CN101695562B - Chinese medicinal composition for treating viral hepatitis and preparation method thereof - Google Patents

Abstract

The invention relates to a Chinese medicinal composition for treating viral hepatitis and a preparation method thereof. The Chinese medicinal composition comprises the following raw material medicaments in part by weight: 15 to 45 parts of oldenlandia diffusa, 15 to 45 parts of barbedskullcap herb, 15 to 45 parts of indigowoad root, 5 to 15 parts of deep-fried largehead atractylodes rhizome, 8 to 22 parts of danshen root, 8 to 22 parts of turmeric root-tuber, 3 to 9 parts of liquoric root, 5 to 15 parts of giant knotweed rhizome, 5 to 15 parts of officinal magnolia bark, 8 to 22 parts of coix seed, 5 to 15 parts of pinellia tuber, 3 to 9 parts of fructus amomi rotundus and 10 to 30 parts of patrinia scaniosaefolia. The Chinese medicinal composition has a reasonable prescription, and has the efficacies of clearing away heat and toxic material, clearing damp and promoting diuresis, invigorating the spleen and regulating the flow of qi, and supplementing qi and expelling stasis; and a preclinicalanimal animal pharmacodynamic experiment proves that the Chinese medicinal composition has good curative effect on the viral hepatitis, especially hepatitis B. The preparation method is simple, and can farthest extract the active ingredients of medicament components to prepare the Chinese medicinal composition for effectively treating the viral hepatitis.

Description

A kind of Chinese medicine composition for the treatment of viral hepatitis and preparation method thereof

Technical field

The present invention relates to the field of Chinese medicines, specifically, relate to a kind of Chinese medicine composition for the treatment of viral hepatitis and preparation method thereof.

Background technology

Hepatites virus infections is a current internationally recognized therapeutics difficult problem, B-mode (HBV) in hepatitis virus, third type (HCV) and fourth type (HDV) have after the actute infection can transfer to more than 80% chronic, wherein 20% if persistent infection might develop into liver cirrhosis, wherein 1%～5% transfer hepatocarcinoma to.Wherein hepatitis b virus infected sickness rate is the highest, and (hepatitis Bvirus, HBV) for having a liking for hepatovirus, the whole world surpasses the infection that 3.5 hundred million people are subjected to hepatitis B virus to hepatitis B virus, suffers from chronic hepatitis, and then develops into liver cirrhosis even hepatocarcinoma.This viral infection is the most common deadly cause of disease of rank the 9th in the world wide.Hepatitis B also is one of the world today's last three big pertinacious diseases.

There are nearly 1.2 hundred million HBV carriers in China, and wherein the chronic viral hepatitis B patient about 3,000 ten thousand.There are every year 350000 people to die from the chronic viral hepatitis B relevant disease.Hepatitis B become China's current popular the most extensively, the most serious a kind of infectious disease of hazardness.The types of drugs that is used at present treating hepatitis B clinically has: interferon-alpha, ucleosides antiviral drugs, because of, Sebivo etc., and immunomodulator is as thymosin etc. as lamivudine, adefovir ester, entecavir, also have some the liver protecting and ALT lowering medicines, as sharp new, the potenlin of liver etc.But because interferon price height, the patient burden is very heavy, and injection continuously, clinical use inconvenience; And nucleoside analog, serious drug resistance has appearred as lamivudine, lamivudine needs long-term prescription, discovered in recent years it induce HBV to produce the YYMD variation, the back drug resistance that produces of variation, according to reported in literature, usefulness lamivudine therapy drug resistance incidence rate 16%-32% after a year, reached 50%, four year 70% in 3 years.After producing drug resistance, cause virus load to raise, the state of an illness increases the weight of, even hepatic necrosis occurs; Though adefovir ester, entecavir because of etc. also do not find serious drug resistance clinically because long-term untoward reaction is serious, price is high, a lot of patients can't bear.

Simultaneously, the utilize all types of acute hepatitises of treatment by Chinese herbs, chronic hepatitis, liver cirrhosis disease based on theory of Chinese medical science have also obtained certain effect, it has intrinsic advantage at aspects such as improving disease, recovery liver function, inhibition virus replication and anti-hepatic fibrosis, and toxic and side effects is little, be difficult for recurrence (biological pathology journal, 24:401-402,1986).For example Chinese patent CN1100642A discloses a kind of Chinese medicine preparation for the treatment of hepatitis B, is made up of 29 flavor Chinese medicines such as Cornu Saigae Tataricae, Concha Margaritifera, Radix Scutellariae, Fructus Gardeniae Preparatus, Rhizoma Alismatis, Radix Gentianae; Chinese patent CN1179953 discloses supporting Chinese medicine hepatitis B virus converting negative agent of taking, take the Chinese medicine that first, second, the third three kinds of prescriptions forms and cure various acute and chronic hepatitis by supporting, all disclose Chinese medicine preparation, the preparation method of different treatment hepatitis ies and taken method, but above-mentioned herbal mixture is many single medicinal materials simply pieces together accumulation, there is not the clinical verification of some, also do not have the support of theory of Chinese medical science, its clinical efficacy waits to estimate.

For overcoming above-mentioned defective, the present invention proposes a kind of Chinese medicine composition for the treatment of viral hepatitis and preparation method thereof.

Summary of the invention

The purpose of this invention is to provide a kind of Chinese medicine composition for the treatment of viral hepatitis and preparation method thereof.

Chinese medicine composition of the present invention is based on understanding and the Therapeutic Principle of motherland's medical science to incidence of hepatitis mechanism, and with reference to the modern pharmacological research achievement, the principles of formulating prescriptions that are equipped with strengthening the spleen to promote digestion, QI invigorating resolving depression according to heat-clearing and toxic substances removing, eliminating dampness and diuresis form.

Described Chinese medicine composition is made by following raw materials by weight proportions: Herba Hedyotidis Diffusae 15-45 part, Herba Scutellariae Barbatae 15-45 part, Radix Isatidis 15-45 part, Rhizoma Atractylodis Macrocephalae preparata 5-15 part, Radix Salviae Miltiorrhizae 8-22 part, Radix Curcumae 8-22 part, Radix Glycyrrhizae 3-9 part, Rhizoma Polygoni Cuspidati 5-15 part, Cortex Magnoliae Officinalis 5-15 part, Semen Coicis 8-22 part, Rhizoma Pinelliae 5-15 part, Fructus Amomi Rotundus 3-9 part, Herba Patriniae 10-30 part.

Wherein, preferred weight proportion is: 30 parts of Herba Hedyotidis Diffusaes, 30 parts of Herba Scutellariae Barbataes, 30 parts of Radix Isatidis, 10 parts of Rhizoma Atractylodis Macrocephalae preparatas, 15 parts of Radix Salviae Miltiorrhizaes, 15 parts of Radix Curcumaes, 6 parts in Radix Glycyrrhizae, 10 parts of Rhizoma Polygoni Cuspidati, 10 parts of Cortex Magnoliae Officinalis, 15 parts of Semen Coiciss, 10 parts of the Rhizoma Pinelliaes, 6 parts in Fructus Amomi Rotundus, 20 parts of Herba Patriniaes.

Weight portion of the present invention can adopt various measurement units commonly used such as the field of medicaments that comprises g, kg.

Differential diagnosis in tcm is thought: hepatitis virus is a kind of heresy of epidemic disease poison, belongs to categories such as " jaundice ", " hypochondriac pain ", " melancholia ", " asthenia ".Invade in the many heresies of its pathogenesis by the epidemic disease caused by damp-heat pathogen poison, with the passing of time evil volt blood system touching and cause the healthy energy damage, QI and blood pent-up causes disorder of QI and blood, liver spleen deficiency of the kidney is decreased, and becomes the pathological manifestations of simulataneous insufficiency and excessive eventually.The clinical signs such as volt, stagnation of QI due to depression of the liver, the hepatic and renal YIN deficiency, spleen deficiency of the kidney damage, venation block in the evil poison such as abdominal distension and anorexia, weak hypochondriac pain, xerostomia hardship, stool are uncomfortable, soreness of waist tinnitus, dim complexion of seeing more.Answer giving consideration to both the incidental and fundamental during treatment, establish eliminating evil, set upright, QI and blood regulating three bonded principles.Specifically, in treatment with " regulate immunity, antagonism viral, improve liver function, prevent that fiber from turning to its outline, be main method of treatment with soothing liver and strengthening spleen, heat-clearing and toxic substances removing blood stasis dispelling; make every effort to performance and human body immunity improving function; remove hepatitis B virus, block pathogenic factor deeply, promotion liver functional recovery.

The present invention is the pharmaceutical composition of pure treatment by Chinese herbs viral hepatitis, is monarch drug with Herba Hedyotidis Diffusae, Herba Scutellariae Barbatae, Radix Isatidis heat-clearing and toxic substances removing, and Herba Hedyotidis Diffusae hardship, sweet is cold, GUIXIN, liver, spleen channel, tool heat-clearing and toxic substances removing, promoting blood circulation and stopping pain, the effect of inducing diuresis to remove edema; Herba Scutellariae Barbatae property suffering, hardship, cold, go into liver, lung, kidney channel, have the merit of heat clearing away, detoxifcation, dampness removing, the Radix Isatidis bitter cold can heat-clearing and toxic substances removing, removing heat from blood sore-throat relieving, three medicines share have heat clearing away, the merit of detoxifcation, removing heat from blood, dampness removing; Rhizoma Atractylodis Macrocephalae preparata, Radix Salviae Miltiorrhizae, Radix Curcumae, Radix Glycyrrhizae air making-up and spleen enlivening, promoting blood circulation to restore menstrual flow; The Rhizoma Polygoni Cuspidati analgesic therapy of invigorating blood circulation, expelling wind and removing dampness, heat-clearing and toxic substances removing; Cortex Magnoliae Officinalis, Fructus Amomi Rotundus circulation of qi promoting, dampness; The Semen Coicis invigorating the spleen to arrest diarrhea, promoting diuresis to eliminate damp pathogen; Rhizoma Pinelliae drying dampness to eliminate phlegm, stopping nausea and vomiting by lowering the adverse flow of QI, dissolving lump and resolving mass; The Herba Patriniae heat-clearing and toxic substances removing, the silt evacuation of pus of dispelling.Therefore, each the component synergism in the Chinese medicine composition of the present invention has that heat-clearing and toxic substances removing, eliminating dampness and diuresis, spleen invigorating are regulated the flow of vital energy, the effect of QI invigorating resolving depression, for viral hepatitis, has good curative effect for hepatitis B especially.

Chinese medicine composition of the present invention can be prepared into various this areas dosage form commonly used, as adding various adjuvants commonly used, makes granule, tablet, pill, capsule, oral liquid etc.

The present invention also provides the preparation method of the Chinese medicine composition of described treatment viral hepatitis.

Preparation method of the present invention may further comprise the steps:

1) get Cortex Magnoliae Officinalis, Fructus Amomi Rotundus, Radix Curcumae, add the water that 5-8 doubly measures, extract volatile oil 3-5h with the way of distillation, volatile oil and medicinal liquid are standby;

2) medicinal residues of step 1) gained are added water 4-6 again and doubly measure and decoct 0.5-2h, merge medicinal liquid, filter, it is 1.12-1.20 (80 ℃ of surveys) that filtrate decompression is concentrated into relative density;

3) get Herba Hedyotidis Diffusae, Herba Scutellariae Barbatae, Radix Isatidis, Rhizoma Atractylodis Macrocephalae preparata, Radix Salviae Miltiorrhizae, Radix Glycyrrhizae, Rhizoma Polygoni Cuspidati, Semen Coicis, the Rhizoma Pinelliae, Herba Patriniae, add the decocting that 5-8 doubly measures and boil 2-5 time, each 1-3h, collecting decoction, filter, filtrate is concentrated into relative density 1.12-1.20 (80 ℃ of surveys);

4) above-mentioned concentrated solution is merged, cooling adds 95% ethanol and makes medicinal liquid contain the alcohol amount to reach 60%, fully stir, leave standstill 24h, get supernatant, be evaporated to relative density 1.25-1.30 (80 ℃ of surveys), collect medicinal liquid;

5) above-mentioned medicinal liquid adds adjuvant, and spray drying is made granule, sprays into volatile oil, promptly.

In the step 5), described adjuvant is one or more in dextrin, lactose, stevioside, starch, sucrose, the mannitol.According to the characteristic of medicinal liquid, the present invention preferably adds 20 parts in dextrin, lactose 50 and 10 parts of dry adjuvants of conduct of stevioside, or adds 60 parts of sucrose, 20 parts of dry adjuvants of conduct of dextrin.

Preferably, preparation method of the present invention is:

1) get Cortex Magnoliae Officinalis, Fructus Amomi Rotundus, Radix Curcumae, add the water of 8 times of amounts, extract volatile oil 4h with the way of distillation, volatile oil and medicinal liquid are standby;

2) medicinal residues with the step 1) gained add 6 times of amount decoctions of water 1h again, merge medicinal liquid, filter, and it is 1.12-1.20 that filtrate decompression is concentrated into relative density;

3) get Herba Hedyotidis Diffusae, Herba Scutellariae Barbatae, Radix Isatidis, Rhizoma Atractylodis Macrocephalae preparata, Radix Salviae Miltiorrhizae, Radix Glycyrrhizae, Rhizoma Polygoni Cuspidati, Semen Coicis, the Rhizoma Pinelliae, Herba Patriniae, the decocting that adds 8 times of amounts boils three times, is respectively 2h, 1.5h, 1h, and collecting decoction filters, and filtrate is concentrated into relative density 1.12-1.20;

4) above-mentioned concentrated solution is merged, cooling adds 95% ethanol and makes medicinal liquid contain the alcohol amount to reach 60%, fully stir, leave standstill 12-24h, get supernatant, be evaporated to relative density 1.25-1.30, collect medicinal liquid;

5) above-mentioned medicinal liquid, one or more in adding dextrin, lactose, stevioside, starch, sucrose, the mannitol are as dry adjuvant, and spray drying is made granule, sprays into volatile oil, promptly.(extractum and adjuvant total amount are 1: 2)

Wherein, before the step 1), also comprise 1 ') take by weighing raw materials of traditional Chinese medicinal materials through cleaning; 2 ') the above-mentioned raw materials Chinese crude drug is cleaned drying;

After step 5), also comprise 6) will add pharmaceutically acceptable carrier and/or excipient in the granule, adopt traditional preparation process technology to can be made into clinical acceptable any dosage form, as tablet, pill, capsule, granule, electuary, oral liquid etc.

