is with synthetic:

Download domestic different year and geographic various enterovirus whole genome sequence from Genbank, carry out the multisequencing comparison by biological software Align X, choose one section conserved sequence at 5 ' end non-coding region, according to primer and probe design principle, adopt Primer Express software design enterovirus universal primer and probe.Design result is as shown in the table:

Annotate: Y=C/T

In the table: F:forward, forward; PE-F represents the enterovirus universal forward primer.

R:reverse, oppositely; PE-R represents the enterovirus universal reverse primer.

P:probe, probe; PE-P represents the enterovirus universal probe.

FAM: fluorescence report group.

ECLIPSE: fluorescent quenching group.

According to the design result of last table, entrust Invitrogen company and Takara company synthetic primer and probe respectively.

(2) dissolving of primer and probe: get frozen enterovirus universal primer (PE-F and PE-R), probe (PE-P) dry powder pipe, 12, the centrifugal 2min of 000rpm, add TE Buffer according to primer probe dissolving specification sheets dry powder is dissolved, making concentration and probe concentration is 10 μ M, and two kinds of primer concentrations respectively are 20 μ M, mix in 1.5mL EP pipe Deng measuring two kinds of primer solution, be mixed with 10 μ M primer mixing solutionss, the vibration mixing is centrifugal, standby;

(3) PCR reaction solution preparation:

In following ratio: DEPC treating water 16 μ L, 2.5mM dNTPs 2 μ L, 10 * PCR Buffer2.5 μ L, 10 μ M primer mixing solutions 1 μ L and 10 μ M probes, 0.5 μ L are mixed with the PCR reaction solution.

3.PCR reaction enzymes preparation:

Concentration is that 0.25 μ L of the RNA enzyme inhibitors of the warm start Taq enzyme 0.25 μ L of 5U/ μ L, MLV reversed transcriptive enzyme 0.5 μ L that concentration is 200U/ μ L and 40U/ μ L is mixed with into the PCR reaction enzymes.

4. negative quality control product preparation:

The effect of negative quality control product is to be used for preventing the false positive that produces because of pollution.The present invention adopts the DEPC treating water as negative quality control product, and whole experiment is monitored.

5. positive quality control product preparation:

The effect of positive quality control product is that whether monitoring reagent lost efficacy and whether performance descends.The present invention adopts the RNA of enterovirus universal in-vitro transcription as positive quality control product.According to molecule clone technology commonly used in the art, its preparation method is as follows:

(1) construction of recombinant plasmid and extraction: at first use PE-F, PE-R respectively as the upstream and downstream primer to PE virus

The genomic dna sequence of positive strain carries out pcr amplification:

Upstream primer is shown in SEQ ID NO:1 in the sequence table: GTGTCGTAAYGGGYAACTCTGCA

Downstream primer is shown in SEQ ID NO:2 in the sequence table: YAATTGTCACCATAAGCAGCCA

Adopt Bo Maide " the multifunctional dna purifying reclaims test kit " to reclaim the PCR product then as the purpose fragment; Adopt the pEAZY-T3 Cloning Vector test kit of full formula King Company, the insertion of above-mentioned purpose fragment is contained among the carrier pEAZY-T3 of T7 promotor, construction recombination plasmid by transforming and screening, obtains containing the positive colony bacterium that is inserted with the segmental recombinant plasmid of above-mentioned purpose; This positive colony bacterium carries out quantitatively with the plasmid in Bo Maide " high purity plasmid extraction kit " the extraction cultivation bacterium liquid and with ultraviolet spectrophotometer through after the enlarged culturing.

(2) preparation of in-vitro transcription RNA quality control product

With the SAC I enzyme of Takara company to the plasmid of said extracted carry out enzyme cut make its linearizing after, adopt the t7 rna polymerase of Takara company that above-mentioned endonuclease reaction liquid is carried out in-vitro transcription, the in-vitro transcription reaction solution of gained digests to remove plasmid DNA wherein with the DNase I of Takara company, adopt the TransZol of full formula King Company to extract RNA in this Digestive system subsequently, this is in-vitro transcription RNA; After adopting ultraviolet spectrophotometer to carry out quantitatively to it, it is diluted to concentration is that 105 copy/μ L are as in-vitro transcription RNA quality control product.

The enterovirus specificity purpose fragment sequence that inserts in the recombinant plasmid is shown in SEQ ID NO.4 in the sequence table:

GTGTCGTAATGGGTAACTCTGCAGTAGAACCGACTACTTACGGTGTCCGT

GTTTCCTTTTATTTTTATATTGGCTGCTTATGGTGACAATTA

Embodiment 1

On ABI 7300 quantitative real time PCR Instruments, detect the method for total enterovirus with test kit of the present invention

(1) RNA extracts: adopt QIAamp Viral RNA Mini Kit to extract,

(2) PCR Mix preparation: in 22 μ L: the ratio of 1 μ L, draw PCR reaction solution and PCR reaction enzymes respectively, abundant mixing, 12, the centrifugal 10s of 000rpm takes out the PCR reaction tubes, one of them positive quality control product reaction tubes, a negative quality control product reaction tubes, another is the sample reaction tubes, gives the PCRMix that adds the above-mentioned preparation of 23 μ L in each reaction tubes;

PCR Mix compound method is as shown in the table:

(3) application of sample: the sample rna 2 μ L that in 3 reaction tubess, add to extract respectively, positive quality control product 2 μ L and negative quality control product 2 μ L, behind the mixing 12, the centrifugal 10s of 000rpm;

(4) pcr amplification: the reactive tank of each reaction tubes being put into quantitative real time PCR Instrument, by correspondence not key sample, positive quality control product product and negative quality control product are set in proper order, and sample title, mark fluorescent radical species are set, according to the form below is provided with response procedures and carries out pcr amplification.

Annotate: reporter gene is made as FAM, and quenching group is made as none, and Passive Reference is made as none; Fluorescent value is read in end of a period in the final step of response procedures.

(5) quality control standard:

Negative quality control product: feminine gender;

Positive quality control product: the positive and Ct value are less than 35.

Above condition should satisfy simultaneously, otherwise it is invalid that test this time is considered as, and Total Test should carry out again.

(6) analysis and judgement:

The Ct value smaller or equal to 35 positive; The Ct value greater than 37 negative; The Ct value is a gray area between 35-37, need carry out revision test, if the Ct value is otherwise negative still between 35-37 then be judged as the positive.The test-results of the embodiment of the invention 1 as shown in Figure 1, detected result is positive, the Ct value is 30.58.

Reagent that the embodiment of the invention is used and material are as follows respectively:

(1) reagent

QIAamp Viral RNA Mini Kit is available from German QIAGEN company;

Enterovirus universal nucleic acid detection kit

(2) material

Pipettor rifle head: 0.2mL, 0.5mL, 1.5mL, available from AXYGEN company;

The PCR reaction tubes: the 0.2mL thin-walled tube, available from AXYGEN company.

(3) instrument

ABI 7300 quantitative real time PCR Instruments are available from AB company.

Embodiment 2

With the method detection unknown sample of test kit of the present invention according to embodiment 1.The source * * hospital patient sample to be determined, the test-results of the embodiment of the invention 2 as shown in Figure 2, detected result is positive, the Ct value is 19.41.

Above-described embodiment, the present invention embodiment a kind of more preferably just, the common variation that those skilled in the art carries out in the technical solution of the present invention scope and replacing all should be included in protection scope of the present invention.

PE-1 sequence table _ ST25.txt

SEQUENCE?LISTING

＜110〉Aipuyi Biotech Co., Ltd., Beijing

＜120〉enterovirus universal nucleic acid detection kit and detection method

<130>09SG1F0546

<160>4

<170>PatentIn?version?3.4?<210>1

<211>23

<212>DNA

＜213〉artificial sequence

 

<220>

＜221〉primer

<222>(1)..(23)

 

<400>1

gtgtcgtaay?gggyaactct?gca 23

 

<210>2

<211>22

<212>DNA

＜213〉artificial sequence

 

<220>

＜221〉primer

<222>(1)..(22)

 

<400>2

yaattgtcac?cataagcagc?ca 22

 

<210>3

<211>26

<212>DNA

＜213〉artificial sequence

 

<220>

＜221〉probe

<222>(1)..(26)

 

<400>3

tagaaccgac?tacttacggt?gtccgt 26

 

<210>4

<211>92

<212>DNA

＜213〉virus

 

<220>

＜221〉non-coding region

<222>(1)..(92)

 

<400>4

gtgtcgtaat?gggtaactct?gcagtagaac?cgactactta?cggtgtccgt?gtttcctttt 60

atttttatat?tggctgctta?tggtgacaat?ta 92

Claims (3)

1. enterovirus universal nucleic acid detection kit is characterized in that:

This test kit contains:

(1) .PCR reaction enzymes is comprising warm start Taq enzyme, MLV reversed transcriptive enzyme, RNA enzyme inhibitors;

(2) .PCR reaction solution is comprising DEPC treating water, dNTPs, 10 * PCR Buffer, enterovirus universal forward primer, enterovirus universal reverse primer, enterovirus universal probe;

Enterovirus universal forward primer sequence is: 5 '-GTGTCGTAAYGGGYAACTCTGCA-3 ',

Enterovirus universal reverse primer sequence is: 5 '-YAATTGTCACCATAAGCAGCCA-3 ',

The enterovirus universal probe sequence is: 5 '-TAGAACCGACTACTTACGGTGTCCGT-3 ';

(3). negative quality control product is the DEPC treating water;

(4). positive quality control product, for adopting the in-vitro transcription RNA of T7 RNA polymerase preparation.

2. enterovirus universal nucleic acid detection kit according to claim 1 is characterized in that: described probe 5 ' end flag F AM fluorescence report group, 3 ' end mark ECLIPSE fluorescent quenching group.

3. a detection method of utilizing claim 1 or 2 described test kits to detect enterovirus is characterized in that, comprises the following steps:

(1) RNA extracts: adopt the commercialization viral RNA to extract test kit and extract;

(2) PCR Mix preparation and packing: by 22 μ L: the ratio of 1 μ L, draw PCR reaction solution and PCR reaction enzymes respectively, abundant mixing, 12, the centrifugal 10s of 000rpm is mixed with PCR Mix, take out the PCR reaction tubes, give the PCR Mix that adds the above-mentioned preparation of 23 μ L in each PCR reaction tubes;

(3) application of sample: in above-mentioned PCR reaction tubes, add the sample rna that extracts, positive quality control product and negative quality control product 2 μ L, 12, the centrifugal 10s of 000rpm respectively;

(4) pcr amplification: each reaction tubes is put into the reactive tank of quantitative fluorescent PCR instrument, mark fluorescent radical species, sample title and type are set, carry out pcr amplification by following condition;

42℃45min；

95℃2min；

95 ℃ of 10s, 60 ℃ of 30s; 40 circulations; Fluorescent value is read in the 3rd end of a period that goes on foot at response procedures;

(5) analysis and judgement: the Ct value smaller or equal to 35 positive; The Ct value greater than 37 negative; The Ct value is a gray area between 35-37, need carry out revision test, if the Ct value is otherwise negative still between 35-37 then be judged as the positive.

Images