CN101475630B - Bloody noun antibacterial peptide temporin-La, genes thereof and use in pharmacy - Google Patents
Bloody noun antibacterial peptide temporin-La, genes thereof and use in pharmacy Download PDFInfo
- Publication number
- CN101475630B CN101475630B CN2008100516382A CN200810051638A CN101475630B CN 101475630 B CN101475630 B CN 101475630B CN 2008100516382 A CN2008100516382 A CN 2008100516382A CN 200810051638 A CN200810051638 A CN 200810051638A CN 101475630 B CN101475630 B CN 101475630B
- Authority
- CN
- China
- Prior art keywords
- bullfrog
- antibacterial peptide
- leu
- gene
- peptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides bullfrog antimicrobial peptide temporin-La and a gene and application thereof in pharmacy, which belong to the field of biomedicine. The gene of the bullfrog antimicrobial peptide is obtained by screening from a constructed bullfrog skin cDNA library, the molecular weight is 1,623.08D, the isoelectric point is 9.70, and a primary structure of a complete sequence of the peptide is Leu Leu Arg His Val Val Lys Ile Leu Glu Lys Tyr Leu-AMIDATION. The gene for encoding the bullfrog antimicrobial peptide consists of 324 nucleotides, wherein 142th to 180th of nucleotides are used for encoding the mature peptide. The bullfrog antimicrobial peptide which is artificially synthesized has obvious effect of inhibiting the growth of bacteria and fungi, has the advantage of no hemolytic activity, and can be applied to preparing a medicine for treating pathogenic microorganism infection diseases.
Description
Technical field
The present invention relates to a kind of bloody noun antibacterial peptide temporin-La and gene thereof and the application in pharmacy, belong to field of biomedicine technology.
Background technology
Antibacterial peptide as a kind of novel concept, broad-spectrum antimicrobial protein microbiotic will have than traditional microbiotic vast market prospect more, promise to be antiseptic-germicide of new generation, its development is subjected to extensive attention at present.At present from different anuran skin, be separated to more than 300 different antibacterial peptide, and its number is increasing also.From the researchist of Kunming Institute of Zoology, Chinese Academy of Sciences biotoxin system at Odorrana grahami (odorranagrahami, a kind of Amphibians) 107 kinds of novel antibacterial peptides (antimicrobial peptides) have been found in, and carried out antibacterial mechanisms research, this batrachians antibacterial peptide number than present report has been Duoed three times, be the abundantest antibacterial peptide resource of finding up to now, this also provides important information for antibacterial mechanisms research.
In China, a lot of amphibian animals are used as traditional Chinese medicine and national medicine and widespread use, as Chinese toad (Bufogargarizans) etc.The skin of these amphibian animals and internal organ have pharmacologically active and clinical efficacy widely.Reported that pharmacologically active has wide spectrum anti-microbial effect, antitumor, analgesia, toponarcosis, immunomodulatory, cardiovascular systems effect etc.According to domestic and foreign literature, separated obtaining different active polypeptide from various biogenetic derivations, and some has entered clinical treatment.For example the esculentin-1 gene is transferred in the tobacco, detects the existence of activated esculentin-1 in its body fluid, this kind of plant obviously strengthens the resistibility of bacterium and fungi simultaneously; Antibacterial peptide Magainin tool spectrum anti-microbial effect from Xenopus laevis (Xenopuslaevis) skin juice obtains has anti-tumor activity simultaneously, has got permission as extensive pedigree antibiotic in the U.S., and it is clinical that its gene engineering product entered for three phases.
There is long history in China to the application of batrachians medicine, but the research of its activeconstituents and pharmacological properties is mainly concentrated on organic molecules such as alkaloid, and is few to the research of its skin activity peptide matters.
The contriver compares bullfrog antibacterial peptide complete sequence amino acid structure of the present invention through Protein Data Bank, find no any phase homopolypeptide.
Summary of the invention:
The object of the present invention is to provide a kind of bloody noun antibacterial peptide temporin-La,, have pharmacologically active for a kind of new bullfrog antibacterial peptide.
