CN101638432A - Rana pleuraden antioxidant peptide and genes and application thereof - Google Patents
Rana pleuraden antioxidant peptide and genes and application thereof Download PDFInfo
- Publication number
- CN101638432A CN101638432A CN200910094264A CN200910094264A CN101638432A CN 101638432 A CN101638432 A CN 101638432A CN 200910094264 A CN200910094264 A CN 200910094264A CN 200910094264 A CN200910094264 A CN 200910094264A CN 101638432 A CN101638432 A CN 101638432A
- Authority
- CN
- China
- Prior art keywords
- rana
- pleuraden
- antioxidant peptide
- antioxidant
- peptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention relates to rana pleuraden antioxidant peptide and genes and an application thereof, belonging to the technical field of biomedical science. The rana pleuraden antioxidant peptide is thesingle chain polypeptide through genetic encoding of Chinese amphibians rana pleuraden, wherein, the molecular weight is 1653.88 daltons, the isoelectric point is 8.22, and the complete sequence of the rana pleuraden antioxidant peptide is NH2-GIRPTYNRQCEIGF-COOH; the gene for encoding is composed of 316 nucleotides, wherein, the encoding mature part is the 130-171th nucleotide. The synthetic ranapleuraden antioxidant peptide features strong antioxidant activity, can be applicable to the preparation of medicines of skin antioxidant protection and free radicals in vivo elimination, and has theadvantages of simple sequence and convenient synthesis.
Description
Technical field:
The invention provides a kind of Yunnan frog (Rana pleuraden) anti-oxidation peptide and gene and application, belong to field of biomedicine technology.
Background technology:
In the traditional Chinese medicine and national medicine of China, many amphibian animals are used as medicinal material and are used widely, as Chinese toad (Bufo gargarizans), Bombina maxima (Bombina maxima), Rana nigromaculata (pelophylax nigromaculata), Rana guentheri (Hylaranaguentheri) and rana limnocharis (Euphlyctislimnocharis) etc.The skin of these amphibian animals and internal organ have pharmacologically active and clinical efficacy widely, reported that pharmacologically active has: broad-spectrum antibacterial action, antitumor, toponarcosis, analgesia, immunomodulatory, to effect of cardiovascular systems etc., on the other hand, the complicacy of traditional Chinese medicine pharmaceutical cpd and the limitation of concocting method thereof also are the major reasons that causes active constituents of medicine better not play a role, thereby the specific reactive monomer compound of searching is one of important content of the modernization of Chinese medicine from these conventional medicaments.Abroad, the searching of the specific pharmacology reactive monomer of batrachians skin compound has become the focus of new drug invention.As from toad and wood frog skin, having obtained having the bufokinin and the ranakinin of vasodilator and hypotensive effect.Bright smart peptide and the smart peptide of junket from the North America leopard frog and the A Bai frog, have been separated to immunomodulatory and antitumor action.The nearly more than ten years screen more than 170 kinds of batrachians skin active peptides and analogue, prove that 40 various active peptides have drug development prospect preferably.
In the skin of batrachia, contain numerous active substances, antioxidation polypeptide belongs to reported first.Found 2 big class antioxidant systems in the past, a class is macromole antioxidant reductase such as the superoxide-dismutase (SOD) and the metallothionein(MT) etc. of genes encoding; Another kind of is small organic molecule such as some VITAMIN.But the current small molecules antioxidation polypeptide of finding from the frog skin of Yunnan genes encoding and secreting, expressing (antioxidantpeptides) is a class novel anti oxidation system, is also referred to as " the 3rd cover antioxidant system " for this reason.Free radical is that the class that produces in the organism metabolic processes can Individual existence has active atomic group or the atom that has one or several unpaired electronics of high oxidation, essential by earning a bare living, but also be the potential killer of biomacromolecule, cell and biological tissue simultaneously.The many dysfunctions of body and the generation of disease are as the generation of engulfing, detoxifcation, inflammation, tumour, aging, radiation injury etc. can cause free radical.In time removing the interior excessive free radical of body is the important component part that immunity of organism is regulated.Quick, the powerful radical scavenging activity of antioxidation polypeptide can be protected skin to greatest extent, makes it be subjected to inductive radical damages such as sunshine, ultraviolet ray as few as possible.This achievement is the great discovery in the anti-oxidant field of skin, and is significant to biomedicine, anti-oxidation protection and makeup research and development.
There is long history in China to the application of batrachians medicine, but the research of its activeconstituents and pharmacological properties is mainly concentrated on organic molecules such as alkaloid, and is also less to the research of its skin activity albumen peptide matters.The Yunnan frog mainly is distributed in ground such as the Yunnan, Guizhou of China.And at present also rarely have report about the research of Yunnan frog skin activity material.
The contriver searches comparison with Rana pleuraden antioxidant peptide complete sequence amino acid structure of the present invention through Protein Data Bank, finds no any phase homopolypeptide.The contriver searches comparison with Rana pleuraden antioxidant dna encoding peptide of the present invention through gene database, finds no any homologous genes.
Summary of the invention:
The objective of the invention is based on above-mentioned prior art basis, a kind of new Rana pleuraden antioxidant peptide with intensive anti-oxidant activity and gene and application are provided.
In order to realize purpose of the present invention, the invention provides following technical scheme:
Rana pleuraden antioxidant peptide:
Rana pleuraden antioxidant peptide is a kind of single chain polypeptide of Chinese batrachians Rana pleuraden antioxidant peptide genes encoding, molecular weight 1653.88 dalton, iso-electric point 8.22, the Rana pleuraden antioxidant peptide total order is classified as: glycine-Isoleucine-Arg-Pro-Threonine-tyrosine-l-asparagine-arginine-glutamine-halfcystine-L-glutamic acid-Isoleucine-glycine-phenylalanine
The clone of Rana pleuraden antioxidant peptide gene comprises:
Frog skin total RNA in Yunnan extracts, the mRNA purifying, and mRNA reverse transcription and cDNA library construction, the design primer utilizes PCR method screening Rana pleuraden antioxidant peptide gene.Amplimer length is 23 Nucleotide, and its sequence is 5 ' ATGTTCACCTTGAAGAAATCCCT 3 ', and another amplimer of PCR is the SMART of CLONTECH company
TM3 ' PCR Primer primer among the cDNA Library Construction Kit, its sequence is 5 ' ATTCTACAGGCCGAGGCGGCCGACATG 3 '.The positive monoclonal that obtains carries out gene nucleotide series and measures.Gene sequencing result shows that the gene of the Rana pleuraden antioxidant peptide of encoding is made up of 316 Nucleotide, from 5 ' end to 3 ' terminal sequence is:
atgttcacct?tgaagaaatc?cctggtattg?ttgtttgttc?tgggaaccat?ctccttatcc 60
ctctgtgagc?aagagagaaa?cgctgatgaa?gaaggagaag?gggaagaaag?actggaagaa 120
ataaaaagag?gaatacgccc?tacatataac?cgccaatgtg?agatcgggtt?ctaaaacaca 180
aaataaatgc?catctcgact?ggaaatctaa?gattgtatgg?aatataccat?taaactaaaa 240
atgtaaaaca?gatacagtat?catccaacta?ataaaaattc?caaaatgtaa?aaaaaaaaaa 300
aaaaaaaaaa?aaaaaa 316
The coding Yunnan ripe anti-oxidation peptide of the frog is a 130-171 position Nucleotide, and its aminoacid sequence is:
Gly?Ile?Arg?Pro?Thr?Tyr?Asn?Arg?Gln?Cys?Glu?Ile?Gly?Phe
1 5 10 14
The Rana pleuraden antioxidant peptide gene prepares the application of Rana pleuraden antioxidant peptide as genetically engineered.
The preparation method of Rana pleuraden antioxidant peptide:
Infer according to the gene of coding Rana pleuraden antioxidant peptide and the aminoacid sequence of Rana pleuraden antioxidant peptide to synthesize its complete sequence with automatic Peptide synthesizer.By the anti-phase C of HPLC
18Column chromatography desalination, purifying.Identify its purity with the HPLC method then, molecular weight determination adopts fast atom bombardment mass spectroscopy(FABMS) method (Fast atom bombardmentmass spectrometry, FAB-MS), isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
Beneficial effect of the present invention is:
By Rana pleuraden antioxidant dna encoding peptide its amino acid structure of deriving, the synthetic Rana pleuraden antioxidant peptide has the effect of significant removing free radical.That this Rana pleuraden antioxidant peptide has is simple in structure, synthetic convenient, anti-oxidant activity is strong, the characteristics that anti-inflammatory activity is strong.
Embodiment:
Further specify essentiality content of the present invention with embodiment below, but content of the present invention is not limited thereto.
