CN101724716B - Enterovirus 71 nucleic acid detection kit and detection method - Google Patents
Enterovirus 71 nucleic acid detection kit and detection method Download PDFInfo
- Publication number
- CN101724716B CN101724716B CN2010101050885A CN201010105088A CN101724716B CN 101724716 B CN101724716 B CN 101724716B CN 2010101050885 A CN2010101050885 A CN 2010101050885A CN 201010105088 A CN201010105088 A CN 201010105088A CN 101724716 B CN101724716 B CN 101724716B
- Authority
- CN
- China
- Prior art keywords
- enterovirus
- quality control
- pcr
- pcr reaction
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an enterovirus 71 nucleic acid detection kit and a detection method thereof. The kit comprises PCR reaction enzymes, PCR reaction solution negative quality control material and positive quality control material, wherein the PCR reaction enzymes comprise hot-start Tap enzyme, MLV reverse transcriptase and RNA enzyme inhibitor, and the PCR reaction solution comprises DEPC treated water, dNTPs, 10*PCR Buffer, an enterovirus 71 forward primer, an enterovirus 71 reverse primer and an enterovirus 71 probe. The sequence of the enterovirus 71 forward primer is 5'-TAGCTTTGATGCAGAGTTGC-3'; the sequence of the enterovirus 71 reverse primer is 5'-GAGCAATTGTGGGACRAYTTC-3'; and the sequence of the enterovirus 71 probe is 5'TTTGTTGCGTGCGCACCCGTTC-3'. The negative quality control material is the DEPC treated water; and the positive quality control material is prepared in vitro transcription RNA. The invention employs real-time fluorescence quantitative PCR technology to detect enterovirus 71 nucleic acid sequence and has the advantages of specificity, sensitivity, fast detection and convenient operation.
Description
Technical field
The invention belongs to biological technical field, disclose a kind of enterovirus 71 nucleic acid detection kit and detection method.
Background technology
Hand foot mouth disease (Hand; Foot and mouth disease; HFMD) be that (pilosity is born in children below 5 years old for Enterovirus, the transmissible disease that EV) causes by enterovirus; Can cause the bleb at positions such as hand, foot, oral cavity, the minority infant can cause complication such as myocarditis, wet lung, AME.Indivedual severe infant PD are fast, cause death.The enterovirus that causes hand foot mouth disease has kind more than 20; 16,4,5,9,10 types of CA group; 2,5 types of B group, and enterovirns type 71 is the more common pathogenic agent of hand foot mouth disease, wherein (Coxsackieviruses 16 with coxsackie virus A 16-type; CA16) and enterovirns type 71 (Enterovirus 71, and is EV71) common.
The specificity diagnostic method of enterovirus infection has three kinds, and promptly viral isolation identification, serology detect and Protocols in Molecular Biology.The separation and Culture and the serological method of virus, numerous and diverse time-consuming, can't satisfy the needs of handling great amount of samples during the viral prevalence simultaneously.Molecular biological progress has been opened up the quick diagnosis technology, particularly round pcr of enterovirus, because its test material consumption is few, quick, highly sensitive and have very high specificity, and the increasing vital role of performance in the diagnosis of virus infection.RT-polymerase chain reaction (RT-PCR) technology has become the important means of enterovirus infection quick diagnosis.Traditional RT-PCR Technology Need two-step reaction, whole process need 6-8 hour, time loss was big, can not satisfy the outburst detection demand in period; In addition, also there is the risk of crossed contamination in this technology, and false positive results inevitably appears in the test experience chamber after for some time.The real-time fluorescence quantitative PCR technology; Be in the PCR reaction system, to add fluorophor; Utilize the fluorescent signal accumulation whole PCR process of monitoring in real time, the method for through typical curve unknown template being carried out quantitative analysis is at last compared with conventional PCR; It has specificity and more by force, effectively solves characteristics such as PCR pollution problem, level of automation height, is used widely at present.
Summary of the invention
The objective of the invention is defective, provide a kind of and utilized the real-time fluorescence quantitative PCR technology and have enterovirus 71 nucleic acid detection kit and detection method special, sensitive, quick, easy and simple to handle to above-mentioned prior art.
The technical scheme taked of the present invention is to achieve these goals: a kind of enterovirus 71 nucleic acid detection kit is provided, and this test kit contains:
(1) .PCR reaction enzymes is comprising warm start Taq enzyme, MLV reversed transcriptive enzyme, RNA enzyme inhibitors;
(2) .PCR reaction solution is comprising DEPC treating water, dNTPs, 10 * PCR Buffer, enterovirns type 71 forward primer, enterovirns type 71 reverse primer, enterovirns type 71 probe;
Enterovirns type 71 forward primer sequence is shown in SEQ ID NO.1 in the sequence table: 5 '-TAGCTTTGATGCAGAGTTGC-3 ',
Enterovirns type 71 reverse primer sequence is shown in SEQ ID NO.2 in the sequence table: 5 '-GAGCAATTGTGGGACRAYTTC-3 ',
The enterovirns type 71 probe sequence is shown in SEQ ID NO.3 in the sequence table: 5 '-TTTGTTGCGTGCACACCCATTC-3 ';
(3). negative quality control product is the DEPC treating water;
(4). positive quality control product, for adopting the in-vitro transcription RNA of t7 rna polymerase preparation.
Said probe 5 ' end flag F AM (fluorescence report group), 3 ' end mark ECLIPSE (fluorescent quenching group).
The proportioning of each component concentration is in the said PCR reaction enzymes: concentration is the warm start Taq enzyme dosage 0.25 μ L of 5U/ μ L; Concentration is the MLV reversed transcriptive enzyme consumption 0.5 μ L of 200U/ μ L; The consumption 0.25 μ L of the RNA enzyme inhibitors of 40U/ μ L;
The proportioning of each component concentration is in the said PCR reaction solution: DEPC treating water consumption 16 μ L; 2.5mM dNTPs consumption 2 μ L; 10 * PCR Buffer consumption, 2.5 μ L; 10 μ M primer mixing solutions consumptions, 1 μ L; 10 μ M probe consumptions, 0.5 μ L.
The present invention also provides a kind of detection method of utilizing the mentioned reagent box to detect enterovirus 71 nucleic acid, comprises the following steps:
(1) RNA extracts: adopt the commercialization viral RNA to extract test kit such as QIAamp Viral RNA Mini Kit extraction;
(2) PCR Mix preparation and packing: by 22 μ L: the ratio of 1 μ L, draw PCR reaction solution and PCR reaction enzymes respectively, abundant mixing; 12, the centrifugal 10s of 000rpm is mixed with PCR Mix; Take out the PCR reaction tubes, give to add the above-mentioned PCR Mix of 23 μ in each reaction tubes; Each detection need be established a positive quality control PCR reaction tubes and a negative Quality Control PCR reaction tubes, and all the other are the PCR reaction tubes of sample;
(3) application of sample: in above-mentioned reaction tubes, add the sample rna that extracts, positive quality control product and negative quality control product 2 μ L, 12, the centrifugal 10s of 000rpm respectively;
(4) pcr amplification: each reaction tubes is put into the reactive tank of quantitative fluorescent PCR instrument, mark fluorescent radical species, sample title and type are set, carry out pcr amplification by following condition;
42℃45min；
95℃2min；
95 ℃ of 10s, 60 ℃ of 30s; 40 circulations; Fluorescent value is read in end of a period in that the 3rd of response procedures goes on foot;
(5) analysis and judgement: the Ct value smaller or equal to 35 positive; The Ct value greater than 37 negative; The Ct value is a gray area between 35-37, need carry out revision test, if the Ct value is otherwise negative still between 35-37 then be judged as the positive.
The invention has the beneficial effects as follows: the present invention adopts the method for real-time fluorescence quantitative PCR technology for detection enterovirus 71 nucleic acid sequence, has special, sensitive, quick, advantages of simple operation.
Description of drawings
Fig. 1 is embodiment 1 experimental result picture;
Fig. 2 is embodiment 2 experimental result pictures.
Embodiment
Below in conjunction with accompanying drawing and specific embodiment the present invention is described further, but not as to qualification of the present invention.
The invention provides a kind of enterovirus 71 nucleic acid detection kit, this test kit contains: the PCR reaction enzymes, comprising warm start Taq enzyme, MLV reversed transcriptive enzyme, RNA enzyme inhibitors; The PCR reaction solution is comprising DEPC treating water, dNTPs, 10 * PCR Buffer, enterovirns type 71 forward primer, enterovirns type 71 reverse primer, enterovirns type 71 probe; Negative quality control product is the DEPC treating water; Positive quality control product is for adopting the in-vitro transcription RNA of t7 rna polymerase preparation.
The manufacturing of test kit:
1. reagent
Reagent used in this test kit manufacturing processed is mainly available from precious biotechnology (Dalian) ltd (Takara),
All the other are available from Pu Luomaige company, Beijing Quanshijin Biotechnology Co., Ltd, Beijing Chemical Plant.
2.PCR reaction solution preparation:
(1) primer and probe design and synthetic:
Download domestic different year and geographic EV71 whole genome sequence from Genbank; Carry out the multisequencing comparison through biological software AlignX; Select one section conserved sequence in the VP1 gene regions,, adopt Primer Express software to establish according to primer and probe design principle
Meter EV71 Auele Specific Primer and probe.Design result is as shown in the table:
Annotate: R=A/G, Y=C/T
In the table: F:forward, forward; EV71-F representes the enterovirns type 71 forward primer.
R:reverse, reverse; EV71-R representes the enterovirns type 71 reverse primer.
P:probe, probe; EV71-P representes the enterovirns type 71 probe.
FAM: fluorescence report group.
ECLIPSE: fluorescent quenching group.
According to the design result of last table, entrust Invitrogen company and Takara company synthetic primer and probe respectively.
(2) dissolving of primer and probe: get frozen enterovirns type 71 primer (EV71-F and EV71-R), probe (EV71-P) dry powder pipe, 12, the centrifugal 2min of 000rpm; Add TE Buffer according to primer probe dissolving specification sheets dry powder is dissolved, making concentration and probe concentration is 10 μ M, and two kinds of primer concentrations respectively are 20 μ M; In 1.5mL EP pipe, mix Deng measuring two kinds of primer solution; Be mixed with 10 μ M primer mixing solutionss, the vibration mixing is centrifugal, subsequent use;
(3) PCR reaction solution preparation:
In following ratio: DEPC treating water 16 μ L, 2.5mM dNTPs 2 μ L, 10 * PCR Buffer2.5 μ L, 10 μ M primer mixing solutions 1 μ L and 10 μ M probes, 0.5 μ L are mixed with the PCR reaction solution.
3.PCR reaction enzymes preparation:
Concentration is that 0.25 μ L of the RNA enzyme inhibitors of the warm start Taq enzyme 0.25 μ L of 5U/ μ L, MLV reversed transcriptive enzyme 0.5 μ L that concentration is 200U/ μ L and 40U/ μ L is mixed with into the PCR reaction enzymes.
4. negative quality control product preparation:
The effect of negative quality control product is to be used for preventing the false positive that produces because of pollution.The present invention adopts the DEPC treating water as negative quality control product, and whole experiment is monitored.
5. positive quality control product preparation:
The effect of positive quality control product is that whether monitoring reagent lost efficacy and whether performance descends.The present invention adopts the RNA of enterovirns type 71 in-vitro transcription as positive quality control product.According to molecule clone technology commonly used in the art, its preparation method is following:
(1) construction of recombinant plasmid and extraction: at first the following primer of design carries out pcr amplification to the genomic dna sequence of enterovirns type 71 positive strain in the outside of EV71-F, EV-71-R:
Upstream primer is shown in SEQ ID NO:5 in the sequence table: ATATAATAGCACTAGCGGCAGC
Downstream primer is shown in SEQ ID NO:6 in the sequence table: TACAAGATTTGCCCAATCAAT
Adopt Bo Maide " multifunctional dna purifying and recovering test kit " to reclaim the PCR product then as the purpose fragment; Adopt the pEAZY-T3 Cloning Vector test kit of full formula King Company; The insertion of above-mentioned purpose fragment is contained among the carrier pEAZY-T3 of T7 promotor; Construction recombination plasmid through transforming and screening, obtains containing the positive colony bacterium that is inserted with the segmental recombinant plasmid of above-mentioned purpose; This positive colony bacterium carries out quantitatively with the plasmid in Bo Maide " high purity plasmid extraction kit " the extraction culture bacteria liquid and with ultraviolet spectrophotometer through after the enlarged culturing.
(2) preparation of in-vitro transcription RNA quality control product
With the SAC I enzyme of Takara company to the plasmid of said extracted carry out enzyme cut make its linearizing after; Adopt the t7 rna polymerase of Takara company that above-mentioned endonuclease reaction liquid is carried out in-vitro transcription; The in-vitro transcription reaction solution of gained digests to remove DNA wherein with the DNase I of Takara company; Adopt the TransZol of full formula King Company to extract the RNA in this Digestive system subsequently, this is in-vitro transcription RNA; After adopting ultraviolet spectrophotometer to carry out quantitatively to it, it is diluted to concentration is that 105 copy/μ L are as in-vitro transcription RNA quality control product.
Recombinant plasmid inserted EV71-specific fragment sequence as the sequence table SEQ? ID? NO.4 follows:
On ABI 7300 quantitative real time PCR Instruments, detect the method for enterovirus 71 nucleic acid with test kit of the present invention
(1) RNA extracts: adopt QIAamp Viral RNA Mini Kit to extract,
(2) PCR Mix preparation: by 22 μ L: the ratio of 1 μ L, draw PCR reaction solution and PCR reaction enzymes respectively, abundant mixing; 12, the centrifugal 10s of 000rpm takes out the PCR reaction tubes; One of them positive quality control product reaction tubes; A negative quality control product reaction tubes, another is the sample reaction tubes, gives the PCRMix that adds the above-mentioned preparation of 23 μ L in each reaction tubes;
PCR Mix compound method is as shown in the table:
(3) application of sample: the sample rna 2 μ L that in 3 reaction tubess, add to extract respectively, positive quality control product 2 μ L and negative quality control product 2 μ L, behind the mixing 12, the centrifugal 10s of 000rpm;
(4) pcr amplification: the reactive tank of each reaction tubes being put into quantitative real time PCR Instrument; By correspondence not key sample, positive quality control product article and negative quality control product are set in proper order; And sample title, mark fluorescent radical species are set, according to the form below is provided with response procedures and carries out pcr amplification.
Annotate: reporter group is made as FAM, and quenching group is made as none, and Passive Reference is made as none; Fluorescent value is read in end of a period in that the 3rd of response procedures goes on foot.
(5) quality control standard:
Negative quality control product: feminine gender;
Positive quality control product: the positive and Ct value are less than 35.
Above condition should satisfy simultaneously, otherwise it is invalid that test this time is regarded as, and Total Test should carry out again.
(6) analysis and judgement:
The Ct value smaller or equal to 35 positive; The Ct value greater than 37 negative; The Ct value is a gray area between 35-37, need carry out revision test, if the Ct value is otherwise negative still between 35-37 then be judged as the positive.The test-results of the embodiment of the invention 1 is as shown in Figure 1, and detected result is positive, and the Ct value is 32.28.
Reagent that the embodiment of the invention is used and material are distinguished as follows:
(1) reagent
QIAamp Viral RNA Mini Kit is available from German QIAGEN company;
The enterovirus 71 nucleic acid detection kit, product of the present invention.
(2) material
Pipettor rifle head: 0.2mL, 0.5mL, 1.5mL, available from AXYGEN company;
The PCR reaction tubes: the 0.2mL thin-walled tube, available from AXYGEN company.
(3) instrument
ABI 7300 quantitative real time PCR Instruments are available from AB company.
With the method detection unknown sample of test kit of the present invention according to embodiment 1.The unknown sample source * * hospital patient sample to be determined, the test-results of the embodiment of the invention 2 is as shown in Figure 2, and detected result is positive, and the Ct value is 23.87.
Above-described embodiment, the present invention embodiment a kind of more preferably just, common variation that those skilled in the art carries out in technical scheme scope of the present invention and replacement all should be included in protection scope of the present invention.
EV71-1 sequence table _ ST25.txt
SEQUENCE?LISTING
< 110>Aipuyi Biotech Co., Ltd., Beijing
< 120>enterovirus 71 nucleic acid detection kit and detection method
<130>09SG1F0548
<160>6
<170>PatentIn?version?3.4
<210>1
<211>20
<212>DNA
< 213>artificial sequence
<220>
< 221>primer
<222>(1)..(20)
<400>1
tagctttgat?gcagagttgc 20
<210>2
<211>21
<212>DNA
< 213>artificial sequence
<220>
< 221>primer
<222>(1)..(21)
<400>2
gagcaattgt?gggacraytt?c 21
<210>3
<211>22
<212>DNA
< 213>artificial sequence
<220>
< 221>probe
<222>(1)..(22)
<400>3
tttgttgcgt?gcacacccat?tc 22
<210>4
<211>1112
<212>DNA
< 213>virus
<220>
< 221>gene
<222>(1)..(1112)
<400>4
atataatagc?actagcggca?gcccaaaaga?acttcactat?gaaattgtgc?aaggatgcta 60
gtgatatcct?gcagacgggc?accatccagg?gagatagggt?ggcagatgta?attgaaagtt 120
ccataggaga?tagcgtgagc?agagccctca?ctcacgctct?accagcaccc?acaggccaga 180
acacacaggt?gagcagtcat?cgactggata?caggcaaggt?tccagcactc?caagctgctg 240
aaattggagc?atcatcaaat?gctagtgacg?agagcatgat?tgagacacgc?tgtgttctta 300
actcgcacag?tacagctgag?accactcttg?atagtttctt?cagcagggcg?ggattagttg 360
gagagataga?tctccctctt?gagggcacaa?ctaacccaaa?tggttatgcc?aactgggaca 420
tagacataac?aggttacgcg?caaatgcgta?gaaaggtaga?gctattcacc?tacatgcgct 480
ttgatgcaga?gttcatagct?ttgatgcaga?gttgcctttt?gttgcgtgca?cacccaccgt 540
ttgttgcgtg?cacacccatt?cgggaagttg?tcccacaatt?gctccaatat?atgtttgtgc 600
cacctggagc?ccctaagcca?gattctaggg?aatcccttgc?atggcaaacc?gccactaacc 660
cctcagtttt?tgtcaagctg?tcagaccctc?cagcgcaggt?ttcagtgcca?ttcatgtcac 720
ctgcgagtgc?ttatcaatgg?ttttatgacg?gatatcccac?attcggagaa?cacaaacagg 780
agaaagatct?tgaatacggg?gcatgtccta?ataacatgat?gggcacgttc?tcagtgcgga 840
ctgtggggac?ctccaagtct?aagtaccctt?tagtggttag?gatttacatg?agaatgaagc 900
acgtcaggcg?tggatacctc?gcccgatgcg?taaccagaac?tacctattca?aagccaaccc 960
aaattatgct?ggcactccat?taagccaact?ggtgccagtc?gcacagcgat?caccactctt 1020
gggaaatttg?gacaaagtct?ggggcctatt?tatgtgggca?actttaaagt?gttcacgaca 1080
tctgccctca?cattgattgg?gcaaatcttg?ta 1112
<210>5
<211>22
<212>DNA
< 213>artificial sequence
<220>
< 221>primer
<222>(1)..(22)
<400>5
atataatagc?actagcggca?gc 22
<210>6
<211>21
<212>DNA
< 213>artificial sequence
<220>
< 221>primer
<222>(1)..(21)
<400>6
tacaagattt?gcccaatcaa?t 21
Claims (2)
1. enterovirus 71 nucleic acid detection kit is characterized in that:
This test kit contains:
(1) .PCR reaction enzymes is comprising warm start Taq enzyme, MLV reversed transcriptive enzyme, RNA enzyme inhibitors;
(2) .PCR reaction solution is comprising DEPC treating water, dNTPs, 10 * PCR Buffer, enterovirns type 71 forward primer, enterovirns type 71 reverse primer, enterovirns type 71 probe;
Enterovirns type 71 forward primer sequence is: 5 '-TAGCTTTGATGCAGAGTTGC-3 ',
Enterovirns type 71 reverse primer sequence is: 5 '-GAGCAATTGTGGGACRAYTTC-3 ',
The enterovirns type 71 probe sequence is: 5 '-TTTGTTGCGTGCACACCCATTC-3 ';
(3). negative quality control product is the DEPC treating water;
(4). positive quality control product, for adopting the in-vitro transcription RNA of t7 rna polymerase preparation.
2. enterovirus 71 nucleic acid detection kit according to claim 1 is characterized in that: said probe 5 ' end flag F AM fluorescence report group, 3 ' end mark ECLIPSE fluorescent quenching group.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101050885A CN101724716B (en) | 2010-02-02 | 2010-02-02 | Enterovirus 71 nucleic acid detection kit and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101050885A CN101724716B (en) | 2010-02-02 | 2010-02-02 | Enterovirus 71 nucleic acid detection kit and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101724716A CN101724716A (en) | 2010-06-09 |
| CN101724716B true CN101724716B (en) | 2012-08-29 |
Family
ID=42446261
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101050885A Active CN101724716B (en) | 2010-02-02 | 2010-02-02 | Enterovirus 71 nucleic acid detection kit and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101724716B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102230026A (en) * | 2011-06-10 | 2011-11-02 | 天津朝海科技有限公司 | Human enterovirus 71 detection kit |
| CN102851391A (en) * | 2012-07-20 | 2013-01-02 | 宁波检验检疫科学技术研究院 | Human enterovirus four-color fluorescence RT-PCR detection kit and detection method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101328507A (en) * | 2008-07-10 | 2008-12-24 | 浙江省疾病预防控制中心 | Fluorescent quantitative RT-PCR detection reagent box and detection method of enterovirus EV71 |
| CN101407846A (en) * | 2008-10-13 | 2009-04-15 | 浙江省疾病预防控制中心 | Fluorescent quantitative RT-PCR detection kit and detection method for enterovirus |
-
2010
- 2010-02-02 CN CN2010101050885A patent/CN101724716B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101328507A (en) * | 2008-07-10 | 2008-12-24 | 浙江省疾病预防控制中心 | Fluorescent quantitative RT-PCR detection reagent box and detection method of enterovirus EV71 |
| CN101407846A (en) * | 2008-10-13 | 2009-04-15 | 浙江省疾病预防控制中心 | Fluorescent quantitative RT-PCR detection kit and detection method for enterovirus |
Non-Patent Citations (3)
| Title |
|---|
| V.Moya-Suri et al..Enterovirus RNA sequences in sera of schoolchildren in the general population and their association with type 1-diabetes-associated autoantibodies.《jourmal of medical microbiology》.2005,第54卷(第9期),879-883. * |
| 严菊英等.肠道病毒EV71荧光定量RT-PCR法快速检测.《中国公共卫生》.2009,第25卷(第7期),843-844. * |
| 王雅静等.手足口病肠道病毒核酸检测方法的比较研究.《中国热带医学》.2009,第9卷(第2期),199-223. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101724716A (en) | 2010-06-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110592290B (en) | Kit and method for detecting feline calicivirus | |
| CN101724717B (en) | Enterovirus universal nucleic acid detection kit and detection method | |
| WO2021175298A1 (en) | Novel coronavirus detection reagent and detection method | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN111534633B (en) | Novel coronavirus (2019-nCOV) detection kit and method | |
| CN101713003B (en) | Kit for detecting coxsackie virus A16-type nucleic acid and detection method thereof | |
| CN111549184B (en) | PCR fluorescence detection kit for respiratory adenovirus and application thereof | |
| CN102634604B (en) | Reagent kit for detecting new Bunyavirus by real-time fluorescent RT-PCR (reverse transcription-polymerase chain reaction) | |
| CN103045754B (en) | One-step process real-time fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) method and kit for detecting Z/S subtype ebola viruses | |
| CN113403430A (en) | Triple fluorescent quantitative PCR primer group for detecting different types of porcine circovirus, kit and application | |
| CN105112564A (en) | Method and kit for detecting high-risk HPV (human papillomavirus) E6/E7 mRNA (messenger ribonucleic acid) by ligase | |
| CN111575405A (en) | Kit and method for detecting 25 RNA viruses of respiratory tract by NGS (Next Generation System) targeted probe capture method | |
| CN111534637A (en) | Universal primer, probe and kit for enterovirus nucleic acid detection | |
| CN113564280A (en) | RAA primer for detecting 12 serotypes of avian adenovirus group I and detection method thereof | |
| CN111394515A (en) | L AMP primer group for detecting canine parvovirus, fluorescence visualization rapid kit and method | |
| CN103484568B (en) | Method and kit for dual fluorescence quantitative PCR detection of grass carp reovirus types I and II | |
| TWI362419B (en) | Nucleic acid detection | |
| CN101724716B (en) | Enterovirus 71 nucleic acid detection kit and detection method | |
| CN101812538B (en) | Enterovirus 71-detecting fluorescent quantitative RT-PCR kit | |
| CN113403420A (en) | Primer probe combination for detecting yersinia sporogenes and drug-resistant mutation thereof and application of primer probe combination | |
| CN103146846A (en) | Single standard product-based four-color fluorogenic quantitative PCR (Polymerase Chain Reaction) method and kit | |
| CN112593011A (en) | Primer and probe for detecting coxsackie virus B group | |
| Xia et al. | Rapid detection of Banna virus by reverse transcription-loop-mediated isothermal amplification (RT-LAMP) | |
| CN104450930A (en) | Molecular detection method of vibrio parahaemolyticus and application thereof | |
| CN106929601B (en) | High-sensitivity human papilloma virus 6,11 type nucleic acid detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |