CN106432425B - Hypoplophora japonica antioxidant peptide, gene thereof and application thereof in pharmacy - Google Patents

Hypoplophora japonica antioxidant peptide, gene thereof and application thereof in pharmacy Download PDF

Info

Publication number
CN106432425B
CN106432425B CN201610917912.4A CN201610917912A CN106432425B CN 106432425 B CN106432425 B CN 106432425B CN 201610917912 A CN201610917912 A CN 201610917912A CN 106432425 B CN106432425 B CN 106432425B
Authority
CN
China
Prior art keywords
peptide
antioxidant
antioxidant peptide
hypsizygus marmoreus
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201610917912.4A
Other languages
Chinese (zh)
Other versions
CN106432425A (en
Inventor
徐学清
陈新
曾白霜
张贝
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Southern Medical University
Original Assignee
Southern Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Southern Medical University filed Critical Southern Medical University
Priority to CN201610917912.4A priority Critical patent/CN106432425B/en
Publication of CN106432425A publication Critical patent/CN106432425A/en
Application granted granted Critical
Publication of CN106432425B publication Critical patent/CN106432425B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/42—Proteins; Polypeptides; Degradation products thereof; Derivatives thereof, e.g. albumin, gelatin or zein
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/08—Anti-ageing preparations
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Dermatology (AREA)
  • Inorganic Chemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Birds (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention relates to an active polypeptide, a gene thereof and application thereof in pharmacy, wherein the antioxidant peptide of the hypsizygus marmoreus is cyclic peptide consisting of 12 amino acids, the molecular weight is 1334.91 daltons, the isoelectric point is 8.002, the amino acid sequence is SEQ ID NO.1, and the third cysteine and the eleventh cysteine of the polypeptide form an intramolecular disulfide bond. The gene sequence of the hypsizygus marmoreus antioxidant peptide consists of SEQ ID NO.4, wherein the mature hypsizygus marmoreus antioxidant peptide with coding function is 187-222 th nucleotide. The mature functional polypeptide amino acid sequence of the hypsizygus marmoreus antioxidant peptide is deduced from the gene of the hypsizygus marmoreus antioxidant peptide, and the synthesized hypsizygus marmoreus antioxidant peptide has strong erythrocyte agglutination and antioxidant functions.

Description

Hypoplophora japonica antioxidant peptide, gene thereof and application thereof in pharmacy
The technical field is as follows:
the invention relates to the field of biomedicine, in particular to a protein obtained from animal tissues and application thereof in biological pharmacy.
Background art:
in addition, oxidative stress is believed to be associated with various diseases such as senile dementia, Parkinson's disease, which are caused by diabetes, complications caused by diabetes, rheumatoid arthritis and amyotrophic lateral sclerosis (Food Chemistry,2008,107, 1485-.
Amphibians are sometimes damaged by free oxygen, due to the particularities of their living environment, which can lead to serious consequences for metabolism and extensive damage to tissues and cells by oxidizing fats, denatured proteins, destroying nucleic acids, in order to counteract this oxidative damage, amphibians have evolved to form an antioxidant defense system, of which antioxidant polypeptides are an important class of components.
Chinese Boda's multi-species natural biological resources are important sources of structurally diverse small-molecule organic compounds, and some bioactive substances have been recorded and adopted in traditional Chinese medicine for a long time. Many amphibians are widely used as traditional Chinese medicines and national medicines, for example, the hypsizigus marmoreus (Microhyla pulchra) is a traditional Chinese medicine, and its adult is soaked in Chinese liquor or pounded with wine and then can be used for treating various diseases such as fracture, lumbago, rheumatalgia, weakness, traumatic injury, suppuration after ulcer and carbuncle and ulceration, and chronic uncleaved. However, due to the small size and difficulty in capturing the phaeomys somnifera, the research on the structure and function of the pharmacologically active substance in skin has not been reported worldwide, and the substance basis of the effect of the phaeomys somnifera as a Chinese medicine is still unknown.
Since the 21 st century, the rapid development of genomics and the rise of synthetic biology have greatly promoted the research on the structure and function of natural products; the invention obtains the coding gene of the antioxidant peptide of the hypsizygus marmoreus by utilizing a genomics method and pharmacological research, and the inventor searches and compares the coding gene of the antioxidant peptide of the hypsizygus marmoreus by a gene database, and does not find any same gene. The inventor searches the whole sequence structure of the anti-oxidation peptide of the hypsizygus marmoreus of the invention by a protein database and does not find any identical polypeptide.
The invention content is as follows:
the present invention is based on the above technical background, and aims at the problems of the shortage of natural antioxidants and the safety of artificially synthesized antioxidants, to provide a novel antioxidant peptide of hypsizygus marmoreus having antioxidant and erythrocyte agglutination activity, its gene and its application in preparing antioxidant drugs and food additives.
In order to solve the technical problems, the invention adopts the technical scheme that:
a peptide has a sequence shown in SEQ ID No. 1.
KTCVYLPLPICS SEQ ID NO.1
A peptide for resisting the oxidization of the bobble frog is a polypeptide consisting of 12 amino acids, the molecular weight is 1334.91 daltons, the isoelectric point is 8.002, the amino acid sequence is L ys Thr Cys Val Tyr L eu Pro L eu Pro Ile Cys Ser (KTCVY L P L PICS) (SEQ ID NO.1), and the third cysteine and the eleventh cysteine of the polypeptide form an intramolecular disulfide bond.
The coding gene of the hypsizygus marmoreus antioxidant peptide consists of 225 nucleotides, and the sequence from the 5 'end to the 3' end is (SEQ ID NO.4):
Figure GDA0002414535080000021
SEQ ID NO.4
the 187-222 th nucleotide in the sequence codes the mature rana japonica antioxidant peptide with function.
A nucleotide encoding said antioxidant peptide of Rana temporaria chensinensis David.
The hypsizygus marmoreus antioxidative peptide can be applied to preparation of medicines and food additives with antioxidant effects.
The application of the hypsizygus marmoreus antioxidative peptide in preparation of free radical scavenging medicines or cosmetics.
The application of the rana japonica antioxidant peptide in preparing a medicine for preventing or treating gastritis or pancreatitis is preferable, and the gastritis or pancreatitis is inflammation-related gastritis or inflammation-related pancreatitis.
The application of the hypsizygus marmoreus antioxidative peptide in preparation of a targeted drug carrier.
The application of the hypsizygus marmoreus in preparing the medicine for treating the neurodegenerative diseases is preferably used for treating the Parkinson disease.
The invention has the beneficial effects that:
the amino acid structure of the coded gene of the hypsizygus marmoreus antioxidant peptide is deduced, and the synthesized hypsizygus marmoreus antioxidant peptide has obvious erythrocyte agglutination and antioxidation effects. The antioxidant peptide of the hypsizygus marmoreus has the beneficial characteristics of simple structure, convenient artificial synthesis and low toxicity.