The Rana pleuraden antioxidant peptide gene clone:
I, the total RNA of Yunnan frog skin extract:
A. live body Yunnan frog water cleans up, and puts into the liquid nitrogen quick-frozen 4 hours, gets skin histology, weigh, get the 300mg skin histology, add the total RNA of 10ml and extract damping fluid (Trizol solution, U.S. GIBCOBRL company product), homogenate is 30 minutes in the 20ml glass homogenizer.
B. add equal-volume phenol/chloroformic solution, the vibration mixing, room temperature was placed 10 minutes, and 4 ℃, centrifugal 10 minutes of 12000rpm, reject precipitation.
C. supernatant adds isopyknic Virahol, and room temperature was placed 10 minutes, and 4 ℃, centrifugal 10 minutes of 12000rpm, precipitation is washed once with 75% ethanol, dries, and pipe end throw out is the total RNA of Yunnan frog skin.
The purifying of II, Yunnan frog skin mRNA:
U.S. PROMEGA company is adopted in Yunnan frog skin mRNA separation and purification
MRNA Isolation Systems test kit.
A. get the total RNA 500 μ g of Yunnan frog skin and be dissolved in the 500 μ l DEPC water, put into 65 ℃ of water-baths 10 minutes, add Oligo (dT) probe and 13 μ l, the 20 * SSC solution of people 3 μ l, mixing is placed the room temperature cooling, is called A liquid.
B. the washing of magnetic bead (SA-PMP): magnetic bead is flicked mixing,, abandon supernatant, add 0.5 * SSC 0.3ml,, add 0.1ml 0.5 * SSC at last and suspend, be referred to as B liquid to magnetic force frame absorption 30 seconds to magnetic force frame absorption 30 seconds.
C. A liquid is added in the B liquid, room temperature was placed 10 minutes, to magnetic force frame absorption 30 seconds, abandon supernatant, with 0.1 * SSC washing 4 times, abandon supernatant at last, add 0.1ml DEPC aqueous suspension, to the magnetic force frame, adsorbed 30 seconds, supernatant is moved to new test tube, add 0.15ml DEPC water again and suspend again, to magnetic force frame absorption 30 seconds, moving supernatant to above-mentioned test tube, then is the Yunnan frog skin mRNA of purifying in the supernatant.
D. add 1/10 volume 3M sodium acetate, pH5.2, the equal-volume Virahol, in-70 ℃ of placements 30 minutes, 4 ℃, centrifugal 10 minutes of 12000rpm abandoned supernatant, and resolution of precipitate is in 10 μ l DEPC water.III, Yunnan frog skin cDNA library construction: adopt the CLONTECH Creator of company
TMSMART
TMCDNA Library Construction Kit Construction of Plasmid cDNA Library test kit.
A.cDNA first chain synthesizes (mRNA reverse transcription):
1. add 1 μ l Yunnan frog skin mRNA, 1 μ l SMART IV oligonucleotide, 1 μ l CDS III/3 ' PCR primer at the aseptic centrifuge tube of 0.5ml, add 2 μ l deionized waters and make cumulative volume reach 5 μ l.
2. the reagent in the mixing centrifuge tube is also centrifugal, and 72 ℃ are incubated 2 minutes.Centrifuge tube was hatched on ice 2 minutes.
3. in centrifuge tube, add following reagent 2.0 μ l 5 * the first chains buffering, 1.0 μ l 20mM dithiothreitol (DTT), 1.0 μ l 10mM dNTP mixtures, 1.0 μ l PowerScript ThermoScript II.
4. reagent and centrifugal in the mixing centrifuge tube is incubated 1 hour at 42 ℃.
5. centrifuge tube is placed and end the synthetic of first chain on ice.
6. it is standby to get the 2 synthetic cDNA of μ l institute, first chain from centrifuge tube.
B. adopt long terminal polymerase chain reaction (LD-PCR) method second chain that increases
1.95 ℃ preheating PCR instrument.
2. 2 μ l cDNA, first chains (mRNA reverse transcription), 80 μ l deionized waters, 10 μ l10 * Advantage 2PCR buffering, 2 μ l, 50 * dNTP mixture, 2 μ l, 5 ' PCR primer, 2 μ l CDS III/3 ' PCR primers and 2 μ l Escherichia coli polymerase centrifuge tubes are reacted.
3. in the PCR instrument, increase by following program:
1. 95 ℃ of 20 second
2. 22 circulations:
95 ℃ of 5 second
68 ℃ 6 minutes
4. after the loop ends, synthetic cDNA two strands in the centrifuge tube is carried out extracting.
C.PCR product PROMEGA company
SV Gel and PCRClean-Up System test kit carries out extracting and reclaims, and step is as follows:
1. will put upside down mixing by the isopyknic film binding buffer of the double-stranded adding of the cDNA that PCR obtains, will mix liquid then and change the centrifugal purification post over to, room temperature left standstill 5 minutes, and DNA is fully combined with pellosil.16, centrifugal 1 minute of 000g outwells the waste liquid in the collection tube.
2. the elutriant (containing ethanol) that adds 700 μ l in the centrifugal purification post, 16, centrifugal 1 minute of 000g outwells the waste liquid in the collection tube.
3. repeating step 2.
4.16, centrifugal 5 minutes of 000g.
5. the centrifugal purification post is placed new centrifuge tube.
6. add 30 μ l ultrapure waters, at room temperature left standstill 5 minutes.
7.16, centrifugal 1 minute of 000g, pipe end solution is the cDNA two strands of purified mistake.
D. the preparation of bacillus coli DH 5 alpha competent cell:
1. the single DH5 α of picking bacterium colony is inoculated in 3ml and does not contain in the LB substratum of penbritin, and 37 ℃ of overnight incubation are got above-mentioned bacterium liquid next day and are inoculated at 1: 100 in proportion in the 50ml LB nutrient solution, and 37 ℃ vibrated 2 hours.Work as OD
600Value reaches at 0.35 o'clock, the results bacterial cultures.
2. bacterium is transferred in aseptic, disposable, the ice-cold 50ml polypropylene tube, 10min puts in the side on ice, makes culture be cooled to 0 ℃.
In 4 ℃ with the centrifugal 10min of 4100r/min, to reclaim cell.
4. pour out nutrient solution, pipe is inverted 1min so that last trace nutrient solution flows to end.
5. the 0.1mol/L CaCl of every 50ml initial incubation liquid and 30ml precooling
2-MgCl
2Solution (80mmol/L MgCl
2, 20mmol/L CaCl
2) resuspended every part of cell precipitation.
In 4 ℃ with the centrifugal 10min of 4100r/min, to reclaim cell.
7. pour out nutrient solution, pipe is inverted 1min so that last trace nutrient solution flows to end.
8. every 50ml initial incubation thing ice-cold 0.1mol/L CaCl of 2ml
2Resuspended every part of cell precipitation, standby after the packing.
E. the enzyme conversion cutting, connect and connect product:
1. add 1 μ l Takara pMD18-T carrier, the double-stranded solution of 4 μ l Yunnan frog cDNA in Eppendorf tube, full dose is 5 μ l.
2. the ligase enzyme buffer mixture that adds 5 μ l (equivalent).
3.16 ℃ reaction 2 hours.
4. full dose (10 μ l) is added in the 100 μ l DH5 α competent cells, places 30 minutes in the ice.
5.42 after 90 seconds of ℃ heating, in ice, placed 1 minute again.
6. add 37 ℃ of LB substratum 890 μ l of bathing of temperature, 37 ℃ of slow shaking culture 60 minutes.
7. get 200 μ l and coat on the LB substratum that contains X-Gal, IPTG, Amp 37 ℃ and cultivated 16 hours, form single bacterium colony.
8. each LB plate washs bacterium colony with 5ml LB liquid nutrient medium, and it is frozen to add 30% glycerine.The cDNA that makes up approximately contains 1 * 10
6Individual independent clone.
IV, Rana pleuraden antioxidant peptide gene clone screening:
Amplimer length is 23 Nucleotide, and its sequence is 5 ' ATTCTACAGGCCGAGGCGGCCGACATG 3 ', and another amplimer of PCR is the SMART of CLONTECH company
TM3 ' PCRPrimer primer among the cDNA Library Construction Kit, its sequence is 5 ' ATTCTACAGGCCGAGGCGGCCGACATG 3 '.
The PCR reaction is carried out under the following conditions: 94 ℃ of 30 second, 60 ℃ of 30 second and 72 ℃ of 45 second, 35 circulations.
The bacterium cDNA library that makes up of titration at first, be diluted to suitable bacterial concentration (5000 bacteria/milliliters with the LB substratum that contains 100 μ g/ml penbritins then, be respectively applied for first run screening second with 30 bacteria/milliliters and take turns screening), on 96 well culture plates by 8 * 8 matrix bed boards (totally 64 holes, every hole 100 μ l), 37 ℃ of incubated overnight.Merge inoculum respectively by row, column, have 16 samples to carry out PCR and identify that the positive hole bacteria samples of intersecting enters second and takes turns screening.
V, Rana pleuraden antioxidant peptide gene sequencing and result:
Extract plasmid DNA and measure nucleotide sequence with dideoxy method, use instrument to be the full-automatic nucleotide sequencing instrument of U.S. AppliedBiosystems373A, sequencing primer is BcaBEST
TMSequencingPrimer RV-M and BcaBEST
TMSequencing Primer M13-47, BcaBEST
TMSequencing Primer RV-M sequence: 5`GAGCGGATAACAATTTCACACAGG 3 ', BcaBEST
TMSequencing Primer M13-47:5 ' CGCCAGGGTTTTCCCAGTCACGAC 3 '.Gene sequencing result from 5 ' end to 3 ' terminal sequence is:
atgttcacct?tgaagaaatc?cctggtattg?ttgtttgttc?tgggaaccat?ctccttatcc 60
ctctgtgagc?aagagagaaa?cgctgatgaa?gaaggagaag?gggaagaaag?actggaagaa 120
ataaaaagag?gaatacgccc?tacatataac?cgccaatgtg?agatcgggtt?ctaaaacaca 180
aaataaatgc?catctcgact?ggaaatctaa?gattgtatgg?aatataccat?taaactaaaa 240
atgtaaaaca?gatacagtat?catccaacta?ataaaaattc?caaaatgtaa?aaaaaaaaaa 300
aaaaaaaaaa?aaaaaa 316
The sequence table of Rana pleuraden antioxidant peptide gene nucleotide is: sequence length is 316 bases, sequence type: nucleic acid, chain number: strand, topology: straight chain shape, sequence kind: cDNA, source: Yunnan frog skin.The coding Rana pleuraden antioxidant peptide is a 130-171 position Nucleotide, and its aminoacid sequence is:
Gly?Ile?Arg?Pro?Thr?Tyr?Asn?Arg?Gln?Cys?Glu?Ile?Gly?Phe
1 5 10 14
Rana pleuraden antioxidant peptide prepares the application of Rana pleuraden antioxidant peptide as genetically engineered.
The preparation Rana pleuraden antioxidant peptide:
The preparation method of I, Rana pleuraden antioxidant peptide: infer according to the gene of coding Rana pleuraden antioxidant peptide and the aminoacid sequence of Rana pleuraden antioxidant peptide to synthesize its complete sequence with automatic Peptide synthesizer.By the anti-phase C of HPLC
18Column chromatography desalination, purifying.
II, molecular weight determination adopt the fast atom bombardment mass spectroscopy(FABMS) method, and (Fast atom bombardment massspectrometry, FAB-MS), with glycerine: m-nitrobenzyl alcohol: methyl-sulphoxide (1: 1: 1, V: V: V, volume ratio) is a substrate, Cs
+As projectile, electric current is 1 μ A, and emission voltage is 25Kv.
The Rana pleuraden antioxidant peptide of III, purifying is identified its purity with the high-efficient liquid phase chromatogram HPLC method, and molecular weight determination adopts the fast atom bombardment mass spectroscopy(FABMS) method, and isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
Rana pleuraden antioxidant peptide is a kind of single chain polypeptide of Chinese amphibian animal Yunnan frog genes encoding, molecular weight 1653.88 dalton, iso-electric point 8.22, the Rana pleuraden antioxidant peptide total order is classified as: glycine-Isoleucine-Arg-Pro-Threonine-tyrosine-l-asparagine-arginine-glutamine-halfcystine-L-glutamic acid-Isoleucine-glycine-phenylalanine
The pharmacological evaluation of Rana pleuraden antioxidant peptide:
1.DPPH (2,2-phenylbenzene-1-picryl hydrazine) removing method detects the oxidation resistant effect of Rana pleuraden antioxidant peptide
Preparation 5 * 10
5M DPPH methanol solution, the testing sample of 0.1ml (concentration is 0.5-10mg/ml) joins in the 1.9ml DPPH methanol solution, and the room temperature lucifuge is placed 30min, detects photoabsorption in 517nm, the methyl alcohol zeroing.The ratio (I%) that suppresses the DPPH free radical calculates according to following formula:
I%=[A
blank-A
sample]×100/A
blank
A
SampleIt is the 517nm absorbance value after DPPH and sample lucifuge are hatched 30min; A
BlankBe the absorbance value of DPPH methanol solution at 517nm, with butylated hydroxytoluene (BHT) as positive control.