The present invention also further provides the application of bloody noun antibacterial peptide temporin-La in pharmacy, preparation cause pathogeny imcrobe infection treatment of diseases medicine and anti-tumor medicine.
In order to realize purpose of the present invention, the invention provides following technical scheme:
The bullfrog antibacterial peptide is a kind of single chain polypeptide by Anura bullfrog antibacterial peptide gene coding, molecular weight is 1623.08 dalton, iso-electric point is 9.70, and polypeptide complete sequence primary structure is: Leu Leu Arg His Val Val Lys IleLeu Glu Lys Tyr Leu-AMIDATION.
The clone of bullfrog antibacterial peptide gene comprises:
The extraction of the total RNA of bullfrog skin, the purifying of mRNA, the reverse transcription of mRNA and cDNA library construction, design primer utilize PCR method screening bullfrog antibacterial peptide gene.Amplimer length is 20 Nucleotide, and its sequence is-ATGTTCACCWTGAAGAAATC-3 ' that another amplimer of PCR is the SMART of CLONTECH company
TM5 ' PCR Primer primer among the cDNA Library Construction Kit, its sequence be 5 '-ATTCTAGAGGCCGAGGCGGCC-3 '.The positive monoclonal that obtains carries out nucleotide sequencing.Sequencing result shows that the gene of bullfrog antibacterial peptide is made up of 324 Nucleotide, from 5 ' end to 3 ' terminal sequence is:
atgttccccttgaagaaatccctgttactcctttttttccttgggaccatcaacttatct 60
ttttgtgaggaagagagagatgtcgatcaagatgaaagaagagatgatccaggtgaaagg 120
aatgttcaagtggaaaaacgattgttacgacatgttgtaaagattctcgaaaaatatttg 180
ggaaaataaccagaaatgttgaaactttgaaaatggaattggaaatcatttgatgtggaa 240
tattatttggctaaatgctcaacagatgttttataaaaataaataaatatgttgcaaaaa 300
aaaaaaaaaaaaaaaaaaaaaaaa 324
The ripe antibacterial peptide of coding bullfrog is a 142-180 position Nucleotide, and its aminoacid sequence is:
Leu?Leu?Arg?His?Val?Val?Lys?Ile?Leu?Glu?Lys?Tyr?Leu-AMIDATION
The bullfrog antibacterial peptide gene prepares the application of bullfrog antibacterial peptide as genetically engineered.
The preparation method of bullfrog antibacterial peptide:
Infer according to the gene of coding bullfrog antibacterial peptide and the aminoacid sequence of bullfrog antibacterial peptide to synthesize its complete sequence with automatic Peptide synthesizer APEX396.By the anti-phase C of HPLC
18Column chromatography desalination, purifying.Identify its purity with the high-efficient liquid phase chromatogram HPLC method then, molecular weight determination adopts the fast atom bombardment mass spectroscopy(FABMS) method, and isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
Following pharmacological evaluation has confirmed that the bullfrog antibacterial peptide has the effect of significant inhibition bacterium and fungal growth, can be used as preparation cause pathogeny imcrobe infection treatment of diseases medicine and is employed.
1, the effect of bullfrog antibacterial peptide bacteria growing inhibiting:
Anti-microbial activity detects, and when measuring minimal inhibitory concentration (MIC), adopts doubling dilution to carry out antibiotic detection.With the LB liquid nutrient medium as developing medium.Become every milliliter to contain 10 with LB substratum dilution bacterium colony the reference culture of incubated overnight
5The bacterium liquid of bacterium is inoculated in the LB liquid nutrient medium with bacterium liquid, and the bacterium ultimate density is 10
5
On 96 porocyte culture plates, add in the 90 μ L LB substratum, adding through the bullfrog antibacterial peptide sample 10 μ L that are dissolved in physiological saline of 0.22 μ m aperture membrane filtration as first hole, get 50 μ L behind the mixing and add the 2nd pipe, doubling dilution successively, 50 μ L discard from the 9th hole sucking-off, the 10th piping control tube, each sample repeats twice.Bacterial isolates is institute of animal husbandry and veterinary medicine of Jilin University microorganism and preserve the immunization experiment chamber, result such as table 1.
Table 1, the bacteriostatic activity of bullfrog antibacterial peptide
By table 1 as seen, synthetic bullfrog antibacterial peptide has the effect of significant bacteria growing inhibiting.
2. the bullfrog antibacterial peptide suppresses the effect of fungal growth:
Anti-mycotic activity detects and adopts cylinder plate method, substratum to adopt improvement husky Bao Shi (Sabousand).Adopting doubling dilution to carry out anti-microbial activity detects.On 96 porocyte culture plates, add in the husky Bao Shi substratum of 90 μ L, adding through the bullfrog antibacterial peptide sample 10 μ L that are dissolved in physiological saline of 0.22 μ m aperture membrane filtration as first hole, get 50 μ L behind the mixing and add the 2nd pipe, doubling dilution successively, 50 μ L discard from the 9th hole sucking-off, the 10th piping control tube, each sample repeats twice.Candida albicans is that result such as table 2. are preserved in institute of animal husbandry and veterinary medicine of Jilin University microorganism and immunization experiment chamber
Table 2. bullfrog antibacterial peptide suppresses the effect of fungal growth
As shown in Table 2, the bullfrog antibacterial peptide has the effect that suppresses fungal growth.
Beneficial effect of the present invention is:
By bullfrog antibacterial peptide encoding gene its amino acid structure of deriving, synthetic a kind of new bullfrog antibacterial peptide, effect with significant inhibition bacterium and fungal growth, the beneficial features that this bullfrog antibacterial peptide has is simple in structure, synthetic convenient, antibiotic pedigree is wide, the medicine that can be used as preparation treatment cause pathogeny imcrobe infection disease is employed.
Embodiment
Further specify essentiality content of the present invention with embodiment below, but content of the present invention is not limited thereto.
Embodiment 1:
Bullfrog antibacterial peptide gene clone:
I. the total RNA of bullfrog skin extracts
A. the live body bullfrog cleans up with distilled water, and the sterilization pin causes paralysis from the oblongata chamber of bullfrog, gets 50～100mg bullfrog skin tissue and puts into the dried mortar of baking, and adds 1mL TRIZOL Reagent (Invitrogen company product) and grinds in ice-water bath rapidly.
B. behind the abundant mixing, move into (DEPC pipe) 15～30 ℃ of placements 5min in the 1.5mL centrifuge tube, add the equal-volume chloroform, vortex mixing 15s, 4 ℃, the centrifugal 15min of 12000 * g.
C. get supernatant and add 500 μ L Virahols, place 5min, vortex 15s mixing, 4 ℃, the centrifugal 10min of 12000 * g for 15～30 ℃.Abandon supernatant, add 1mL 75% ethanol rinsing precipitation, the centrifugal 5min of 7500 * g repeats 1 time.Dry 90s in the Bechtop with 30 μ L RNase-free water dissolving, promptly obtains the bullfrog skin total tissue RNA.
II. the Oligotex of operation steps according to German QIAGEN company adopted in bullfrog skin mRNA separation and purification
MRNA Mini Kit test kit specification sheets carries out.
III. the structure in bullfrog skin cDNA library
Adopt the Creator of CLONTECH company
TMSMART
TMCDNA Library Construction Kit library construction test kit.
A.cDNA first chain synthesizes (mRNA reverse transcription)
1. add 1 μ L bullfrog skin mRNA, 1 μ L SMART IV oligonucleotide, 1 μ L CDS111/3 ' PCR primer at the aseptic centrifuge tube of 05mL, add 2 μ L deionized waters and make cumulative volume reach 5 μ L.
2. the reagent in the mixing centrifuge tube is also of short duration centrifugal, and 72 ℃ are incubated 2 minutes.
3. centrifuge tube was hatched on ice 2 minutes.