Specialize as nothing, the relative density of medicinal liquid of the present invention is all measured at 80 ℃.

Preferred, the preparation method of Chinese medicine composition of the present invention is:

1) takes by weighing raw materials of traditional Chinese medicinal materials according to consumption through cleaning;

2) the above-mentioned raw materials Chinese crude drug is cleaned drying;

3) Cortex Magnoliae Officinalis, Fructus Amomi Rotundus, Radix Curcumae add the water of 8 times of amounts, extract volatile oil 4h with the way of distillation, and volatile oil and medicinal liquid are standby;

4) medicinal residues with the step 1) gained add 6 times of amount decoctions of water 1h again, merge medicinal liquid, filter, and it is 1.12-1.20 (80 ℃ of surveys) that filtrate decompression is concentrated into relative density;

5) Herba Hedyotidis Diffusae, Herba Scutellariae Barbatae, Radix Isatidis, Rhizoma Atractylodis Macrocephalae preparata, Radix Salviae Miltiorrhizae, Radix Glycyrrhizae, Rhizoma Polygoni Cuspidati, Semen Coicis, the Rhizoma Pinelliae, the Herba Patriniae decocting that adds 8 times of amounts boils three times, be respectively 2h, 1.5h, 1h, collecting decoction filters, and filtrate is concentrated into relative density 1.12-1.20 (80 ℃ of surveys);

6) above-mentioned concentrated solution is merged, cooling adds 95% ethanol and makes medicinal liquid contain the alcohol amount to reach 60%, fully stir, leave standstill 24h, get supernatant, be evaporated to relative density 1.25-1.30 (80 ℃ of surveys), collect medicinal liquid.

7) above-mentioned medicinal liquid adds dextrin, lactose, stevioside etc. in right amount, and spray drying is made granule, sprays into volatile oil, packing, promptly.

Wherein in the fine powder of step 7), add pharmaceutically acceptable carrier and/or excipient, adopt traditional preparation process technology to can be made into clinical acceptable any dosage form, as tablet, pill, capsule, granule, electuary, oral liquid etc.

Chinese medicine composition reasonable recipe of the present invention has that heat-clearing and toxic substances removing, eliminating dampness and diuresis, spleen invigorating are regulated the flow of vital energy, the effect of QI invigorating resolving depression, through animal pharmacodynamics evidence before clinical, for viral hepatitis, has good curative effect for hepatitis B especially; Preparation method of the present invention is simple, can extract the effective ingredient of each drug component to greatest extent, makes the Chinese medicine composition that can effectively treat viral hepatitis.

The specific embodiment

Following examples are used to illustrate the present invention, but are not used for limiting the scope of the invention.

Embodiment 1

1, take by weighing following weight through cleaning the crude drug Chinese crude drug: Herba Hedyotidis Diffusae 150kg, Herba Scutellariae Barbatae 150kg, Radix Isatidis 150kg, Rhizoma Atractylodis Macrocephalae preparata 5kg, Radix Salviae Miltiorrhizae 8kg, Radix Curcumae 8kg, Radix Glycyrrhizae 8kg, Rhizoma Polygoni Cuspidati 5kg, Cortex Magnoliae Officinalis 5kg,, Semen Coicis 8kg, Rhizoma Pinelliae 5kg, Fructus Amomi Rotundus 3kg, Herba Patriniae 10kg.

2, the above-mentioned raw materials Chinese crude drug is cleaned drying;

3, Cortex Magnoliae Officinalis, Fructus Amomi Rotundus, Radix Curcumae add the water of 6 times of amounts, extract volatile oil 5h with the way of distillation, and volatile oil and medicinal liquid are standby.

4, above-mentioned medicinal residues add 4 times of amount decoctions of water 1.5h again, merge medicinal liquid, filter, and it is 1.15 (80 ℃ of surveys) that filtrate decompression is concentrated into relative density.

5, Herba Hedyotidis Diffusae, Herba Scutellariae Barbatae, Radix Isatidis, Rhizoma Atractylodis Macrocephalae preparata, Radix Salviae Miltiorrhizae, Radix Glycyrrhizae, Rhizoma Polygoni Cuspidati, Semen Coicis, the Rhizoma Pinelliae, the Herba Patriniae decocting that adds 5 times of amounts boils 4 times, be respectively 3h, 2h, 1h, 0.5h, collecting decoction filters, and filtrate is concentrated into relative density 1.12-1.20 (80 ℃ of surveys);

6, above-mentioned concentrated solution is merged, cooling adds 95% ethanol and makes medicinal liquid contain the alcohol amount to reach 60%, fully stir, leave standstill 24h, get supernatant, be evaporated to relative density 1.25-1.30 (80 ℃ of surveys), collect medicinal liquid.

7, above-mentioned medicinal liquid adds 20 parts in dextrin, lactose 50 and 10 parts of dry adjuvants of conduct of stevioside, and spray drying is made granule, sprays into volatile oil, tabletting, and packing, promptly.

Embodiment 2

1, take by weighing following weight through cleaning the crude drug Chinese crude drug: Herba Hedyotidis Diffusae 45g, Herba Scutellariae Barbatae 45g, Radix Isatidis 45g, Rhizoma Atractylodis Macrocephalae preparata 15g, Radix Salviae Miltiorrhizae 22g, Radix Curcumae 22g, Radix Glycyrrhizae 9g, Rhizoma Polygoni Cuspidati 15g, Cortex Magnoliae Officinalis 15g, Semen Coicis 22g, Rhizoma Pinelliae 15g, Fructus Amomi Rotundus 9g, Herba Patriniae 30g.

2, the above-mentioned raw materials Chinese crude drug is cleaned drying;

3, Cortex Magnoliae Officinalis, Fructus Amomi Rotundus, Radix Curcumae add the water of 6 times of amounts, extract volatile oil 3h with the way of distillation, and volatile oil and medicinal liquid are standby.

4, above-mentioned medicinal residues add 5 times of amount decoctions of water 2h again, merge medicinal liquid, filter, and it is 1.12-1.20 (80 ℃ of surveys) that filtrate decompression is concentrated into relative density.

5, Herba Hedyotidis Diffusae, Herba Scutellariae Barbatae, Radix Isatidis, Rhizoma Atractylodis Macrocephalae preparata, Radix Salviae Miltiorrhizae, Radix Glycyrrhizae, Rhizoma Polygoni Cuspidati, Semen Coicis, the Rhizoma Pinelliae, the Herba Patriniae decocting that adds 6 times of amounts boils three times, be respectively 2h, 1.5h, 1h, collecting decoction filters, filtrate is concentrated into relative density 1.17 (80 ℃ of surveys)

6, above-mentioned concentrated solution is merged, cooling adds 95% ethanol and makes medicinal liquid contain the alcohol amount to reach 60%, fully stir, leave standstill 18h, get supernatant, be evaporated to relative density 1.28 (80 ℃ of surveys), collect medicinal liquid.

7, above-mentioned medicinal liquid adds 60 parts of sucrose, 20 parts of dry adjuvants of conduct of dextrin, and spray drying is made granule, sprays into volatile oil, and packing becomes capsule, packing, promptly.

Embodiment 3

1, take by weighing following weight through cleaning the crude drug Chinese crude drug: Herba Hedyotidis Diffusae 30kg, Herba Scutellariae Barbatae 30kg, Radix Isatidis 30kg, Rhizoma Atractylodis Macrocephalae preparata 10kg, Radix Salviae Miltiorrhizae 15kg, Radix Curcumae 15kg, Radix Glycyrrhizae 6kg, Rhizoma Polygoni Cuspidati 10kg, Cortex Magnoliae Officinalis 10kg, Semen Coicis 15kg, Rhizoma Pinelliae 10kg, Fructus Amomi Rotundus 6kg, Herba Patriniae 20kg.

2, the above-mentioned raw materials Chinese crude drug is cleaned drying;

3, Cortex Magnoliae Officinalis, Fructus Amomi Rotundus, Radix Curcumae add the water of 8 times of amounts, extract volatile oil 4h with the way of distillation, and volatile oil and medicinal liquid are standby.

4, above-mentioned medicinal residues add 6 times of amount decoctions of water 1h again, merge medicinal liquid, filter, and it is 1.12-1.20 (80 ℃ of surveys) that filtrate decompression is concentrated into relative density.

5, Herba Hedyotidis Diffusae, Herba Scutellariae Barbatae, Radix Isatidis, Rhizoma Atractylodis Macrocephalae preparata, Radix Salviae Miltiorrhizae, Radix Glycyrrhizae, Rhizoma Polygoni Cuspidati, Semen Coicis, the Rhizoma Pinelliae, the Herba Patriniae decocting that adds 8 times of amounts boils three times, be respectively 2h, 1.5h, 1h, collecting decoction filters, and filtrate is concentrated into relative density 1.20 (80 ℃ of surveys);

6, above-mentioned concentrated solution is merged, cooling adds 95% ethanol and makes medicinal liquid contain the alcohol amount to reach 60%, fully stir, leave standstill 24h, get supernatant, be evaporated to relative density 1.30 (80 ℃ of surveys), collect medicinal liquid.

7, above-mentioned medicinal liquid, 20 parts in dextrin, lactose 50 and 10 parts of dry adjuvants of conduct of stevioside, spray drying is made granule, sprays into volatile oil, and packing becomes capsule, packing, promptly.

Embodiment 4

Grouping and administration

Get 100 of the male Shanghai of 1 age in days sheldrakes, through lumbar injection Shanghai sheldrake DHBV DNA strong positive serum, every 0.2ml, separation of serum infected positive duck with PCR method screening DHBV DNA, calculated infection rate from the lower limb venous blood collection in the 8th day after infecting.From infect successful duckling, choose 50 and be divided into five groups at random, 10 every group.Model control group (DHBV), Chinese medicine composition of the present invention (embodiment 3) low dose group (100mg/kg), high dose group (200mg/kg), adefovir ester 2mg/kg group, oral administration, every day 2 times, successive administration 28 days, respectively after infection before the administration in the 8th day, administration 14 days, administration 28 and drug withdrawal 7 days, from the lower limb venous blood collection, separation of serum ,-70 ℃ of preservations are to be checked.

Serum DHBV extracts and fluorescent quantitative PCR detection method

Adopt the sodium caprylate method to get 40 μ L serum, add 20 μ L sodium caprylate; Add 10min at 99 ℃, the centrifugal 10min of 12000r/min gets supernatant and detects then.

The DHBV fluorescent quantitative PCR detection method: the primer probe sequence is Senseprimer:CAGGCTTGCTGTATCTGACGG, Anti-sense:GGCAGTAGT-GAAGAGATGGAGGA, Probe:FAM-CTGAGACCGACGC-CCATTGGAGCTTT-TAMRA.

Reaction system consists of: adopt 25 μ L systems, primer concentration is 50mM, and concentration and probe concentration is 40mM, and masterplate adds 2 μ L, and quantitative fluorescent PCR masterMix adds 12.5 μ L, adds ultra-pure water to 25 μ L.Reaction condition is: 95 ℃, and the pre-degeneration of 1min, 95 ℃ then, 15s; 60 ℃, 1min carries out 40 circulations.Reaction finishes the post analysis result and the result is converted to DHBV concentration in the serum.

Statistical method

(x ± s) expression relatively adopts paired data t check to measurement data before and after the treatment, relatively adopt variance analysis between group, and inspection level is α=0.05, adopts SPSS10.10 statistical software analytical data with mean ± standard deviation.

Experimental result

Experimental result sees Table 1:

Table 1 granule of the present invention is to duck hepatitis B model DHBV DNA therapeutic effect

Annotate: compare (each group and model control group are relatively) between group, * * P＜0.01, * P＜0.05; Group interior relatively (D0 and other each point of taking a blood sample compare in organizing), ##P＜0.01, #P＜0.05.

Experimental result shows: adefovir ester is in the time of the 7th, 14,28 days, and the clear virus load of Sanguis Anas domestica all obviously descends, (compare with D0, be P＜0.01, each time point and virus control group relatively are P＜0.01); , compare with the virus control group after 7 days at inactive adefovir ester, serum DHBV carrying capacity still has remarkable decline (P＜0.01); But more then there is not obviously descend (P＞0.05) in organizing with D0; During Chinese medicine composition high dose group of the present invention the 7th, 14,28 day after administration, the clear virus load of Sanguis Anas domestica all obviously descend (with D0 relatively, D7 is P＜0.05; D14, D28 are P＜0.01, and each time point and model control group relatively are P＜0.01; After 7 days, D0 organizes interior comparison at inactive Chinese medicine composition of the present invention, and the serum-virus carrying capacity still significantly reduces (P＜0.01), but model control group does not more then have significantly descend (P＞0.05);

Conclusion

Chinese medicine composition provided by the invention has the effect of good hepatitis virus resisting, particularly hepatitis B virus.

Embodiment 5

The present invention has also carried out preclinical animal acute toxicity test, has verified safety of the present invention.

The acute toxicity of [test objective] test Chinese medicine composition of the present invention.

[being subjected to the reagent thing]

Supply sample unit: pharmaceutical factory, rich former Pharmaceutical Tushan

Lot number: 20060326;

Concentration: form by the particulate former extractum of embodiment 2 undried preparations is concentrated, concentration is 3.0g/mL;

Compound method: be mixed with desired concn with normal saline.

[animal]

1. originate, kind, strain, the quality certification: provide by animal housing of Anhui Prov. Medical Science Inst., the Kunming kind, outbreeding sealing system, the animal quality certification is: the Anhui doctor is real to be moved accurate No. 01;

2. body weight: 18～22g;

3. sex: male and female half and half, female person does not have pregnant;

4. number of animals: 40, divide every cage 5 raisings;

5. experimental situation: laboratory temperature is 18～28 ℃, and relative humidity is 50%-70%;

6. pellet: provide by Fuyang Ying Quan health and happiness laboratory animal feed factory.

[experimental technique]

Get 80 of mices, sub-cage rearing 2 days, behind fasting (the freely drinking water) 12h, every Mus ig gives Chinese medicine composition concentrated solution 0.6mL/20g of the present invention, and with Isodose repeat administration 3 times, matched group gives isopyknic normal saline, breeding observing 7 days in the 24h.

[result]

1. animal toxicity response situation: administration group mice is moving phase after each administration, and spirit is not good enough to reducing, and diet reduces, and loose stool occurs after 1 hour, and number of times increases, and recovers after 3～4 hours.Administration treated animal hair after the administration first time has slight pollution, and all other indexs are compared no significant difference with matched group, and all indexs all recover normal in administration after 24 hours.After this animal is in the behavior activity, and aspect such as mental status and matched group relatively do not have significant change.

2. body weight change before and after the filling stomach:

Body weight does not have significant change before and after irritating stomach, sees table 2 for details.

Table 2 is irritated stomach front and back mice body weight situation (g)

P＞0.05，n＝20

3. feed consumption before and after the filling stomach

The administration treated animal reduces than matched group in filling stomach food-intake on the same day, and mice appetite every day were compared no significant change before and after all the other irritated stomaches with matched group, saw table 3 for details.

Table 3 is irritated average every the mouse feed consumption (g) in stomach front and back

4. death condition: observed 7 days none animal dead after the administration continuously.

[conclusion]

We carry out the maximum dosage-feeding test with Kunming mouse, and observed every index is all normal, does not see 1 animal dead.Show that Chinese medicine composition of the present invention does not have obvious acute toxicity effect, the oral maximum dosage-feeding of this product mice (MTD) is 550g/kg, is equivalent to 550 times of clinical plan consumption.

Embodiment 6

The present invention has also carried out the stability test investigation, determines that Chinese medicine composition of the present invention has good stable, and effect duration can reach 2 years.

[test objective] determines the stability and the effect duration of Chinese medicine composition of the present invention.

[test basis] Chinese Pharmacopoeia version in 2005.

[sample source] self-control, lot number: 20,060,326 20,060,328 20060330, sample adopts commercially available three layers of aluminum-plastic composite membrane packing.

[room temperature keeps sample] placed sample under the room temperature condition and preserves, respectively at sampling examination in 0,3,6,9,12,18,24 month.

[investigation project] character, granularity, moisture, melting, microbial limit, assay.

1, character: in required time, get three batch samples respectively, investigate by the character contents of a project in the Chinese medicine composition quality standard draft of the present invention.

2, granularity: undertaken by method under an appendix IC of Chinese Pharmacopoeia version in 2005 the granule item.

3, moisture: undertaken by appendix IXH first method of Chinese Pharmacopoeia version in 2005.

4, melting: undertaken by method under an appendix IC of Chinese Pharmacopoeia version in 2005 the granule item.

Microbial limit: undertaken by 2005 editions one appendix XIIIC of Chinese Pharmacopoeia " microbial limit test ".

5, assay: undertaken by method under the assay item in the Chinese medicine composition quality standard draft of the present invention.

[result and conclusion]

With room temperature reserved sample observing method, three batch samples of preparation have been carried out the preliminarily stabilised test, investigate the result of the test 4-6 (stability test data) that sees attached list:

Table 4 stability test data (lot number 060326)

Table 5 stability test data (lot number: 060328)

Table 6 stability test data (lot number: 060330)

The result: obviously, Chinese medicine composition of the present invention does not all have to take place significant the variation at aspects such as character, granularity, moisture content, melting, microbial limit, assays, show that this product is stable, and employed packaging material also meet the requirements.According to result of the test, we determine that temporarily this product effect duration is 2 years.

Claims (9)

1. Chinese medicine composition, make by following raw materials by weight proportions: Herba Hedyotidis Diffusae 15-45 part, Herba Scutellariae Barbatae 15-45 part, Radix Isatidis 15-45 part, Rhizoma Atractylodis Macrocephalae preparata 5-15 part, Radix Salviae Miltiorrhizae 8-22 part, Radix Curcumae 8-22 part, Radix Glycyrrhizae 3-9 part, Rhizoma Polygoni Cuspidati 5-15 part, Cortex Magnoliae Officinalis 5-15 part, Semen Coicis 8-22 part, Rhizoma Pinelliae 5-15 part, Fructus Amomi Rotundus 3-9 part, Herba Patriniae 10-30 part, the preparation method of this Chinese medicine composition may further comprise the steps:

1) get Cortex Magnoliae Officinalis, Fructus Amomi Rotundus, Radix Curcumae, add the water that 5-8 doubly measures, extract volatile oil 3-5h with the way of distillation, volatile oil and medicinal liquid are standby;

2) medicinal residues of step 1) gained are added water 4-6 again and doubly measure and decoct 0.5-2h, merge medicinal liquid, filter, relative density was 1.12-1.20 when filtrate decompression was concentrated into 80 ℃;

3) get Herba Hedyotidis Diffusae, Herba Scutellariae Barbatae, Radix Isatidis, Rhizoma Atractylodis Macrocephalae preparata, Radix Salviae Miltiorrhizae, Radix Glycyrrhizae, Rhizoma Polygoni Cuspidati, Semen Coicis, the Rhizoma Pinelliae, Herba Patriniae, add the decocting that 5-8 doubly measures and boil 2-5 time, each 1-3h, collecting decoction, filter, relative density was 1.12-1.20 when filtrate was concentrated into 80 ℃;

4) above-mentioned concentrated solution is merged, cooling adds 95% ethanol and makes medicinal liquid contain the alcohol amount to reach 60%, fully stir, leave standstill 12-24h, get supernatant, and relative density is 1.25-1.30 when being evaporated to 80 ℃, collects medicinal liquid;

5) above-mentioned medicinal liquid adds adjuvant, and spray drying is made granule, sprays into volatile oil, promptly.

2. Chinese medicine composition as claimed in claim 1, it is characterized in that, make: 30 parts of Herba Hedyotidis Diffusaes, 30 parts of Herba Scutellariae Barbataes, 30 parts of Radix Isatidis, 10 parts of Rhizoma Atractylodis Macrocephalae preparatas, 15 parts of Radix Salviae Miltiorrhizaes, 15 parts of Radix Curcumaes, 6 parts in Radix Glycyrrhizae, 10 parts of Rhizoma Polygoni Cuspidati, 10 parts of Cortex Magnoliae Officinalis, 15 parts of Semen Coiciss, 10 parts of the Rhizoma Pinelliaes, 6 parts in Fructus Amomi Rotundus, 20 parts of Herba Patriniaes by following raw materials by weight proportions.

3. Chinese medicine composition as claimed in claim 1 or 2 is characterized in that, its dosage form is granule, tablet or capsule.

4. claim 1 or the 2 described Chinese medicine compositions application in the medicine of preparation treatment hepatitis B.

5. method for preparing claim 1 or 2 described Chinese medicine compositions may further comprise the steps:

1) get Cortex Magnoliae Officinalis, Fructus Amomi Rotundus, Radix Curcumae, add the water that 5-8 doubly measures, extract volatile oil 3-5h with the way of distillation, volatile oil and medicinal liquid are standby;

2) medicinal residues of step 1) gained are added water 4-6 again and doubly measure and decoct 0.5-2h, merge medicinal liquid, filter, relative density was 1.12-1.20 when filtrate decompression was concentrated into 80 ℃;

3) get Herba Hedyotidis Diffusae, Herba Scutellariae Barbatae, Radix Isatidis, Rhizoma Atractylodis Macrocephalae preparata, Radix Salviae Miltiorrhizae, Radix Glycyrrhizae, Rhizoma Polygoni Cuspidati, Semen Coicis, the Rhizoma Pinelliae, Herba Patriniae, add the decocting that 5-8 doubly measures and boil 2-5 time, each 1-3h, collecting decoction, filter, relative density was 1.12-1.20 when filtrate was concentrated into 80 ℃;

4) above-mentioned concentrated solution is merged, cooling adds 95% ethanol and makes medicinal liquid contain the alcohol amount to reach 60%, fully stir, leave standstill 12-24h, get supernatant, and relative density is 1.25-1.30 when being evaporated to 80 ℃, collects medicinal liquid;

5) above-mentioned medicinal liquid adds adjuvant, and spray drying is made granule, sprays into volatile oil, promptly.

6. preparation method as claimed in claim 5 is characterized in that, may further comprise the steps:

1) get Cortex Magnoliae Officinalis, Fructus Amomi Rotundus, Radix Curcumae, add the water of 8 times of amounts, extract volatile oil 4h with the way of distillation, volatile oil and medicinal liquid are standby;

2) medicinal residues with the step 1) gained add 6 times of amount decoctions of water 1h again, merge medicinal liquid, filter, and relative density was 1.12-1.20 when filtrate decompression was concentrated into 80 ℃;

3) get Herba Hedyotidis Diffusae, Herba Scutellariae Barbatae, Radix Isatidis, Rhizoma Atractylodis Macrocephalae preparata, Radix Salviae Miltiorrhizae, Radix Glycyrrhizae, Rhizoma Polygoni Cuspidati, Semen Coicis, the Rhizoma Pinelliae, Herba Patriniae, the decocting that adds 8 times of amounts boils three times, is respectively 2h, 1.5h, 1h, collecting decoction, filter, relative density was 1.12-1.20 when filtrate was concentrated into 80 ℃;

4) above-mentioned concentrated solution is merged, cooling adds 95% ethanol and makes medicinal liquid contain the alcohol amount to reach 60%, fully stir, leave standstill 24h, get supernatant, and relative density is 1.25-1.30 when being evaporated to 80 ℃, collects medicinal liquid;

5) above-mentioned medicinal liquid, one or more in adding dextrin, lactose, stevioside, starch, sucrose, the mannitol are as dry adjuvant, and spray drying is made granule, sprays into volatile oil, promptly.

7. preparation method according to claim 5 is characterized in that, in the step 5), described adjuvant is one or more in dextrin, lactose, stevioside, starch, sucrose, the mannitol.

8. as claim 5 or 6 described preparation methoies, it is characterized in that, before the described step 1), also comprise 1 ') take by weighing raw materials of traditional Chinese medicinal materials through cleaning; 2 ') the above-mentioned raw materials Chinese crude drug is cleaned drying.

9. as claim 5 or 6 described preparation methoies, it is characterized in that, after step 5), also comprise 6) with adding pharmaceutically acceptable carrier or excipient in the granule, make clinical acceptable forms.