The result shows that Rana pleuraden antioxidant peptide has the activity of very strong removing DPPH free radical.When the Rana pleuraden antioxidant peptide concentration is 80ug/ml, can remove 80% DPPH free radical in 5 seconds, can reach 100% clearance rate in 4 minutes; When its concentration is 20ug/ml, can remove 50% DPPH free radical in 2 minutes; Even when its concentration is low to moderate 5ug/ml, in 10 minutes, also can remove 40% DPPH free radical.
2.ABTS
+The removing method detects the oxidation resistant effect of Rana pleuraden antioxidant peptide:
ABTS
+Be the blue-greenish colour radical cation of quite stable,, become the ABTS that does not have color having in the presence of the antioxidant of hydrogen supply capacity.Anti-oxidation peptide is removed ABTS
+The variation of ability by 734nm place absorbancy measure.The resistance of oxidation of sample and ABTS
+Residual quantity be inversely proportional to.ABTS
+Residual quantity (%) is calculated according to following formula:
%ABTS
+ ·R=[(ABTS
+ ·)
T/(ABTS
+ ·)
t=0]×100
ABTS
+ TBe ABTS
+Hatch 734nm absorbance value behind the 10min with the sample lucifuge; ABTS
+ T=oBe ABTS
+734nm absorbance value when initial.
1. the preparation of the PBS storage liquid of .ABTS, concentration is 2mM.2. .K
2S
2O
8PBS solution preparation, concentration is 70mM.3. .ABTS
+Preparation: before using with ABTS storage liquid and K
2S
2O
8Solution is mixing in 250: 1 according to volume ratio, room temperature lucifuge 15-16h.4.. dilute ABTS with PBS before the experiment
+Solution makes its A
734Between 0.8 ± 0.030.Draw the good ABTS of dilution
+Solution 48 μ l add 2 μ l testing samples (concentration is 0.5-10mg/ml), and room temperature is placed 10min, measure its absorbance value down in the 734nm wavelength.The PBS zeroing.
More than test all uses sample dissolution liquid (ultrapure water) to do contrast.Every group establish 3 parallel.
The result shows that the Rana pleuraden antioxidant Toplink of 80ug/ml is removed ABTS fast
+Free radical, clearance rate reaches 95.9 ± 4.7.This shows that Rana pleuraden antioxidant peptide has very strong antioxygenation, also has simple, the synthetic advantage such as convenient of sequence simultaneously, can be as preparation skin anti-oxidation protection and the application of removing the interior free yl medicine.
Rana pleuraden antioxidant peptide and gene thereof and application _ ST25.txt
SEQUENCE?LISTING
<110〉Kunming Institute of Zoology, Chinese Academy of Sciences
<120〉Rana pleuraden antioxidant peptide and gene thereof and application
<130>1
<160>2
<170>PatentIn?version?3.4
<210>1
<211>316
<212>DNA
<213>Rana?pleuraden
<400>1
atgttcacct?tgaagaaatc?cctggtattg?ttgtttgttc?tgggaaccat
ctccttatcc 60
ctctgtgagc?aagagagaaa?cgctgatgaa?gaaggagaag?gggaagaaag
actggaagaa 120
ataaaaagag?gaatacgccc?tacatataac?cgccaatgtg?agatcgggtt
ctaaaacaca 180
aaataaatgc?catctcgact?ggaaatctaa?gattgtatgg?aatataccat
taaactaaaa 240
atgtaaaaca?gatacagtat?catccaacta?ataaaaattc?caaaatgtaa
aaaaaaaaaa 300
aaaaaaaaaa?aaaaaa
316
<210>2
<211>14
<212>PRT
<213>Rana?pleuraden
Rana pleuraden antioxidant peptide and gene thereof and application _ ST25.txt
<400>2
Gly?Ile?Arg?Pro?Thr?Tyr?Asn?Arg?Gln?Cys?Glu?Ile?Gly?Phe
1 5 10
Claims (4)
1. Rana pleuraden antioxidant peptide, it is characterized in that Rana pleuraden antioxidant peptide is a kind of single chain polypeptide of Chinese amphibian animal Yunnan frog genes encoding, molecular weight is 1653.88 dalton, iso-electric point 8.22, polypeptide complete sequence primary structure is: glycine-Isoleucine-Arg-Pro-Threonine-tyrosine-l-asparagine-arginine-glutamine-halfcystine-L-glutamic acid-Isoleucine-glycine-phenylalanine
2. Rana pleuraden antioxidant peptide gene nucleotide series, it is characterized in that: cDNA is made up of 316 Nucleotide, and it from 5 ' end to 3 ' terminal sequence is:
atgttcacct?tgaagaaatc?cctggtattg?ttgtttgttc?tgggaaccat?ctccttatcc 60
ctctgtgagc?aagagagaaa?cgctgatgaa?gaaggagaag?gggaagaaag?actggaagaa 120
ataaaaagag?gaatacgccc?tacatataac?cgccaatgtg?agatcgggtt?ctaaaacaca 180
aaataaatgc?catctcgact?ggaaatctaa?gattgtatgg?aatataccat?taaactaaaa 240
atgtaaaaca?gatacagtat?catccaacta?ataaaaattc?caaaatgtaa?aaaaaaaaaa 300
aaaaaaaaaa?aaaaaa 316
3. the described Rana pleuraden antioxidant peptide gene nucleotide series of claim 2 is characterized in that, coding Rana pleuraden antioxidant peptide mature sequence is a 130-171 position Nucleotide, and its aminoacid sequence is:
Gly?Ile?Arg?Pro?Thr?Tyr?Asn?Arg?Gln?Cys?Glu?Ile?Gly?Phe
1 5 10 14
4. the described Rana pleuraden antioxidant peptide of claim 1 is as the preparation skin peptide anti-oxidation protection and the application of removing the interior free yl medicine.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100942647A CN101638432B (en) | 2009-03-27 | 2009-03-27 | Rana pleuraden antioxidant peptide and genes |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100942647A CN101638432B (en) | 2009-03-27 | 2009-03-27 | Rana pleuraden antioxidant peptide and genes |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101638432A true CN101638432A (en) | 2010-02-03 |
CN101638432B CN101638432B (en) | 2011-07-20 |
Family
ID=41613627
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2009100942647A Active CN101638432B (en) | 2009-03-27 | 2009-03-27 | Rana pleuraden antioxidant peptide and genes |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101638432B (en) |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101824077A (en) * | 2010-03-12 | 2010-09-08 | 中国科学院昆明动物研究所 | Large green frog antioxidant peptide (antioxidin-RL) as well as gene and application thereof |
CN102952177A (en) * | 2012-11-15 | 2013-03-06 | 大连理工大学 | Odorrana tiannanensis natural antioxidant peptide reconstructed body and preparation method and application thereof |
CN103233012A (en) * | 2013-05-17 | 2013-08-07 | 梁醒财 | Antioxidant peptide of odorrana andersonii skin and gene thereof |
CN104530192A (en) * | 2015-01-19 | 2015-04-22 | 云南民族大学 | Antioxidant peptide AOP-OM1 as well as preparation method and application thereof |
CN105037498A (en) * | 2015-06-19 | 2015-11-11 | 苏州大学 | Antioxidative peptide derived from amolops wuyiensis, gene and application thereof |
CN106397564A (en) * | 2016-10-20 | 2017-02-15 | 南方医科大学 | Bufo melanostictus antioxidative peptide and its gene and application in pharmacy |
CN106432425A (en) * | 2016-10-20 | 2017-02-22 | 南方医科大学 | Microhyla pulchra antioxidation peptide and gene thereof, and application of microhyla pulchra antioxidation peptide to pharmacy |
CN109913486A (en) * | 2019-04-11 | 2019-06-21 | 中国科学院新疆理化技术研究所 | A kind of biological expression of anti-oxidation peptide NV13 recombination and application |
-
2009
- 2009-03-27 CN CN2009100942647A patent/CN101638432B/en active Active
Cited By (13)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101824077A (en) * | 2010-03-12 | 2010-09-08 | 中国科学院昆明动物研究所 | Large green frog antioxidant peptide (antioxidin-RL) as well as gene and application thereof |
CN102952177A (en) * | 2012-11-15 | 2013-03-06 | 大连理工大学 | Odorrana tiannanensis natural antioxidant peptide reconstructed body and preparation method and application thereof |
CN102952177B (en) * | 2012-11-15 | 2014-10-15 | 大连理工大学 | Odorrana tiannanensis natural antioxidant peptide reconstructed body and preparation method and application thereof |
CN103233012A (en) * | 2013-05-17 | 2013-08-07 | 梁醒财 | Antioxidant peptide of odorrana andersonii skin and gene thereof |
CN104530192B (en) * | 2015-01-19 | 2017-10-31 | 云南民族大学 | A kind of antioxidation polypeptide AOP OM1 and preparation method and application |
CN104530192A (en) * | 2015-01-19 | 2015-04-22 | 云南民族大学 | Antioxidant peptide AOP-OM1 as well as preparation method and application thereof |