4. in centrifuge tube, add following reagent 2 μ L 5X first chain buffering, 1.0 μ L 20mM dithiothreitol (DTT), 1. 0 μ L dNTP (10mM) mixture, 1.0 Powerscript ThermoScript II.
5. reagent and of short duration centrifugal in the mixing centrifuge tube is incubated 1 hour at 42 ℃.
6. centrifuge tube is placed and end the synthetic of first chain on ice.
7. it is standby to get the 2 synthetic cDNA of μ L institute, first chain from centrifuge tube.
B. adopt long terminal polymerase chain reaction (LD-PCR) method second chain that increases
1.95 ℃ preheating PCR instrument.
2. with 2 μ L cDNA, first chains (mRNA reverse transcription), 80 μ L deionized waters, 10 μ L10
*Advantage 2PCR damping fluid, 2 μ L 50
*DNTP mixture, 2 μ L, 5 ' PCR primer, 2 μ L CDS111/3 ' PCR primers and 2 μ L 50
*Advantage 2 Polymerase Mix centrifuge tubes react.
3. in the PCR instrument, increase by following program:
1. 95 ℃ 1 minute;
2. 22 circulations: 95 ℃ of 15 second, 68 ℃ of renaturation 6 minutes.
4. after the loop ends, synthetic cDNA two strands in the centrifuge tube is carried out purifying.
The purifying of C.cDNA two strands
1. the digestion of Proteinase K: in the test tube of a 0.5mL, add double-stranded cDNA (the 2-3 μ g) product that 50 μ L obtain through amplification, then to the Proteinase K that wherein adds 2 μ L (20 μ g/ μ L).
Attention: handle the activity that suppresses archaeal dna polymerase with Proteinase K and be very important.The amount that this system process in operating process is optimized best PCR product cDNA is 2-3ug (a 50uL system).Too much double-stranded cDNA can reduce tiring of library.
2. put upside down mixing, 45 ℃, 20 minutes.
3. add 50 μ L deionized waters.
4. add 100 μ L phenol: chloroform: primary isoamyl alcohol, soft continuously putting upside down mixed 1-2 minute.
5.14,000rpm, 5min two is separated it.
6. upper strata (water) moved into the test tube (discarding interface and lower floor's liquid) of clean 0.5ml
7. add the 100ul chloroform: primary isoamyl alcohol, soft continuously putting upside down mixed 1-2 minute.
8.14,000rpm, 5min two is separated it.
9. upper strata (water) moved into the test tube (discarding interface and lower floor's liquid) of clean 0.5ml
10. add 3M NaAc sodium-acetate 10 μ L, Glycogen glycogen (20ug/ul) 1.3 μ L, 95% ethanol (room temperature), 260 μ L, 14,000rpm, centrifugal 20 minutes of room temperature.
Attention: before centrifugal, sample is not carried out-20 ℃ of precoolings or ice bath, will cause sample and impurity coprecipitation to the cooling of centrifuge tube.
11. with rifle careful remove supernatant, the rifle head is not run into precipitate, cleans precipitate with the ethanol of 100 μ L 80%.
12. ethanol evaporation at the air drying precipitate, adds deionized water suspension precipitate.
D. the preparation of bacillus coli DH 5 alpha competent cell:
1. the streak inoculation of picking bacillus coli DH 5 alpha list bacterium colony is on fresh LB agar plate, and 37 ℃ are spent the night.Picking list colony inoculation is in the LB liquid nutrient medium of 25mL.
2. spend the night with 37 ℃ of joltings of 220-225rpm.Getting the 10mL overnight culture is inoculated among the 1L LB.Cultivate up to OD 37 ℃ of violent joltings
600Reach 0.5-0.7, ice bath 1h.
3. bacterium liquid is transferred in the centrifugal bottle of precooling of sterilization.With 4000rpm (2800 * g) 4 ℃, 15min.Remove supernatant liquor, bottle is placed on ice.Ice the resuspended precipitation of 10% glycerine of precooling lightly with 1L.
4.4000rpm (2800 * g) 4 ℃, 15min is lightly with the resuspended precipitation of 10% glycerine of 0.5L ice precooling.
5.4000rpm (2800 * g) 4 ℃, 15min is lightly with the resuspended precipitation of 10% glycerine of 250mL ice precooling.
6.4000rpm(2800×g)4℃，15min。Reach 3.5mL with the resuspended final volume that makes of glycerine.Bacterial density is approximately 3 * 10
10Cell/mL.Equal-volume is packed as 100 μ L/ parts, is put in the dry ice rapidly.Store competent cell at-80 ℃.
7. transform the checking competence with superhelix carrier such as Puc19.Should produce 0.5-1 * 10 at least
10The cell of cfu/ μ g.
E. the conversion that connects and connect product:
1. add the Solutionl of 0.3 μ L TaKaRa pMD18-T carrier, the double-stranded solution of 2.2 μ L bullfrog cDNA, adding 2.5 μ L in Eppendorf tube, full dose is 5 μ L.
2.16 a ℃ connection is spent the night.
3. full dose (5 μ L) is added in the 100 μ L DH5a competent cells, ice bath 30 minutes.
5.42 ℃ thermal shock is after 90 seconds, ice bath 2 minutes.
6. add LB substratum 800 μ L, 37 ℃ of slow shaking culture (60-80 commentaries on classics/min) 45-60 minute.
7. get 200 μ L and coat on the LB substratum that contains Amp+ 37 ℃ and cultivated 16 hours, form single bacterium colony.
8. each LB plate washs bacterium colony with 5mL LB liquid nutrient medium, and it is frozen to add 30% glycerine.The cDNA library that makes up approximately contains 1 * 10
6Individual independent clone.
IV. bullfrog antibacterial peptide gene colony screening
Amplimer length is 20 Nucleotide, its sequence is 5 '-ATGTTCACCWTGAAGAAATC-3 ', another amplimer of PCR is the SMART of CLONTECH company
TM5 ' PCR Primer primer among the cDNA Library Construction Kit, its sequence be 5 '-ATTCTAGAGGCCGAGGCGGCC-3 '.
The PCR reaction conditions is as follows: 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ 2 minutes, totally 35 the circulation, 72 ℃ 10 minutes.
V. bullfrog antibacterial peptide gene sequencing and result
Extract plasmid and use M13+ and the M13-order-checking, instrument is ABI PRISM 3730 full-automatic nucleotide sequencing instrument, and gene sequencing result from 5 ' end to 3 ' terminal sequence is:
atgttccccttgaagaaatccctgttactcctttttttccttgggaccatcaacttatct 60
ttttgtgaggaagagagagatgtcgatcaagatgaaagaagagatgatccaggtgaaagg 120
aatgttcaagtggaaaaacgattgttacgacatgttgtaaagattctcgaaaaatatttg 180
ggaaaataaccagaaatgttgaaactttgaaaatggaattggaaatcatttgatgtggaa 240
tattatttggctaaatgctcaacagatgttttataaaaataaataaatatgttgcaaaaa 300
aaaaaaaaaaaaaaaaaaaaaaaa 324
The sequence table of bullfrog antibacterial peptide gene Nucleotide is: sequence length is 324 bases, sequence type: nucleic acid, chain number: strand, sequence kind: cDNA, source: bullfrog skin
Coding bullfrog mature peptide antibacterial peptide is a 142-180 position Nucleotide, and its aminoacid sequence is:
Leu?Leu?Arg?His?Val?Val?Lys?Ile?Leu?Glu?Lys?Tyr?Leu-AMIDATION
Synthetic bullfrog antibacterial peptide has the effect of significant inhibition bacterium and fungal growth, can be used as preparation cause pathogeny imcrobe infection treatment of diseases medicine and is employed.
Embodiment 2:
Preparation bullfrog antibacterial peptide
The preparation method of I, sample: infer according to the gene of coding bullfrog antibacterial peptide and the aminoacid sequence of bullfrog antibacterial peptide to synthesize its complete sequence with automatic Peptide synthesizer APEX396.By the anti-phase C of HPLC
18Column chromatography desalination, purifying.
II, molecular weight determination adopt electron spray ionisation, and (electrospray ionization, ESI), emission voltage is 4.5Kv.
The bullfrog antibacterial peptide of III, purifying is identified its purity (flow velocity 1.0ml/min with the high-efficient liquid phase chromatogram HPLC method; Moving phase acetonitrile+water+TFA0.01%, gradient elution; Chromatographic column C
18, detect wavelength 220nm), molecular weight determination adopts the fast atom bombardment mass spectroscopy(FABMS) method, and isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
The bullfrog antibacterial peptide is a kind of single chain polypeptide by Anura animal bullfrog antibacterial peptide gene coding, molecular weight is respectively 1623.08 dalton, iso-electric point is 9.70, and polypeptide complete sequence primary structure is: leucine-leucine-arginine-Histidine-Xie Ansuan-Xie Ansuan-Methionin-Isoleucine-leucine-glutamic-lysine-tyrosine-leucine-amidation (Leu Leu Arg His Val Val Lys Ile Leu Glu Lys Tyr Leu-AMIDATION).
Sequence table
＜110〉Jilin University
＜120〉bloody noun antibacterial peptide temporin-La and gene thereof and the application in pharmacy
<130>20
<160>1
<170>Patentln?version?3.5
<210>1
<211>324
<212>DNA
<213>Rana?catesbeiana
<400>1
atgttcccct?tgaagaaatc?cctgttactc?ctttttttcc?ttgggaccat?caacttatct 60
ttttgtgagg?aagagagaga?tgtcgatcaa?gatgaaagaa?gagatgatcc?aggtgaaagg 120
aatgttcaag?tggaaaaacg?attgttacga?catgttgtaa?agattctcga?aaaatatttg 180
ggaaaataac?cagaaatgtt?gaaactttga?aaatggaatt?ggaaatcatt?tgatgtggaa 240
tattatttgg?ctaaatgctc?aacagatgtt?ttataaaaat?aaataaatat?gttgcaaaaa 300
aaaaaaaaaa?aaaaaaaaaa?aaaa 324
Claims (3)
1. bloody noun antibacterial peptide temporin-La is characterized in that: be a kind of single chain polypeptide of bullfrog antibacterial peptide gene coding, molecular weight is 1623.08 dalton, and iso-electric point is 9.70, and polypeptide complete sequence primary structure is:
Leu?Leu?Arg?His?Val?Val?Lys?Ile?Leu?Glu?Lys?Tyr?Leu-AMIDATION。
2. Nucleotide of bloody noun antibacterial peptide temporin-La according to claim 1 of encoding, its sequence is the 142-180 position Nucleotide of sequence shown in the Seq ID NO.1.
3. the described bloody noun antibacterial peptide temporin-La of claim 1 is in the application of preparation antibacterium and fungi infestation medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008100516382A CN101475630B (en) | 2008-12-22 | 2008-12-22 | Bloody noun antibacterial peptide temporin-La, genes thereof and use in pharmacy |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008100516382A CN101475630B (en) | 2008-12-22 | 2008-12-22 | Bloody noun antibacterial peptide temporin-La, genes thereof and use in pharmacy |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101475630A CN101475630A (en) | 2009-07-08 |
| CN101475630B true CN101475630B (en) | 2011-12-21 |
Family
ID=40836413
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008100516382A Expired - Fee Related CN101475630B (en) | 2008-12-22 | 2008-12-22 | Bloody noun antibacterial peptide temporin-La, genes thereof and use in pharmacy |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101475630B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101724632B (en) * | 2009-07-15 | 2012-11-07 | 吉林大学 | Bullfrog skin active peptide, gene and application thereof in pharmacy |
| CN102952820A (en) * | 2011-08-30 | 2013-03-06 | 青岛根源生物技术集团有限公司 | Production method of genetic engineering hybrid antimicrobial peptide CecA-Temporin-SHF |
| CN103641903B (en) * | 2013-11-27 | 2016-03-02 | 苏州大学 | A kind of temporin-Lb CRC and variant, coding nucleic acid and application |
| CN111349144A (en) * | 2018-12-24 | 2020-06-30 | 天津农学院 | Antitumor polypeptide extracted from bullfrog and analysis method |
-
2008
- 2008-12-22 CN CN2008100516382A patent/CN101475630B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| 赵瑞利 等.牛蛙皮肤抗菌肽的分离纯化与活性测定.《中国生物制品学杂志》.2008,第21卷(第8期),694-697. * |
| 金莉莉 等.蛙科两栖动物皮肤抗菌肽的分子多样性及功能.《遗传HEREDITAS (Beijing)》.2008,第30卷(第10期),1241―1248. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101475630A (en) | 2009-07-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Molecular cloning and expression profile of putative antilipopolysaccharide factor in Chinese shrimp (Fenneropenaeus chinensis) | |
| Liu et al. | Effect of intraperitoneal injection of immunostimulatory substances on allochthonous gut microbiota of Atlantic salmon (Salmo salar L.) determined using denaturing gradient gel electrophoresis | |
| Zhao et al. | Evidences of abundant hemocyanin variants in shrimp Litopenaeus vannamei | |
| CN101475630B (en) | Bloody noun antibacterial peptide temporin-La, genes thereof and use in pharmacy | |
| CN112094833B (en) | Bacteriostatic protein, and coding gene, application and strain thereof | |
| Liu et al. | Molecular characterization and antibacterial immunity functional analysis of the antimicrobial peptide hepcidin from Coregonus ussuriensis berg | |
| Zhu et al. | Molecular characterization of minichromosome maintenance protein (MCM7) in Scylla paramamosain and its role in white spot syndrome virus and Vibrio alginolyticus infection | |
| CN101503459B (en) | Bloody noun antibacterial peptide temporin-Lb, genes thereof and use in pharmacy | |
| Sathyamoorthi et al. | Fish heat shock cognate 70 derived AMPs Cs HSC70 A1 and Cs HSC70 A2 | |
| CN103360467B (en) | Preparation method of broad-spectrum antibacterial polypeptide | |
| CN101724632B (en) | Bullfrog skin active peptide, gene and application thereof in pharmacy | |
| CN101168564B (en) | Human antibiotic peptide and use for derivative thereof | |
| CN103882029B (en) | A kind of Africa emperor's scorpion antibiotic peptide gene, antibacterial peptide Pi_4, its structure homology antibacterial peptide, preparation method and application | |
| Sun et al. | Gene expression patterns in response to pathogen challenge and interaction with hemolin suggest that the Yippee protein of Antheraea pernyi is involved in the innate immune response | |
| Chen et al. | Molecular cloning and characterization of a galectin-1 homolog in orange-spotted grouper, Epinephelus coioides | |
| CN112321697B (en) | Hermetia illucens antibacterial peptide Cecropin-alpha and application thereof | |
| CN104910266A (en) | Amolops wuyiensis antibacterial peptide as well as encoding gene and application thereof | |
| CN113527461A (en) | Horseshoe head bats source antibacterial peptide RF-CATH1 and application thereof | |
| CN101845092A (en) | Antimicrobial peptide Ea-CATH1 of Equus asinus and genes and application thereof | |
| CN101508993B (en) | Bullfrog lectin gene, encoded lectin and uses thereof | |
| CN102115496A (en) | Antimicrobial peptide Pc-CATH1 and gene thereof, chemical synthesis method and application thereof | |
| Antony et al. | Molecular characterization and phylogenetic analysis of a penaeidin-like antimicrobial peptide, Fi-penaeidin from Fenneropenaeus indicus | |
| CN102250216A (en) | Rana nigromaculata antimicrobial peptide as well as gene and application thereof | |
| Zhang et al. | Identification and function of a lebocin-like gene from the Chinese oak silkworm, Antheraea pernyi | |
| CN113480631B (en) | Horseshoe head bats source antibacterial peptide RF-CATH2 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111221 Termination date: 20141222 |
|
| EXPY | Termination of patent right or utility model |