Description of the drawings:
FIG. 1 shows the result of the purification and identification of the antioxidant peptide HP L C of the present invention;
FIG. 2 shows the result of mass spectrometric identification of the peptide antioxidant from the Rana grahami of the present invention;
FIG. 3 is a relation curve of the amount-effect of the peptide for scavenging DPPH and ABTS free radicals;
FIG. 4 shows the result of agglutination of erythrocytes by the peptide of the present invention.
The specific implementation mode is as follows:
the invention is described in further detail below with reference to the following figures and detailed description:
the hypsizygus marmoreus antioxidant peptide is a cyclic peptide consisting of 12 amino acids, has the molecular weight of 1334.91 daltons, the isoelectric point of 8.002 and the amino acid sequence of L ys Thr Cys Val Tyr L eu Pro L eu Pro Ile Cys Ser (KTCVY L P L PICS) (SEQ ID NO.1), and the third cysteine and the eleventh cysteine of the polypeptide form an intramolecular disulfide bond.
The gene sequence of the rana japonica antioxidant peptide is coded by 187-222 nucleotides of SEQ ID NO. 4. The preparation process of the hypsizygus marmoreus antioxidant peptide and the gene thereof comprises the following steps:
example 1 cloning of the peptide Gene of the antioxidant peptide of Rana margarita:
I. the method for extracting the total RNA of the skin of the Rana temporaria chensinensis David comprises the steps of cleaning living Rana temporaria chensinensis David with water, placing the living Rana temporaria chensinensis David in liquid nitrogen for quick freezing for 4 hours, taking skin tissues, weighing, taking 300mg of the skin tissues, adding 10m1 of total RNA extraction buffer (Trizol solution, product of GIBCOBR L company, USA), homogenizing in a 20m1 glass homogenizer for 30min, adding an isovolume of phenol/chloroform solution, violently mixing the mixture, placing the mixture at room temperature for 10min, centrifuging at 4 ℃, 12000rpm for 10min, removing precipitates, placing the mixture in supernatant for 10min at room temperature, centrifuging at 4 ℃, at 12000rpm for 10min, washing the precipitates once with 75% ethanol, and airing, wherein precipitates at.
II. Hypocrea (pers.: Fr.) kummerPurification of frog skin mRNA: the mRNA of the skin of the Rana temporaria chensinensis David is isolated and purified by PROMEGA
Figure GDA0002414535080000031
The mRNA Isolation Systems kit comprises the steps of dissolving 500 mu g of total skin RNA of the frogae japonicas in 500 mu l of DEPC water, placing the solution in a 65 ℃ water bath for 10min, adding 3 mu l of Oligo (dT) probe and 13 mu l of 20 × SSC solution, mixing the solution uniformly, placing the solution at room temperature for cooling to obtain solution A, flicking and mixing magnetic beads uniformly, adsorbing 30S on a magnetic frame, collecting supernatant, adding 0.5 × SSC0.3m1, adsorbing 30S on the magnetic frame, suspending the supernatant in 0.1ml of 0.5 SSC 82, collecting solution B, placing the solution A in solution B, placing the solution at room temperature for 10min, adsorbing 30sec on the magnetic frame, collecting supernatant, washing the supernatant for 4 times with 0.1 × SSC, collecting supernatant, adding 0. L ml of DEPC water, suspending the supernatant on the magnetic frame, adsorbing 30sec, transferring the supernatant to a new sample, adding 0.15M of DEPC water, resuspending the supernatant in the magnetic frame, adsorbing 30S, removing the supernatant, placing the supernatant in a test tube, precipitating mRNA in 10 ℃ water, centrifuging the test tube, precipitating the supernatant in 10. mu.00, precipitating the test tube, precipitating the mRNA in 10. mu.5 rpm, and precipitating the test tube, and centrifuging the test tube.
III, constructing the Rana Temporaria Chensinensis David skin cDNA library by using the Creator of C L ONTECHTMSMARTTMcDNA L ibrary Construction Kit plasmid cDNA library Construction Kit.
First Strand cDNA Synthesis (reverse transcription of mRNA) in 0.5ml sterile centrifuge tube 1. mu.l of Rana Temporaria skin mRNA, 1. mu.l of SMART IV oligonucleotide, 1. mu.l of CDS III/3' PCR primer, 2. mu.l of deionized water to make the total volume 5. mu.l are added, the reagents in the centrifuge tube are mixed and centrifuged at 12000rpm for 15sec, the temperature is maintained at 72 ℃ for 2min, the centrifuge tube is incubated on ice for 2min, the following reagents are added in the centrifuge tube 2.0. mu.l of 5 × first Strand buffer, 1.0. mu.l of 20mM dithiothreitol, 1.0. mu.l of 10mM dNTP mixture, 1.0. mu.l of PowerScript reverse transcriptase, the reagents in the centrifuge tube are mixed and centrifuged at 12000rpm for 15sec, the temperature is maintained at 42 ℃ for 1h, the synthesis of the first strand is stopped by placing the centrifuge tube on ice, and 2. mu.l of the synthesized first strand of.
B. Amplifying the second strand by using a long-end polymerase chain reaction (L D-PCR) method, namely preheating a PCR instrument at 95 ℃, carrying out reaction on 2 mu l of a first chain of the cDNA (mRNA) reverse transcription, 80 mu l of deionized water, 10 mu l of 10 × Advantage 2PCR buffer, 2 mu l of 50 × dNTP mixture, 2 mu l of 5 'PCR primer, 2 mu l of CDS III/3' PCR primer and 2 mu l of an escherichia coli polymerase centrifuge tube, amplifying in the PCR instrument according to the following procedures of 95 ℃ for 20sec, 95 ℃ for 5sec, 68 ℃ for 6min and 22 cycles, and extracting the cDNA double strand synthesized in the centrifuge tube after the cycles are finished.
PCR products from PROMEGA
Figure GDA0002414535080000041
The SV Gel and PCR Clean-Up System kit is extracted and recovered, and the steps are as follows: adding cDNA double chains obtained by PCR into equal-volume membrane binding buffer, reversing and uniformly mixing, transferring the mixed solution into a centrifugal purification column, and standing at room temperature for 5 minutes to ensure that the DNA is fully bound with a silica gel membrane. The collection tube was centrifuged at 12000rpm for 30sec to discard the waste liquid. Add 700. mu.l of eluent (containing ethanol) to the centrifugation and purification column, centrifuge at 12000rpm for 30sec, and discard the waste liquid from the collection tube. And repeating the steps. Centrifuge at 12000rpm for 5 min. The centrifugal purification column was placed in a new centrifuge tube. 30. mu.l of ultrapure water was added thereto, and the mixture was allowed to stand at room temperature for 5 min. Centrifuging at 12000rpm for 30sec, and obtaining the purified cDNA double strand in the bottom of the tube.
D. Enzyme digestion, ligation and transformation of ligation products, namely adding 1. mu.l of Takara pMD18-T vector and 4. mu.l of a double-stranded cDNA solution of the Rana margarita into a microcentrifuge tube, adding 5. mu.l of a ligase buffer mixture, reacting at 16 ℃ for 2h, adding the total amount (10. mu.l) into 100. mu.l of DH5 α competent cells, placing the cells in ice for 30min, heating at 42 ℃ for 90Sec, placing the cells in ice for 1 min, adding 890. mu.l of L B culture medium incubated at 37 ℃, slowly shaking at 37 ℃ for culturing for 60min, taking 200. mu.l of the mixture, coating the 200. mu.l of the mixture on L B culture medium containing X-Gal, IPTG and Amp, culturing at 37 ℃ for 16h to form single colonies, washing the colonies on each L B dish with 5m 1L B liquid culture medium, adding 30% of glycerol, freezing and constructing cDNA containing about 1 × 106Individual clones.
IV, cloning and screening the gene of the antioxidant peptide of the hypsizigus marmoreus: the length of the amplification primer is 25 nucleotides5 'ATGTTCACCTTGAAGACATC CCTG 3' (SEQ ID NO.2), and another PCR amplification primer C L ONTECH SMARTTM3 ' PCR Primer in cDNA L ibrary Construction Kit with sequence 5 ' ATTCTAGAGGCCGAGGCGGCCGACATG 3 ' (SEQ ID NO. 3). PCR was performed at 94 ℃ for 30sec, 50 ℃ for 45sec and 72 ℃ for 2.5min for 35 cycles.
The constructed bacterial cDNA library was first titrated, then diluted to the appropriate bacterial concentration with L B medium containing 100. mu.g/ml ampicillin (approximately 5000 bacteria/ml and 30 bacteria/ml for the first round of selection and the second round of selection respectively), plated in a matrix of 8 × 8 on a 96-well plate (64 wells total of 100. mu.1 per well), incubated overnight at 37 ℃ and the bacterial cultures were pooled in rows and columns, 16 samples were PCR identified and the cross-positive well bacterial samples were subjected to the second round of selection.
V, determining the gene sequence of the antioxidant peptide of the hypsizygus marmoreus and obtaining the results: plasmid DNA extraction nucleotide sequences were determined by dideoxy using an apparatus, US Applied Biosystems 373A full-automatic nucleotide sequencer, Sequencing primers were BcaBESTTM Sequencing Primer RV-M and BcaBESTTM Sequencing Primer M13-47, BcaBESTTM Sequencing Primer RV-M sequences: 5 'GAGCGGATAACAATTTCACACAGG 3' (SEQ ID NO.5), BcaBESTTM Sequencing Primer M13-47: 5 'CGCCAGGGTTTTCCCAGTCACGAC 3' (SEQ ID NO. 6). The sequence from 5 'end to 3' end of the gene sequencing result is (SEQ ID NO.4):
Figure GDA0002414535080000051
the sequence table of the nucleotide of the antioxidant peptide gene of the hypsizygus marmoreus is as follows: the sequence length is 225 bases; sequence types: a nucleic acid; number of chains: single-stranded; topology: straight-chain; the sequence types are as follows: cDNA; the source is as follows: skin of Boletus davidii.
The gene of the antioxidant peptide of the hypsizygus marmoreus infers that the mature active secretion peptide with the coding function is the 187-222 th nucleotide, and the amino acid sequence is KTCVY L P L PICS (see the sequence SEQ ID NO.1)
Example 2, preparation of an antioxidant peptide of hypsizygus marmoreus:
a process for preparing antioxidizing peptide from the gazette includes such steps as deducing the amino acid sequence of active mature peptide, synthesizing polypeptide by automatic polypeptide synthesizer, dissolving the polypeptide in 0.1mg/ml solution of acetic acid 0.1%, titrating to pH 7.8 with ammonium hydroxide, stirring overnight at ordinary temp, desalting by HP L C reverse-phase C18 column chromatography, and purifying A liquid to obtain 0.05% TFA + 2% CH3CN, B solution is 0.05% TFA + 90% CH3The gradient of CN and B liquid is 30-50% in 20min, the detection wavelength is 220nm, and the polypeptide appears in 12.962 min.
II, measuring the molecular weight by adopting a Fast atom bombardment mass spectrometry (FAB-MS), taking glycerol, m-nitrobenzyl alcohol, dimethyl sulfoxide (1:1: l, V: V: V, volume ratio) as a substrate, taking Cs + as a bombardment particle, and taking the current as 1 muA and the emission voltage as 25 Kv.
III, identifying the purity of the purified hypsizygus marmoreus antioxidant peptide by using a high performance liquid chromatography (HP L C) method, determining an isoelectric point by using isoelectric focusing electrophoresis, and determining an amino acid sequence structure by using an automatic amino acid sequencer.
The hypsizygus marmoreus antioxidant peptide is cyclic peptide containing 12 amino acids and encoded by a hypsizygus marmoreus antioxidant peptide gene of a Chinese amphibian, has the molecular weight of 1334.91 daltons, the isoelectric point of 8.002, the amino acid sequence of L ys Thr Cys Val Tyr L euPro L eu Pro Ile Cys Ser (KTCVY L P L PICS) (SEQ ID NO.1), and the third cysteine and the eleventh cysteine of the polypeptide form an intramolecular disulfide bond.
Example 3 Activity test of antioxidant peptide of Rana Temporaria Chensinensis David
I, determination of antioxidant Capacity
1) Determination of DPPH radical scavenging Capacity
The antioxidant polypeptide is researched by a DPPH (1, 1-diphenyl-2-picryl-hydrazinyl) free radical scavenging rate measuring method, a DPPH ethanol solution with the concentration of 1 × 10-5 mol/L is prepared and stored in a dark place, 2ml of 0.1mM DPPH absolute ethanol solution is added into a clean test tube containing 2ml of different enzymolysis samples, the mixture is uniformly mixed, after the mixture is placed at room temperature for 30min, the absorbance is measured at 517nm, and the smaller the absorbance, the stronger the free radical scavenging capacity is indicated.
Clearance (%) ═ 1- (a)i-Aj)/A0】*100％
In the formula, A02ml,0.1mM DPPH in absolute ethanol +2ml of sample reagent, blank, Ai2ml,0.1mM DPPH in absolute ethanol +2ml of sample, Aj2ml of absolute ethanol +2ml of sample.
2) Determination of ABTS free radical scavenging Activity
Dissolving ABTS with deionized water to enable the concentration of ABTS to reach 7 mmol/L, adding potassium persulfate to enable the concentration of potassium persulfate to be 2.45 nmol/L, then placing the solution in the dark at room temperature for 12-16 h, diluting the generated ABTS free radical solution with phosphate buffer solution (PBS, 0.2 mol/L, pH 7.4) to enable the light absorption value of the ABTS free radical solution to be 0.70 at 734nm, mixing 0.1ml of enzymolysis solution with 2.9ml of ABTS free radical solution, shaking for 30 seconds, reacting for 10 minutes in the dark, then measuring the light absorption value of the reaction solution at 734nm, and replacing the hydrolysis solution with distilled water to serve as a blank.
Clearance (%) ═ ai-Aj)/A0*100％
In the formula, A0The absorbance of a mixture of 2.9ml of ABTS reagent and 0.1ml of distilled water, AjThe absorbance was 2.9ml ABTS +0.1ml enzymolysis solution mixture.
Free radical oxidation plays an important role in neurodegenerative diseases caused by senile dementia, Parkinson's disease, diabetes, rheumatoid arthritis and amyotrophic lateral sclerosis. The hypsizygus marmoreus antioxidant peptide can well remove free radicals, so that the hypsizygus marmoreus antioxidant peptide can be applied to treatment of related diseases caused by free radical oxidation. In addition, in order to prevent damage to the skin caused by free radicals, it is essential to add a free radical scavenger to a cosmetic skin care product. Therefore, the hypsizygus marmoreus antioxidant peptide can also be applied to beauty skin care products.
II, erythrocyte agglutination activity
In a 96-well hemagglutination plate, the rana chensinensis antioxidant peptide with the initial concentration of 3mg/ml is diluted by 25 mul PBS in a multiple ratio, the solution is kept stand for 5-10min at room temperature, 75 mul 1% chicken erythrocyte suspension is added, the solution is kept stand for 1h at 4 ℃, 75 mul/mlodoranalectin is added into each well of a positive control, equal volume of PBS is added into each well of a negative control, the hemagglutination result is observed as shown in figure 4, the rana chensinensis antioxidant peptide can agglutinate erythrocytes, and the agglutination constant is 11.7 mug/ml. The antioxidant peptide of Rana Temporaria Chensinensis David has lectin-like activity and can agglutinate red blood cells. Lectins are generally able to specifically recognize carbohydrate motifs on the surface of mammalian cells to facilitate drug delivery to specific targets, and thus can be used as carriers for drugs. The Odorranalectin nano-particles have a good promoting effect on the treatment of the Parkinson disease. Therefore, from the viewpoint of the function of agglutinating erythrocytes, the antioxidant peptide of the hyprana marmorata has a very good promoting effect on the treatment of neurodegenerative diseases such as Parkinson's disease.
Figure IDA0001135043720000011
Figure IDA0001135043720000021

Claims (4)

1. A peptide of Rana temporaria chensinensis David has a sequence shown in SEQ ID No.1, and the third cysteine and the eleventh cysteine form an intramolecular disulfide bond.
2. A nucleotide encoding the peptide of claim 1.
3. Use of the phaeobaena margarita antioxidant peptide of claim 1 for the preparation of a medicament and food additive having antioxidant effect.
4. Use of the phaeobaena margarita antioxidant peptide of claim 1 in the preparation of a free radical scavenging medicament or cosmetic product.
CN201610917912.4A 2016-10-20 2016-10-20 Hypoplophora japonica antioxidant peptide, gene thereof and application thereof in pharmacy Expired - Fee Related CN106432425B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610917912.4A CN106432425B (en) 2016-10-20 2016-10-20 Hypoplophora japonica antioxidant peptide, gene thereof and application thereof in pharmacy

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610917912.4A CN106432425B (en) 2016-10-20 2016-10-20 Hypoplophora japonica antioxidant peptide, gene thereof and application thereof in pharmacy

Publications (2)

Publication Number Publication Date
CN106432425A CN106432425A (en) 2017-02-22
CN106432425B true CN106432425B (en) 2020-07-10

Family

ID=58176527

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610917912.4A Expired - Fee Related CN106432425B (en) 2016-10-20 2016-10-20 Hypoplophora japonica antioxidant peptide, gene thereof and application thereof in pharmacy

Country Status (1)

Country Link
CN (1) CN106432425B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101638432A (en) * 2009-03-27 2010-02-03 中国科学院昆明动物研究所 Rana pleuraden antioxidant peptide and genes and application thereof
CN103613645A (en) * 2013-11-26 2014-03-05 大连理工大学 Antioxidant peptide sourced from limnonectes fragilis as well as gene and application thereof
CN105037498A (en) * 2015-06-19 2015-11-11 苏州大学 Antioxidative peptide derived from amolops wuyiensis, gene and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101638432A (en) * 2009-03-27 2010-02-03 中国科学院昆明动物研究所 Rana pleuraden antioxidant peptide and genes and application thereof
CN103613645A (en) * 2013-11-26 2014-03-05 大连理工大学 Antioxidant peptide sourced from limnonectes fragilis as well as gene and application thereof
CN105037498A (en) * 2015-06-19 2015-11-11 苏州大学 Antioxidative peptide derived from amolops wuyiensis, gene and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Tigerinins: Novel Antimicrobial Peptides from the Indian Frog Rana tigerina;Sai 等;《THE JOURNAL OF BIOLOGICAL CHEMISTRY》;20001012;第276卷(第4期);第2703页TABLE I和II *
抗菌肽抗氧化作用机制及其应用前景;肖明珠 等;《食品科学》;20100601;第31卷(第11期);第312页右栏第1段，第314页第3小节 *

Also Published As

Publication number Publication date
CN106432425A (en) 2017-02-22

Similar Documents

Publication Publication Date Title
Shau et al. Cloning and sequence analysis of candidate human natural killer-enhancing factor genes
CN108883138A (en) Enhance the production and isolated method of cell-derived vesica
CN101265296B (en) Reptile cathelicidin antibiotic peptide and derivatives, and application thereof
CN104650210B (en) Preparation method as the TAT HOXB4H recombinant proteins of hematopoiesis irritant
RU2012127298A (en) ENVIRONMENTAL LIQUIDS ENZYMES OBTAINED BY HATCHING, AND THEIR APPLICATION
WO2023051848A1 (en) Anti-tumor recombinant collagen, and preparation method and use therefor
Rakitov et al. Brochosomins and other novel proteins from brochosomes of leafhoppers (Insecta, Hemiptera, Cicadellidae)
JP2005154338A (en) Cell proliferating agent containing basic antibacterial peptide as active ingredient
NL8602960A (en) HUMAN MANGANESE SUPEROXYDEDISMUTASE CDNA, EXPRESSION THEREOF IN BACTERIA AND METHOD FOR WINNING ENZYMATIC ACTIVE HUMAN MANGANESE SUPEROXIDE DISMUTASE.
CN106432425B (en) Hypoplophora japonica antioxidant peptide, gene thereof and application thereof in pharmacy
Shen et al. Molecular cloning, characterization and expression of the complement component Bf/C2 gene in grass carp
CN110317813B (en) Portunus trituberculatus C-type lectin PtCLec2 gene, and coding protein and application thereof
CN116874590A (en) Recombinant III type collagen and preparation method thereof
CN111448320A (en) Cell membrane penetrating peptides
CN106432483B (en) Rana chensinensis skin serine protease inhibitory peptide, gene and pharmaceutical application thereof
CN116693626A (en) Staple peptides and uses thereof and methods for expanding stem cells in vitro
CN107501395B (en) Rana nigromaculata antioxidant peptide, gene and application thereof
CN106397564B (en) Black-frame toad antioxidant peptide, gene thereof and application thereof in pharmacy
CN86108955A (en) New cell growth regulator
CN106478811B (en) Giant knotweed frog protease inhibitory peptide, gene thereof and application thereof in pharmacy
EP3811983B1 (en) Composition for cell transplant, and method for cell transplant
KR100692226B1 (en) NOVEL POLYPEPTIDES, cDNAS ENCODING THE SAME AND UTILIZATION THEREOF
CN114349821B (en) Application of frog skin antioxidant peptide and gene thereof in pharmacy and anti-wrinkle cosmetics
KR20160049874A (en) Composition or method for preventing or treating hair loss, and screening method for a material preventing, treating, or alleviating of hair loss
CN110106181A (en) Application of 2 LmLRP2 and its dsRNA of migratory locusts LDL receptor related gene in migratory locusts prevent and treat

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20200710

CF01 Termination of patent right due to non-payment of annual fee