CN105037498B (en) * | 2015-06-19 | 2018-06-12 | 苏州大学 | Derived from the anti-oxidation peptide and its gene of the Wuyi rapids frog and application |
CN105037498A (en) * | 2015-06-19 | 2015-11-11 | 苏州大学 | Antioxidative peptide derived from amolops wuyiensis, gene and application thereof |
CN106432425A (en) * | 2016-10-20 | 2017-02-22 | 南方医科大学 | Microhyla pulchra antioxidation peptide and gene thereof, and application of microhyla pulchra antioxidation peptide to pharmacy |
CN106397564A (en) * | 2016-10-20 | 2017-02-15 | 南方医科大学 | Bufo melanostictus antioxidative peptide and its gene and application in pharmacy |
CN106432425B (en) * | 2016-10-20 | 2020-07-10 | 南方医科大学 | Hypoplophora japonica antioxidant peptide, gene thereof and application thereof in pharmacy |
CN106397564B (en) * | 2016-10-20 | 2020-07-10 | 南方医科大学 | Black-frame toad antioxidant peptide, gene thereof and application thereof in pharmacy |
CN109913486A (en) * | 2019-04-11 | 2019-06-21 | 中国科学院新疆理化技术研究所 | A kind of biological expression of anti-oxidation peptide NV13 recombination and application |
Also Published As
Publication number | Publication date |
---|---|
CN101638432B (en) | 2011-07-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101638432B (en) | Rana pleuraden antioxidant peptide and genes | |
Pozzan et al. | The comeback of mitochondria to calcium signalling | |
CN100590130C (en) | Anticancer active peptide | |
EP2749568B1 (en) | Cell dna synthesis prevention and cell proliferation inhibition polypeptide and use thereof | |
CN101824077A (en) | Large green frog antioxidant peptide (antioxidin-RL) as well as gene and application thereof | |
CN113549129A (en) | D-configuration antitumor peptide and preparation method and application thereof | |
CN102250217A (en) | Hyla simplex skin injury repair promotion polypeptides and genes as well as application thereof | |
Miao et al. | Rational design of a potent macrocyclic peptide inhibitor targeting the PD-1/PD-L1 protein–protein interaction | |
CN104193826B (en) | A kind of fused polypeptide and its application in antineoplastic is prepared | |
CN101475630B (en) | Bloody noun antibacterial peptide temporin-La, genes thereof and use in pharmacy | |
CN100581584C (en) | Serine protease inhibitor of Rana grahami, and its application | |
Tehrani et al. | The toxicity study of synthesized inverse carnosine peptide analogues on HepG2 and HT-29 cells | |
CN111235156B (en) | Immune regulatory peptide derived from rana huashanensis and application of gene thereof in skin photodamage protection | |
CN107987144A (en) | A kind of centipede polypeptide SLP_SsTx and its encoding gene and application | |
CN101724632B (en) | Bullfrog skin active peptide, gene and application thereof in pharmacy | |
CN102796176B (en) | Kunyuenin, preparation method and application | |
CN113004372A (en) | Immune polypeptide and application thereof | |
Staykova et al. | Antioxidant capacity of new analogs of Octreotide | |
CN109096368B (en) | Polypeptide with antioxidant and liver protecting activities, gene for encoding polypeptide, preparation method and application thereof | |
CN106399319A (en) | Fejervarya multistriata gene, polypeptide encoded by same and application of polypeptide | |
CN106496317B (en) | Rana chensinensis secretory peptide, gene thereof and application thereof in pharmacy | |
CN101012273A (en) | Rana grahami secretory peptide, gene thereof and application in pharmacy | |
CN101012275A (en) | Rana grahami skin peptide, gene thereof and application in pharmacy | |
CN101503459B (en) | Bloody noun antibacterial peptide temporin-Lb, genes thereof and use in pharmacy | |
Jackway et al. | Disulfide-containing peptides from the glandular skin secretions of froglets of the genus Crinia: Structure, activity and evolutionary trends |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |