AU2020104066A4

AU2020104066A4 - Double fluorescent quantitative RT-PCR detection method for Classical swine fever virus and Bovine viral diarrhea virus

Info

Publication number: AU2020104066A4
Application number: AU2020104066A
Authority: AU
Inventors: Jing Chen; Shumin Chen; Yujie Li; Shengfu Sun; Fulin TIAN; Ye Tian; Guisheng Wang; Xuehua Wei; Hexiao Zhang; Yue Zhang
Original assignee: SHANDONG PROVINCIAL CENTER FOR ANIMAL DISEASE CONTROL AND PREVENTION
Current assignee: SHANDONG PROVINCIAL CENTER FOR ANIMAL DISEASE CONTROL AND PREVENTION
Priority date: 2020-12-14
Filing date: 2020-12-14
Publication date: 2021-02-25
Anticipated expiration: 2028-12-14

Abstract

Disclosed relates to a double fluorescent quantitative RT-PCR detection method for a Classical swine fever virus and a Bovine viral diarrhea virus, and belongs to the technical field of fluorescent quantitative RT-PCR. The detection method uses two sets of primers and probes; the sequence of an amplification product of the first set of primers and probe is uniquely consistent with a conserved region of a Classical swine fever virus gene sequence, and the sequence of an amplification product of the second set of primers and probe is uniquely consistent with a conserved region of a BVDV gene sequence; in addition, the CSFV probe P only appears in the amplification product consistent with the conserved region of the Classical swine fever virus gene sequence, and the BVDV probe P only appears in the amplification product consistent with the conserved region of the Bovine viral diarrhea virus gene sequence (each set of primers and probe can eliminate the interference of the other set of primers and probe). Therefore, the detection method can distinguish CSFV and BVDV, and can simultaneously detect the Classical swine fever virus and the Bovine viral diarrhea virus. (Fig. 1) Drawings IIM 0 7m OIL Fig.1I kin INf acra Fig. 2

Description

Drawings

IIM

0 7m

OIL

Fig.1I

kin

INf acra

Fig. 2

DOUBLE FLUORESCENT QUANTITATIVE RT-PCR DETECTION METHOD FOR CLASSICAL SWINE FEVER VIRUS AND BOVINE VIRAL DIARRHEAVIRUS

Field of the Invention

The present invention relates to a double fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection method for a Classical swine fever virus and a Bovine viral diarrhea virus, and belongs to the technical field of fluorescent quantitative RT-PCR.

Background of the Invention

Classical swine fever virus (CSFV) and Bovine viral diarrhea virus (BVDV) both belong to the genus Pestivirus in the family Flaviviridae. For a long time, the infectious diseases caused by them have caused huge economic losses to the cattle, swine and sheep breeding industries. BVDV is widely distributed around the world. Animals such as goats, sheep, swine, deer and wallabies are the host and infection source of BVDV. The nucleotide sequences of BVDV and CSFV have about 60% homology, and their amino acids have about 85% homology. Polyclonal antibodies have serological cross reaction with the two viruses. First, CSFV and BVDV infect swine under natural conditions, and their clinical symptoms and pathological changes are similar. Second, in the production of veterinary vaccines, bovine-derived materials such as bovine serum, bovine testicular cells, and pancreatin are often used as raw materials; once these raw materials are contaminated by BVDV, vaccine products are inevitably contaminated; and especially after swine vaccines are contaminated by BVDV, an immune swine infection will be caused, resulting in clinical symptoms similar to a swine fever, which will bring difficulties to the diagnosis of swine fever and also become a pollution source.

CN101058830A discloses "Fluorescent Quantitative Diagnosis Kit for Classical Swine Fever Virus", and CN101328506A discloses "Fluorescent Quantitative Rapid Diagnosis Kit for Specific Detection of Classical Swine Fever Virus Wild Virus

Infection and Application Method thereof'. Both documents only test CSFV separately. OIE published a primer probe sequence for detecting BVDV, which was annotated by failing to distinguish Classical swine fever virus. CN103397107A discloses "Fluorescent Quantitative Detection Kit for Bovine Viral Diarrhea Virus", but only tests BVDV separately. Clinical test results show that the existing CSFV or BVDV fluorescent quantitative RT-PCR kits cannot distinguish CSFV and BVDV. At present, the joint detection method for CSFV and BVDV infection has not been perfect, the detection of swine BVDV is still in the exploratory stage, and there is no relevant reagent that can simultaneously detect the Classical swine fever virus and the Bovine viral diarrhea virus.

Summary of the Invention

Based on the fact that CSFV and BVDV have similar gene sequences and ordinary RT-PCR cannot distinguish the two, the purpose of the present invention is to provide a double fluorescent quantitative RT-PCR detection method capable of distinguishing a Classical swine fever virus and a Bovine viral diarrhea virus.

Technical solution

A set of primers and probes for fluorescent quantitative RT-PCR detection consists of a first set of primers and probe or/and a second set of primers and probe;

The first set of primers and probe are:

CSFV-F: ATACATAAAGCCCGGCCCTG, as shown in SEQ ID No. 1;

CSFV-R: CTTGCCATCACTACCCGTGA, as shown in SEQ ID No. 2;

CSFV probe P: FAM-CCAGGACTACATGGGCCCAGTCTATCAC-BHQ1, as shown in SEQ ID No. 3;

The second set of primers and probe are:

BVDV-F: AGCAACAGTGGTGAGTTCGT, as shown in SEQ ID No. 4;

BVDV-R: CGTGGCATCTCGAGACCTTT, as shown in SEQ ID No. 5;

BVDV probe P: HEX\VIC-ATGGCTTAAGCCCTGAGTACA-BHQ1, as shown in SEQ ID No. 6.

The above-mentioned primers and probes of the present invention: wherein the first set of primers and probe are used to amplify a specific sequence of a Classical swine fever virus, and the second set of primers and probe are used to amplify a specific sequence of a Bovine viral diarrhea virus. The sequence of the amplification product of the first set of primers and probe is uniquely consistent with a conserved region (533bp-671bp) of a Classical swine fever virus gene sequence; and the sequence of the amplification product of the second set of primers and probe is uniquely consistent with a conserved region (142bp-237bp) of a BVDV gene sequence. The above-mentioned primers of the present invention for fluorescent quantitative RT-PCR detection can distinguish CSFV and BVDV, and solve the technical problem that the existing CSFV or BVDV fluorescent quantitative RT-PCR kit cannot distinguish CSFV and BVDV.

A double fluorescent quantitative RT-PCR detection reagent for a Classical swine fever virus and a Bovine viral diarrhea virus contains the above-mentioned primers and probes.

The above-mentioned detection reagent consists of:

DEPC H2 0: 2.75 ul

5 x Buffer: 2.5 ul

10 x Buffer: 1.25 ul

2.5 mM dNTP: 2 ul

CSFV-F: 0.5 ul

CSFV-R: 1 ul

CSFV probe P: 0.5 ul

BVDV-F: 0.5 ul

BVDV-R: 1 ul

BVDV probe P: 0.5 ul

20 uM MgCl2:1.5 ul

enzyme mixture: 1 ul;

wherein the concentrations of the CSFV-F, CSFV-R, CSFV probe P, BVDV-F, BVDV-R, and BVDV probe P are all 10 mol/L.

The above-mentioned detection reagent is in an amount for detecting a piece of sample.

A double fluorescent quantitative RT-PCR detection method for a Classical swine fever virus and a Bovine viral diarrhea virus includes:

preparing a 25 ul reaction system from 10 ul of nucleic acid of a sample to be tested and 15 ul of the above-mentioned detection reagent, then performing fluorescent quantitative RT-PCR, and reading results;

wherein the fluorescent quantitative RT-PCR includes:

stage one: reverse transcription 42°C/30 min;

stage two: pre-denaturation 94°C/3 min; stage three: 92°C/15 sec, 45°C/30 sec, 72°C/60 sec, a total of 5 cycles; stage four: 92°C/10 sec, 56°C/60 sec, a total of 40 cycles; last 40°C/10 sec; wherein fluorescence is collected during annealing 56°C extension of each cycle in stage four; wherein the read results are: if an FAM detection channel shows an "S"-shaped amplification curve, and a Ct value is less than or equal to 30, then the sample contains CSFV; and if an HEX\VIC detection channel shows an "S"-shaped amplification curve, and a Ct value is less than or equal to 30, then the sample contains BVDV.

The above-mentioned detection method,

the primers and probe used to amplify a specific sequence of the Classical swine fever virus are: primer CSFV-F, primer CSFV-R and CSFV probe P; and

the primers and probe used to amplify a specific sequence of the Bovine viral diarrhea virus are: primer BVDV-F, primer BVDV-R and BVDV probe P.

The amplification products obtained by the above-mentioned detection method are sequenced, the CSFV probe P only appeared in the amplification product consistent with a conserved region (533bp-671bp) of a Classical swine fever virus gene sequence, and the BVDV probe P only appeared in the amplification product consistent with a conserved region (142bp-237bp) of a Bovine viral diarrhea virus gene sequence. It shows that each set of primers and probe can eliminate the interference of the other set of primers and probe; therefore, the detection method of the present invention can simultaneously detect the Classical swine fever virus and the

Bovine viral diarrhea virus.

Advantages

The above-mentioned primers of the present invention for fluorescent quantitative RT-PCR detection can distinguish CSFV and BVDV. The detection method of the present invention can simultaneously detect the Classical swine fever virus and the Bovine viral diarrhea virus.

In the detection method of the present invention, the double fluorescent quantitative RT-PCR detection method for the Classical swine fever virus and the Bovine viral diarrhea virus uses a viral RNA column extraction kit, so the extraction time is short, and the entire detection process is less than 3 hours. Because of closed tube reaction, the kit is directly treated after detection, which avoids aerosol pollution caused by opening. The process is simple, the detection time is short, and the sensitivity is high.

Brief Description of the Drawings

Figs. 1 and 2 are amplification result diagrams of specificity experiments; the "S" curve in Fig. 1 is an amplification curve of CSFV, the "S" curve in Fig. 2 is an amplification curve of BVDV, and the straight lines in Figs. 1 and 2 are negative test results of a Porcine reproductive and respiratory syndrome virus, a Porcine epidemic diarrhea virus, a Transmissible gastroenteritis virus and a negative control;

Figs. 3 and 4 are amplification result diagrams of repeatability experiments; the "S" curves in Fig. 3 are amplification curves of different strains of Classical swine fever virus, the "S" curves in Fig. 4 are amplification curves of different strains of Bovine viral diarrhea virus, and the straight lines in Figs. 3 and 4 are test results of negative controls; and

Figs. 5 and 6 are amplification result diagrams of sensitivity experiments; the "S" curves in Fig. 5 are amplification curves of Classical swine fever virus with different concentrations, the four curves from top to bottom are amplification curves of CSFV sequentially diluted 10-1, 10-2, 10-3 and 10-4 times, the amplification curves of CSFV diluted 10-5 and 10-6 times are straight lines, and the test result of a negative control is a straight line; the "S" curves in Fig. 6 are amplification curves of BVDV with different concentrations, the 5 curves from top to bottom are amplification curves of BVDV sequentially diluted 10-1, 10-2, 10-3, 10-4 and 10-5 times, the amplification curve of BVDV diluted 10-6 times is a straight line, and the test result of a negative control is a straight line; thus, it can be seen that the test results of CSFV diluted 10-5 and 10-6 times are negative, and the test result of BVDV diluted 10-6 times is negative.

Detailed Description of the Embodiments

In this specific embodiment, the Classical swine fever virus involved was isolated and identified from diseased swine from January 2015 to July 2016 as recorded, and is now collected in the Shandong Animal Disease Prevention and Control Center.

The Bovine viral diarrhea virus involved was isolated and identified from diseased swine from January 2013 to July 2014 as recorded, and is now collected in the Shandong Animal Disease Prevention and Control Center.

The Porcine reproductive and respiratory syndrome virus involved was isolated and identified from diseased swine from January 2015 to July 2016 as recorded, and is now collected in the Shandong Animal Disease Prevention and control center.

The Porcine epidemic diarrhea virus involved was isolated and identified from diseased swine from January 2015 to July 2016 as recorded, and is now collected in the Shandong Animal Disease Prevention and Control Center.

The Transmissible gastroenteritis virus involved was isolated and identified from diseased swine from January 2015 to July 2016 as recorded, and is now collected in the Shandong Animal Disease Prevention and Control Center.

Design of primers and probes

Primers and a probe used to amplify a specific sequence of a Classical swine fever virus were:

Forward primer CSFV-F: ATACATAAAGCCCGGCCCTG, as shown in SEQ ID No. 1;

Reverse primer CSFV-R: CTTGCCATCACTACCCGTGA, as shown in SEQ ID No. 2;

CSFV probe P: FAM-CCAGGACTACATGGGCCCAGTCTATCAC-BHQ1, as shown in SEQ ID No. 3;

Primers and a probe used to amplify a specific sequence of a Bovine viral diarrhea virus were:

Forward primer BVDV-F: AGCAACAGTGGTGAGTTCGT, as shown in SEQ ID No. 4;

Reverse primer BVDV-R: CGTGGCATCTCGAGACCTTT, as shown in SEQ ID No. 5;

BVDV probe P: HEX\VIC-ATGGCTTAAGCCCTGAGTACA-BHQ1, as shown in SEQ ID No. 6.

Specificity test

1.2.1

Original virus liquids of CSFV and BVDV were selected, and 200 ul each was put in a 1.5 ml centrifuge tube. Nucleic acids of the virus liquids were respectively extracted by means of viral RNA column extraction kits of Beijing SCENK Biological Technology Development Co., Ltd. with reference to the instructions.

At the same time, virus liquids of 3 Porcine reproductive and respiratory syndrome virus strains, 3 Porcine epidemic diarrhea virus strains, and 3 Transmissible gastroenteritis virus strains, a total of 9 strains stored in the laboratory were selected. 200 ul each of virus liquids of the 9 strains was put in a 1.5 ml centrifuge tube, and nucleic acids of the 9 virus liquids were extracted by means of viral RNA column extraction kits of Beijing SCENK Biological Technology Development Co., Ltd. with reference to the instructions.

The nucleic acids of the above-mentioned 3 Porcine reproductive and respiratory syndrome virus strains, 3 Porcine epidemic diarrhea virus strains and 3 Transmissible gastroenteritis virus strains and the nucleic acids of a Classical swine fever virus and a Bovine viral diarrhea virus were tested as follows:

15 ul of a reaction solution prepared was respectively added with 10 ul of the above-mentioned nucleic acids, and a 25 ul reaction system was finally prepared. The formula of the reaction solution was shown as Table 1:

Table 1

Composition Amount (uL) 10 mol/L CSFV-F 0.5 10 mol/L CSFV-R 1 10 mol/L CSFV probe P 0.5 10 mol/L BVDV-F 0.5 10 tmol/L BVDV-R 1 10 mol/L BVDV probe P 0.5 DEPC H2 0 2.75 10 x Buffer 1.25 5 x Buffer 2.5 MgCl 2 (20 mmol/L) 1.5 dNTP (25 mmol/L) 2 Enzyme mixture 1

The reaction system was put on a machine for fluorescent quantitative RT-PCR, and then results were read. Reaction parameters of the fluorescent quantitative PCR were set as follows: stage one: reverse transcription 42°C/30 min; stage two: pre-denaturation 94°C/3 min; stage three: 92°C/15 sec, 45°C/30 sec, 72°C/60 sec, a total of 5 cycles; stage four: 92°C/10 sec, 56°C/60 sec, a total of 40 cycles; last 40°C/10 sec;

Fluorescence was collected during annealing 56°C extension of each cycle in stage four.

Result reading: for a multi-channel PCR instrument, the results were respectively read by means of an FAM (465-510) channel and an HEX\VIC (533-580) channel; and if an ABI instrument was used, the results were read by means of a channel corresponding to an FAM fluorescein and a channel corresponding to an HEX fluorescein without fluorescence quenching groups.

The present invention used the multi-channel PCR instrument (including an ABI instrument): an "S" amplification curve appeared in the FAM (465-510) channel, as shown in Fig. 1. Because the probe for detecting CSFV was labeled by the FAM fluorescein, the fluorescent signal received in the FAM (465-510) channel was an amplification curve of an amplification product labeling the FAM fluorescein probe, which was an amplification curve of CSFV. An "S" amplification curve appeared in the HEX\VIC (533-580) channel, as shown in Fig. 2. Because the probe for detecting BVDV was labeled by the HEX fluorescein, the fluorescent signal received in the HEX (533-580) channel was an amplification curve of an amplification product labeling the HEX fluorescein probe, which was an amplification curve of BVDV. The amplification products in the reaction system were sequenced; wherein, the sequence of the amplification product labeled with the CSFV probe P was: atac ataaagcccg gccctgtcta ctaccaggac tacatgggcccagtctatca cagagctcct ttagagttct ttgatgaggc ccagttctgc gaggtgacta agagaatagg cagggtcacg ggtagtgatg gcaag, as shown in SEQ ID No. 7, and this sequence was uniquely consistent with a conserved region (533bp-671bp) of a swine fever virus gene sequence; and the sequence of the amplification product labeled with the BVDV probe P was: agcaacagtg gtgagttcgt tggatggctt aagccctgag tacagggtag tcgtcagtgg ttcgacgcct tggaataaag gtctcgagat gccacg, as shown in SEQ ID No. 8, and this sequence was uniquely consistent with a conserved region (142bp-237bp) of a BVDV gene sequence. It showed that the primers CSFV-F and CSFV-R and the CSFV probe P can specifically amplify the conserved region of the CSFV gene sequence. The "S" curve in Fig. 1 is a change curve of amount of the amplification product of the conserved region of the CSFV gene sequence. The primers BVDV-F and BVDV-R and the BVDV probe P can specifically amplify the conserved region of the BVDV gene sequence. The "S" curve in Fig. 2 is a change curve of amount of the amplification product of the conserved region of the BVDV gene sequence. The primers CSFV-F and CSFV-R and the CSFV probe P, the primers BVDV-F and BVDV-R and the BVDV probe P did not amplify the Porcine reproductive and respiratory syndrome virus, the Porcine epidemic diarrhea virus, and the Transmissible gastroenteritis virus. The double fluorescent quantitative RT-PCR for the Swine fever virus and the Bovine viral diarrhea virus cannot detect the Porcine reproductive and respiratory syndrome virus, the Porcine epidemic diarrhea virus and the Transmissible gastroenteritis virus that were easily confused, and thereof had good specificity.

In addition, the CSFV probe P only appeared in the amplification product consistent with the conserved region (533bp-671bp) of the Classical swine fever virus gene sequence, and the BVDV probe P only appeared in the amplification product consistent with the conserved region (142bp-237bp) of the Bovine viral diarrhea virus gene sequence, indicating that each set of primers and probe can eliminate the interference of the other set of primers and probe.

Repeatability test

10 identified Classical swine fever virus strains and 3 identified swine Bovine viral diarrhea virus strains were selected. 200 ul each of virus liquids of the 10 CSFV virus strains were put into 10 different 1.5 ml centrifuge tubes; 200 ul each of virus liquids of the 3 BVDV strains (2 BVDV-1 strains and 1 BVDV-2 strain) were put into 1.5 ml centrifuge tubes; and nucleic acids of the 13 virus liquids were extracted by means of viral RNA column extraction kits of Beijing SCENK Biological Technology Development Co., Ltd. with reference to the instructions. The nucleic acids of the 10 Classical swine fever virus strains and the nucleic acids of the 3 Bovine viral diarrhea virus strains were mixed and divided into 30 parts, and finally 30 parts of nucleic acid mixed with the two virus liquids were formed; and the mixed nucleic acid of the two virus liquids was regarded as a template for fluorescent quantitative RT-PCR. The fluorescence quantitative RT-PCR used a system of 15 ul reaction solution and 10 ul template, a total of 25 ul; and the formula of the reaction solution was shown in Table 1.

15 ul of the prepared reaction solution was taken and added with 10 ul of the mixed nucleic acid of the two virus liquids, a 25 ul reaction system was finally prepared, a negative control (15 ul reaction solution + 10 ul DEPC water) was set at the same time, a fluorescent quantitative RT-PCR was performed by means of a multi-channel PCR instrument, and then the results were read. Reaction parameters of the fluorescent quantitative RT-PCR were set as follows:

stage one: reverse transcription 42°C/30 min;

stage two: pre-denaturation 94°C/3 min;

stage three: 92°C/15 sec, 45°C/30 sec, 72°C/60 sec, a total of 5 cycles,

stage four: 92°C/10 sec, 56°C/60 sec, a total of 40 cycles;

last 40°C/10 sec;

Result reading: the results were read by means of an FAM (465-510) channel, as shown in Fig. 3; and the results were read by means of an HEX\VIC (533-580) channel, as shown in Fig. 4. It can be seen from Fig. 3 that the 10 different strains of Classical swine fever virus can be tested positive, and the results were within a controllable range; thus, the double fluorescent quantitative RT-PCR was relatively stable for the detection of Classical swine fever virus. It can be seen from Fig. 4 that the 3 Bovine viral diarrhea viruses can be tested positive, and the results were within a controllable range; thus, the double fluorescent quantitative RT-PCR was relatively stable for the detection of Bovine viral diarrhea virus.

Sensitivity test

1 identified and purified Classical swine fever virus strain and 1 identified and purified swine Bovine viral diarrhea virus strain were selected, nucleic acids were extracted by means of an operation process of viral RNA column extraction kits, OD260 were measured by means of a full-wavelength microplate reader (SpectraMax@ i3x), the concentrations of the nucleic acids were calculated by means of OD260/280 and respectively were 40.748 ng/ul (CSFV) and 39.803 ng/ul (BVDV), and the virus liquids were diluted by 10-1, 10-2, 10-, 10-4, 10-5, and 10-6 times. 10 ul each of the nucleic acids of the virus liquids with the same dilution concentration were mixed thoroughly, 6 parts of mixed nucleic acid of the two virus liquids of different dilutions were finally formed, and the mixed nucleic acid of the two virus liquids of different dilutions was used as a template for fluorescent quantitative RT-PCR. The fluorescence quantitative RT-PCR used a system of 15 1 reaction solution and 10 1 template, a total of 25 l; and the formula of the reaction solution was shown in Table 1.

15 ul of the prepared reaction solution was taken and added with 10 ul of the mixed nucleic acid of the three bacteria, and a 25 ul reaction system was finally prepared; a negative control (15 ul reaction solution + 10 ul DEPC water) was set at the same time, a fluorescent quantitative PCR was performed by means of a multi-channel PCR instrument, and then the results were read. Reaction parameters of the fluorescent quantitative PCR were set as follows:

stage one: reverse transcription 42°C/30 min;

stage two: pre-denaturation 94°C/3 min; stage three: 92°C/15 sec, 45°C/30 sec, 72°C/60 sec, a total of 5 cycles; stage four: 92°C/10 sec, 56°C/60 sec, a total of 40 cycles; last 40°C/10 sec;

Result reading: the results were read by means of an FAM (465-510) channel, as shown in Fig. 5; and Fig. 5 shows that the detection limit of CSFV is 40.748 pg/ul. The results were read by means of HEX\VIC (533-580), as shown in Fig. 6; and Fig. 6 shows that the detection limit of BVDV is 3.9803 pg/ul. Compared with the existing fluorescent quantitative RT-PCR detection reagents that cannot distinguish CSFV and BVDV, the sensitivity of the double fluorescent RT-PCR kit of the present invention was not reduced.

Claims

1. A set of primers and probes for fluorescent quantitative RT-PCR detection, characterized by consisting of a first set of primers and probe or/and a second set of primers and probe; wherein the first set of primers and probe are: CSFV-F: ATACATAAAGCCCGGCCCTG, as shown in SEQ ID No. 1; CSFV-R: CTTGCCATCACTACCCGTGA, as shown in SEQ ID No. 2; CSFV probe P: FAM-CCAGGACTACATGGGCCCAGTCTATCAC-BHQ1, as shown in SEQ ID No. 3; wherein the second set of primers and probe are: BVDV-F: AGCAACAGTGGTGAGTTCGT, as shown in SEQ ID No. 4; BVDV-R: CGTGGCATCTCGAGACCTTT, as shown in SEQ ID No. 5; BVDV probe P: HEX\VIC-ATGGCTTAAGCCCTGAGTACA-BHQ1, as shown in SEQ ID No. 6.

2. The primers and probes according to claim 1, characterized by consisting of the first set of primers and probe and the second set of primers and probe.

3. A double fluorescent quantitative RT-PCR detection reagent for a Classical swine fever virus and a Bovine viral diarrhea virus, characterized by containing the primers and probes according to claim 2.

4. The detection reagent according to claim 3, characterized by consisting of: DEPC H2 0: 2.75 ul 5 x Buffer: 2.5 ul 10 x Buffer: 1.25 ul 2.5 mM dNTP: 2 ul CSFV-F: 0.5 ul CSFV-R: 1 ul CSFV probe P: 0.5 ul BVDV-F: 0.5 ul BVDV-R: 1 ul BVDV probe P: 0.5 ul

20 uM MgCl2:1.5 ul enzyme mixture: 1 ul; wherein the concentrations of the CSFV-F, CSFV-R, CSFV probe P, BVDV-F, BVDV-R, and BVDV probe P are all 10 mol/L.

5. A double fluorescent quantitative RT-PCR detection method for a Classical swine fever virus and a Bovine viral diarrhea virus, characterized by using the detection reagent according to claim 3 or 4, and comprising: preparing a 25 ul reaction system from 10 ul of nucleic acid of a sample to be tested and 15 ul of the detection reagent, then performing fluorescent quantitative RT-PCR, and reading results; wherein the fluorescent quantitative RT-PCR comprises: stage one: reverse transcription 42°C/30 min; stage two: pre-denaturation 94°C/3 min; stage three: 92°C/15 sec, 45°C/30 sec, 72°C/60 sec, a total of 5 cycles; stage four: 92°C/10 sec, 56°C/60 sec, a total of 40 cycles; last 40°C/10 sec; wherein fluorescence is collected during annealing 56°C extension of each cycle in stage four; wherein the reading results are: if an FAM detection channel shows an "S"-shaped amplification curve, and a Ct value is less than or equal to 30, then the sample contains CSFV; and if an HEX\VIC detection channel shows an "S"-shaped amplification curve, and a Ct value is less than or equal to 30, then the sample contains BVDV.

6. The detection method according to claim 5, characterized in that, the primers and probe used to amplify a specific sequence of the Classical swine fever virus are: primer CSFV-F, primer CSFV-R and CSFV probe P; and the primers and probe used to amplify a specific sequence of the Bovine viral diarrhea virus are: primer BVDV-F, primer BVDV-R and BVDV probe P.

Ref: CN106521030A Drawings 2020104066

Fig. 1

Fig. 2

1

1/3