CN105624331A - Fluorescent PCR detection kit for intestinal viruses - Google Patents
Fluorescent PCR detection kit for intestinal viruses Download PDFInfo
- Publication number
- CN105624331A CN105624331A CN201610019626.6A CN201610019626A CN105624331A CN 105624331 A CN105624331 A CN 105624331A CN 201610019626 A CN201610019626 A CN 201610019626A CN 105624331 A CN105624331 A CN 105624331A
- Authority
- CN
- China
- Prior art keywords
- probe
- enterovirus
- pcr
- primer
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a kit for specifically detecting existence of intestinal virus nucleic acid in a sample by virtue of a fluorescent PCR technique. By virtue of the kit, the existence of intestinal virus nucleic acid in the sample can be rapidly detected, intestinal viruses existing in the sample can be sensitively detected and determined, and the lower detection limit is 10 copies per each reaction system; and the kit has important application values in the fields of disease surveillance, clinical diagnosis and the like.
Description
Technical field
The present invention relates to a kind of test kit adopting enterovirus in Fluorescence PCR assay specific detection sample to exist, belong to the in-vitro diagnosis field of enterovirus.
Background technology
Enterovirus belongs to strand underlying stock RNA viruses, and virion is ball-type, and capsid is 20 body symmetrical structures, without peplos, has infectivity. Starch internal breeding at host cell, cause rapidly cytopathy. Propagate mainly through excrement a bite approach, diverse clinical manifestations, cause the multiple disease of the mankind, such as poliomyelitis, hand-foot-mouth disease, paralysis, aseptic isolator, myocardial damage, diarrhoea and erythra etc.
Human enteric virus is at least made up of 72 serotypes, and its kind has:
1. human poliovirus 1��3 type;
2. human coxsackievirus A group 1��22 type and 24 types (A-23 type is echovirus 9 type), B group 1��6 type;
3. echovirus 1��9,11��27,29��34 totally 32 serotypes;
4. newtype enteroviru 68��72 type, 70 types wherein separated for 1971, acute hemorrhagic conjunctivitis attention can be caused, 72 types are hepatitis A virus. Rotavirus, EAd.
In test in laboratory, PCR method to substitute owing to its fast and convenient feature presents gradually based on the trend of cell cultivation and the traditional detection method of Serologic detection. And for PCR method, the specificity of primer is the basis of the specificity of its detection and sensitivity. The present invention is directed to the special target sequence design primer of enterovirus and Taqman probe, the method utilizing real-timeRT-PCR, be used for differentiating enterovirus in detection sample, it is possible to quickly obtain specific detection result.
Summary of the invention
What present invention mainly solves technical problem is that to detect in sample whether there is enterovirus rapidly and accurately, it is provided that the fluorescent PCR kit of a kind of specific detection enterovirus.
The technical problem to be solved is achieved through the following technical solutions:
The test kit of enterovirus in a kind of specific detection sample, component includes PCR reactant liquor, enzyme mixation, negative quality-control product and positive quality control product. Wherein PCR reactant liquor mainly contains relevant primer and probe, reaction buffer, Mg2+With dNTP etc., enzyme mixation mainly contains reverse transcriptase and hot start Taq polymerase, and negative quality-control product is without RNase and DNase water, and positive quality control product is detect the RNA of target sequence containing enterovirus.
In PCR reactant liquor, for the primer of nucleic acid amplification, to be P1 and P2, P1 and P2 be for the design of enterovirus gene group specific and conserved sequence the specific primer that filters out through preliminary experiment; In PCR reactant liquor, the oligonucleotide probe for fluorescence signal monitoring is Probe1,2,3, for the specific probe designed for enterovirus gene group specific and conserved sequence and filter out through preliminary experiment, wherein fluorescent reporter group X1For FAM, fluorescent quenching group Y1For Eclipse(in Table 1).
Table 1 detects primer and the probe sequence of enterovirus
| Title | Sequence |
| P1 | 5`-CCCTGAATGCGGCTAATC-3` |
| P2 | 5`-ATTGTCACCATAAGCAGCCA-3` |
| Probe1 | 5`-X1-CCGACTACTTTGGGWGTCCGTGT-Y1-3` |
| Probe2 | 5`-X1-AACTGCGGAGCACACGCCCAC-Y1-3` |
| Probe3 | 5`-X1-TAACTGCGGAGCRCGCACCCTC-Y1-3` |
It is a further object to provide this fluorescence PCR detection reagent kit application process detection enterovirus, including:
The PCR reaction system that test kit is selected is 20 �� l, including 2 �� PCR buffer 10 �� l, 10mmol/LdNTP1.0 �� l, 25 ��m of each 0.5 �� l of ol/L primer, 10 ��m of ol/L probe 0.2 �� l, reverse transcriptase and hot start Taq polymerase mixed liquor 0.8 �� l, sample RNA2 �� l, add aquesterilisa to whole system 20 �� l.
The PCR reaction cycle parameter of test kit is reverse transcription step: 42 DEG C, 10min; The denaturation stage: 94 DEG C, 10sec; Pre-amplification phase: degeneration 94 DEG C, 5sec; Anneal 50 DEG C, 20sec; Extend 72 DEG C, 20sec; Totally 5 circulations. Notice that this stage does not gather fluorescence signal. Detection-phase: degeneration 94 DEG C, 5sec; Anneal 56 DEG C, 50sec; Extend 72 DEG C, 15sec; Totally 40 circulations. Fluorescence signal is detected at annealing steps.
Quality control: experiment should set up positive and negative to compare every time, and negative control is without Ct value (or Ct value is 0), and positive control Ct value��30, otherwise experimental result is false.
Result interpretation:
Positive: " S " type amplification curve, Ct value��35 occur; Suspicious: appearance " S " type amplification curve, but Ct value > 35; Negative: " S " type amplification curve does not occur, although or curve exceeded threshold value, but in " S " type; To suspect results, should repeating experiment, if repeating experiment or " S " type amplification curve occur, negative control does not pollute, and can determine whether as the positive.
Sample requires: clinical sample type includes stool sample, herpes liquid, throat swab and viral cultures; Clinical sample should transport by band ice after gathering ,-20 DEG C of preservations, it is impossible to multigelation; RNA is extracted, it is proposed that adopting commercial kit stable and reliable for performance, concrete grammar is referring to corresponding commodity test kit description, and the RNA of extraction should detect immediately from clinical sample, otherwise, should by-80 DEG C��-20 DEG C preservations after RNA subpackage.
Test kit provided by the invention has good specificity, it is possible to the nucleic acid of detection enterovirus, but can not detect the nucleic acid of non-bowel viral pathogen; Monitoring lower-cut to enterovirus is the 10 every reaction systems of copy; Have only to 2 hours to complete detection, experimental basis can be provided for the disease surveillance of enterovirus and clinical diagnosis.
Accompanying drawing explanation
Fig. 1 is the amplification curve diagram of substance real-time PCR detection enterovirus sensitivity. The respectively enterovirus in vitro transcription rna ladder degree of 5 curves from left to right dilution after (2 �� 106-2��102Copies/ �� l) amplification. Abscissa is reaction cycle number, and vertical coordinate is the DRn value of different period fluorescent assay signal.
Fig. 2 is that enterovirus is detected specific amplification curve chart by substance real-time PCR detection system. There is S type amplification curve in enterovirus, and S type amplification curve all do not occur in other pathogenic microorganism Quality Control strains. Abscissa is reaction cycle number, and vertical coordinate is the DRn value of different period fluorescent assay signal.
Detailed description of the invention
The preferred embodiment of the present invention is described in detail below in conjunction with specific embodiment. It is pointed out that the embodiment listed here is merely exemplary descriptive purpose, and it should not be constructed as any limitation on the scope of the present invention. The reagent such as the test kit that wherein uses, buffer are only reagent specifically chosen in this specific embodiment, it should be appreciated that those skilled in the art can select the corresponding reagent of other companies to realize the purpose of the present invention as required.
The design of primer and TaqMan probe and synthesis
Utilizing Blast instrument that enterovirus genome sequence all of in Genbank and domestic and foreign literature is analyzed, select its stable conservative region as detection target sequence respectively, enterovirus detection target sequence is 5 ' UTR; And for this detection target sequence design and synthetic primer and probe (see table 1). Primer and probe are by the synthesis of TaKaRa Dalian treasured biotech firm of Japan, and wherein detection probe 5 ' the end flag F AM fluorophor of enterovirus, 3 ' hold labelling Eclipse fluorescent quenching groups.
The preparation of detection strain
The enterovirus used in the present embodiment and other negative control strains (adenovirus type III, 7 types, influenza virus A H1N1, AH3N2, AH7N9, Measles virus, rubella virus, haemadsorption virus 1, rhinovirus) all buy in Nat'l Pharmaceutical & Biological Products Control Institute.
The extracting of bacterial strain RNA
The nucleic acid extraction or the purified reagent QIAampDSPVirusSpinKit (state's tool is for 20140008QIAGENGmbH) that select the production of QIAGEN company of Germany extract strain RNA. Concrete steps reference reagent box operating instruction.
The screening of primer and probe
Adopt the primer of design and the geneome RNA of the enterovirus of probe Detection and Extraction respectively and negative control strain, through repeatedly testing, filter out primed probe combination (see sequence table, enterovirus forward primer P1, reverse primer P2 and probe Probe1,2,3) that sensitivity, specificity and repeatability are best.
The structure of standard substance and preparation
It is utilized respectively P1, P2 primer, RT-PCR expands enterovirus specific gene fragment, and it is cloned into the plasmid (such as pGEM-Teasyvector) containing T7 promoter sequence, use the RNAPolymerase of Dalian treasured biotech firm, synthesis RNA, add the pancreas DNA enzymatic I without RNase with cessative aspect responsive transcription outward, by with phenol: chloroform purifying RNA. Utilizing ultraviolet-uisible spectrophotometer to measure the absorptance at wavelength 260nm place, 280nm place respectively, then calculate RNA concentration and purity, then 10 times of gradient dilutions copy every microlitre to 200.
Reaction condition optimization
The key elements such as primer, probe, enzyme are optimized one by one, the reaction system determined is: 2 �� PCR buffer 10 �� l, 10mmol/LdNTP1.0 �� l, 25 ��m of each 0.5 �� l of ol/L primer, 10 ��m of ol/L probe 0.2 �� l, reverse transcriptase and hot start Taq polymerase mixed liquor 0.8 �� l, template 2ul, adds aquesterilisa to whole system 20 �� l.
Annealing temperature according to amplified fragments length, primer and probe and enzyme viability, mainly annealing temperature and extension time to reaction are optimized, and finally determine that loop parameter is: reverse transcription step: 42 DEG C, 10min; The denaturation stage: 94 DEG C, 10sec; Pre-amplification phase: degeneration 94 DEG C, 5sec; Anneal 50 DEG C, 20sec; Extend 72 DEG C, 20sec; Totally 5 circulations. Notice that this stage does not gather fluorescence signal. Detection-phase: degeneration 94 DEG C, 5sec; Anneal 56 DEG C, 50sec; Extend 72 DEG C, 15sec; Totally 40 circulations. Fluorescence signal is detected at annealing steps.
By identical conditions analytical data after amplification terminates, it is determined that the Ct value of each sample.
The evaluation of detection limit
Judge the detection limit of valency test kit provided by the invention with the positive criteria in above-mentioned 5, positive criteria product concentration is: 2 �� 106copies/��l��2��105copies/��l��2��104copies/��l��2��103copies/��l��2��102Copies/ �� l, the Monitoring lower-cut of enterovirus is the 10 every reaction systems of copy by test kit provided by the invention.
Detect specific evaluation
The specificity of this test kit is have rated with the strain RNA in above-mentioned 2 for template. Amplification curve clear and definite all as seen when enteroviral rna is detected, during to above-mentioned 9 kinds of other intestinals encountered pathogenic microorganism RNA detection, do not produce positive amplification curve, illustrate to be absent from cross reaction between probe and primer and other strains that we select that we use.
Although above in a preferred manner; some embodiment of the present invention is illustrated by specific embodiment; but it will be understood by a person skilled in the art that; the present invention is not limited to embodiment disclosed above; but according to the knowledge of the technical field of the invention, it can be modified, made an amendment without departing from the scope of protection of present invention. Such as, fluorescent real time PCR used in the present invention can also adopt the mark substance beyond the fluorescent reporter group and fluorescent quenching group pointed out in embodiment listed in description as required, such as labels such as Tet, HEX, TAMRA, ROX, Cy3, TxRd, JOE; Or use other labelling systems outside Taqman technology, for instance the fluorescent probe labelling techniques such as MGB probe, molecular beacon MB probe, scorpion shape probe, fluorescence double cross probe; Or use the saturable dyes such as unsaturated dyestuff and LCGreen such as the chimeric method such as SYBRGreenI of dyestuff, as long as it using specific primer sequence of the present invention, get final product qualitative or detection by quantitative genes of interest existence, and then detect the existence of enterovirus specifically. So, change and the replacement of customary means that these those skilled in the art are appreciated by also fall in protection scope of the present invention. Protection scope of the present invention should be defined by the appended claims.
Sequence table
<110>Jiangsu and wound bio tech ltd
Fourth, little quiet
<120>enterovirus fluorescence PCR detection reagent kit
<130>
<160>5
<170>PatentInversion3.3
<210>1
<211>18
<212>DNA
<213>artificial sequence
<220>
<221>primer_bind
<222>(1)..(18)
<223>primer sequence according to genome conserved regions design, for nucleic acid amplification and detection
<400>1
ccctgaatgcggctaatc18
<210>2
<211>20
<212>DNA
<213>artificial sequence
<220>
<221>primer_bind
<222>(1)..(20)
<223>primer sequence according to genome conserved regions design, for nucleic acid amplification and detection
<400>2
attgtcaccataagcagcca20
<210>3
<211>22
<212>DNA
<213>artificial sequence
<220>
<221>misc_binding
<222>(1)..(22)
<223>primer sequence according to genome conserved regions design, for nucleic acid amplification and detection
<400>3
ccgactactttgggwgtccgtg22
<210>4
<211>21
<212>DNA
<213>artificial sequence
<220>
<221>misc_binding
<222>(1)..(21)
<223>primer sequence according to genome conserved regions design, for nucleic acid amplification and detection
<400>4
aactgcggagcacacgcccac21
<210>5
<211>22
<212>DNA
<213>artificial sequence
<220>
<221>misc_binding
<222>(1)..(22)
<223>primer sequence according to genome conserved regions design, for nucleic acid amplification and detection
<400>5
taactgcggagcrcgcaccctc22
Claims (2)
1., for a test kit for enterovirus in specific detection sample, including PCR reactant liquor, enzyme mixation, negative quality-control product and positive quality control product, in PCR reactant liquor, the primer sequence for nucleic acid amplification reaction is as follows:
P1:5`-CCCTGAATGCGGCTAATC-3`,
P2:5`-ATTGTCACCATAAGCAGCCA-3`,
The sequence of the oligonucleotide probe monitored for fluorescence signal in PCR reactant liquor is as follows:
Probe1:5`-X1-CCGACTACTTTGGGWGTCCGTGT-Y1-3`,
Probe2:5`-X1-AACTGCGGAGCACACGCCCAC-Y1-3`,
Probe3:5`-X1-TAACTGCGGAGCRCGCACCCTC-Y1-3`,
Probe fluorescent reporter group X1For FAM, fluorescent quenching group Y1For Eclipse.
2. test kit as claimed in claim 1, it is further characterized in that PCR reaction system is 20 �� l, including 2 �� PCR buffer 10 �� l, 10mmol/LdNTP1.0 �� l, 25 ��m of each 0.5 �� l of ol/L primer, 10 ��m of ol/L probe 0.2 �� l, reverse transcriptase and hot start Taq polymerase mixed liquor 0.8 �� l, sample RNA2 �� l, add aquesterilisa to whole system 20 �� l.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610019626.6A CN105624331A (en) | 2016-01-13 | 2016-01-13 | Fluorescent PCR detection kit for intestinal viruses |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610019626.6A CN105624331A (en) | 2016-01-13 | 2016-01-13 | Fluorescent PCR detection kit for intestinal viruses |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105624331A true CN105624331A (en) | 2016-06-01 |
Family
ID=56039673
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610019626.6A Pending CN105624331A (en) | 2016-01-13 | 2016-01-13 | Fluorescent PCR detection kit for intestinal viruses |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105624331A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101638693A (en) * | 2008-07-30 | 2010-02-03 | 中山大学达安基因股份有限公司 | Kit for detecting human enteric viruses by real-time fluorescent quantitative PCR |
| CN101724717A (en) * | 2010-02-02 | 2010-06-09 | 北京爱普益生物科技有限公司 | Enterovirus universal nucleic acid detection kit and detection method |
| CN102154520A (en) * | 2011-03-31 | 2011-08-17 | 江苏硕世生物科技有限公司 | Enterovirus CoxA 16/EV 71/universal nucleic acid detection kit |
-
2016
- 2016-01-13 CN CN201610019626.6A patent/CN105624331A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101638693A (en) * | 2008-07-30 | 2010-02-03 | 中山大学达安基因股份有限公司 | Kit for detecting human enteric viruses by real-time fluorescent quantitative PCR |
| CN101724717A (en) * | 2010-02-02 | 2010-06-09 | 北京爱普益生物科技有限公司 | Enterovirus universal nucleic acid detection kit and detection method |
| CN102154520A (en) * | 2011-03-31 | 2011-08-17 | 江苏硕世生物科技有限公司 | Enterovirus CoxA 16/EV 71/universal nucleic acid detection kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hodneland et al. | Sensitive and specific detection of Salmonid alphavirus using real-time PCR (TaqMan®) | |
| Piralla et al. | Clinical severity and molecular typing of human rhinovirus C strains during a fall outbreak affecting hospitalized patients | |
| CN111363860A (en) | Nucleic acid composition for detecting novel coronavirus COVID-19 and application | |
| US20230340624A1 (en) | Detection reagents for severe acute respiratory syndrome coronavirus 2 and detection methods | |
| CN103642936B (en) | The specific detection of 55 type adenoviruss primed probe combination and test kit | |
| CN108315483B (en) | Combination of primers and probes for distinguishing wild strains and vaccine strains of duck tembusu virus | |
| WO2021180631A1 (en) | Compositions and methods for detecting severe acute respiratory syndrome coronavirus 2 (sars-cov-2), influenza a and influenza b | |
| CN112011650B (en) | Chinese bee sacbrood virus RT-RPA detection primer, probe and kit | |
| CN107699635B (en) | Fluorescent RPA (reverse transcriptase amplification) detection method for porcine epidemic diarrhea virus | |
| CN104195264A (en) | Nucleic acid test kit for rapidly detecting Coxsackie virus A6 type/A10 type and application thereof | |
| CN109371174A (en) | Middle East respiration syndrome coronavirus fluorescence PCR detection reagent kit | |
| CN103484568B (en) | Method and kit for dual fluorescence quantitative PCR detection of grass carp reovirus types I and II | |
| CN102634610B (en) | The specific detection of Measles virus and rubella virus primed probe combination and test kit | |
| US11248272B2 (en) | Methods and compositions for influenza a virus subtyping | |
| CN106755574B (en) | A kind of real-time fluorescence quantitative PCR detection kits of highly sensitive OsHV 1 and method | |
| US20230250497A1 (en) | One-step nested pcr primers set and kit modified with locked nucleic acid for detecting african swine fever virus | |
| CN105624285A (en) | Mycoplasma pneumoniae fluorescent PCR detection reagent kit | |
| CN105624286A (en) | Legionella pneumophila fluorescence PCR detection kit | |
| CN105624284A (en) | Klebsiella pneumonia fluorescent PCR detection reagent kit | |
| CN105671209A (en) | Primers, probe, kit and method for detecting bovine coronavirus | |
| CN113046481B (en) | Primer, probe and kit for quantitative fluorescence detection of pigeon adenovirus B | |
| Hu et al. | Development of a real-time RT-PCR assay for detection and quantitation of parainfluenza virus 3 | |
| CN105624331A (en) | Fluorescent PCR detection kit for intestinal viruses | |
| CN110872638B (en) | Specific primer, probe and rapid detection kit for detecting macrobrachium nipponense stem cover virus-1 | |
| CN107227380A (en) | The primer sequence and method of a kind of synchronous detection PCV2 and PRV infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160601 |
|
| RJ01 | Rejection of invention patent application after publication |