CN101575616B - Avian influenza and MD bivalent vaccine rMDV-HA virus strain and construction method - Google Patents
Avian influenza and MD bivalent vaccine rMDV-HA virus strain and construction method Download PDFInfo
- Publication number
- CN101575616B CN101575616B CN2007101339535A CN200710133953A CN101575616B CN 101575616 B CN101575616 B CN 101575616B CN 2007101339535 A CN2007101339535 A CN 2007101339535A CN 200710133953 A CN200710133953 A CN 200710133953A CN 101575616 B CN101575616 B CN 101575616B
- Authority
- CN
- China
- Prior art keywords
- virus
- rmdv
- strain
- vaccine
- marek
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention relates to bird flu and Marek's disease dual live vaccine rMDV-HA viral strain and a construction method. H5 subtype bird flu virus SY strain haemagglutinin genes, reticuloendotheliosis disease virus LTR, screening mark genes lac/smGFP and Marek's virus Rispens CVI 988 vaccine strain genome exogenous genes are amplified by adopting reverse transcriptase-polymerase chain reaction or polymerase chain reaction and cloned to plasmid vectors to form recombinant plasmids pHA, pLTR, ploxP-lac/smGFP-loxP, pUP and pDOWN; DNA of transfer vector pMHA plasmids and DNA extracted from cells infected from the Marek's virus Rispens CVI 988 vaccine strain are co-transfected to chick embryo fibroblast; the exogenous genes are inserted to the Marek's virus Rispens CVI 988 vaccine strain genome through homologous recombination to form recombinant virus rMDV-HA/GFP with the screening mark genes; and the screening mark genes lac/smGFP of the rMDV-HA/GFP are removed through cre enzyme-mediated loxP site sequence recombination, and the rMDV-HA/GFP is purified to form the rMDV-HA viral strain. The rMDV-HA viral strain has the advantages of low cost, no pollution and long immunity period, and can be used as bird flu and Marek's disease dual live vaccine viral strain.
Description
Technical field
The present invention relates to a kind of virus strain, particularly a kind of poultry is used bird flu and Marek bigeminal live vaccine rMDV-HA virus strain.
Background technology
Bird flu and Marek are two kinds of important transmissible diseases of chicken, are caused by avian influenza virus (AIV) and Mareks disease virus (MDV) respectively, can cause very big financial loss and public health harm.
Before the present invention, found that the immune effect of MDV Rispens CVI 988 vaccine strains is good, duration of immunity is long, be to produce the vaccine strain of going up widespread use at present.A plurality of virus replication non-essential fragments are arranged on this vaccine strain genome, when construction of recombinant virus, can be used as the insertion site of foreign gene.
Hemagglutinin on the AIV cyst membrane (HA) is pathogenic closely related with virus.Found the AIV of 16 kinds of HA hypotypes, wherein H5 hypotype AIV is the main pathogen that causes high pathogenic avian influenza.The main means of the bird flu of China's control at present are the inoculation inactivated vaccines.Though inactivated vaccine can stimulate body to produce humoral immunization, can not produce mucosal immunity and cellular immunization, so its duration of immunity is not long.In addition, the production cost height of inactivated vaccine may cause the pollution of virus to environment in the production process.
Summary of the invention
Purpose of the present invention just is to overcome the above-mentioned defective of existing inactivated avian influenza vaccine, development bird flu and Marek bigeminal live vaccine rMDV-HA virus strain and construction process.
Technical scheme of the present invention is:
A kind of bird flu and Marek bigeminal live vaccine rMDV-HA virus strain, its major technique feature is that to have inserted in the genome of Mareks disease virus Rispens CVI 988 vaccine strains with RE hyperplasia syndrome virus LTR be the hemagglutinin gene of the H5 subtype avian influenza virus SY strain of promotor, is the recombinant marek's disease toxic vaccine strain that adopts the artificial expression avian flu virus hemagglutinin that makes up of recombinant DNA technology.
Another technical scheme of the present invention is:
The construction process of a kind of bird flu and Marek bigeminal live vaccine rMDV-HA virus strain, its major technique step is: adopt increase the respectively hemagglutinin gene of H5 subtype avian influenza virus SY strain of reverse transcription-polymerase chain reaction or polymerase chain reaction, RE hyperplasia syndrome virus LTR, screening marker gene lac/smGFP and the genomic foreign gene of Mareks disease virus Rispens CVI 988 vaccine strains that two ends have the loxP site insert both sides, site sequence, and these dna fragmentations are cloned in the plasmid vector, obtain recombinant plasmid pHA, pLTR, ploxP-lac/smGFP-loxP, pUP and pDOWN; Utilize these recombinant plasmids, be built into transfer vector pMHA; With transfer vector pMHA plasmid DNA and the DNA cotransfection chick embryo fibroblast of extracting from Mareks disease virus RispensCVI 988 vaccine strain cells infecteds, by homologous recombination foreign gene is inserted into Mareks disease virus Rispens CVI 988 vaccine strain genomes, obtains recombinant virus rMDV-HA/GFP with the screening marker gene; Screening marker gene lac/smGFP by sequence reorganization removal rMDV-HA/GFP between the loxP site of cre enzyme mediation obtains the rMDV-HA virus strain behind the purifying.
Advantage of the present invention and effect are that with MDV Rispens CVI 988 vaccine strains be carrier, the rMDV-HA virus strain of construction expression H5 hypotype AIV HA.This virus strain is still the strain of MDV vaccine virus on the one hand; Can express AIV HA on the other hand, make chicken produce hemagglutination inhibition antibody, can be used as bird flu and Marek bigeminal live vaccine virus strain.
The present invention selects the insertion site of the genomic replicate nonessential fragment of MDV Rispens CVI 988 vaccine strains (partial sequence of short distinct zones sorf 1-sorf2 gene) as AIV HA gene, the rMDV-HA virus strain that makes up still keeps the biological characteristics of MDV, and is constant to the immune effect of Marek.REV LTR is a kind of strong promoter, can guarantee rMDV-HA virus strain high level expression AIV HA.The rMDV-HA virus strain no longer has screening marker gene lac/smGFP, and virus is more stable like this.As bird flu and Marek bigeminal live vaccine virus strain, the production cost of rMDV-HA virus strain is low, and can not cause the pollution of virus to environment in the production process.
Other concrete advantage of the present invention and effect will continue to describe below.
Embodiment
The total design of the present invention is: with MDV Rispens CVI 988 vaccine strains is that carrier high-efficiency is expressed H5 hypotype AIV HA, makes up bird flu and Marek bigeminal live vaccine virus strain.
The present invention includes: the HA gene of REV LTR and H5 hypotype AIV SY strain is inserted in the MDVRispens CVI 988 vaccine strain genomes, obtains the rMDV-HA virus strain of purifying; Detect the rMDV-HA virus strain and express the situation of AIV HA.
The concrete technical scheme that is adopted is as follows:
1. the amplification of dna fragmentation and clone
Screening marker gene lac/smGFP and the genomic foreign gene of MDV Rispens CVI 988 vaccine strains that HA gene, REV LTR, the two ends of H5 hypotype AIV SY strain have a loxP site insert both sides, site sequence to adopt RT-PCR or PCR to increase respectively, and these dna fragmentations are cloned in the plasmid vector, obtain recombinant plasmid pHA, pLTR, ploxP-lac/smGFP-loxP, pUP and pDOWN.
2. the structure of transfer vector pMHA
Utilize recombinant plasmid pHA, pLTR, ploxP-lac/smGFP-loxP, pUP and pDOWN, cut with ligation through a series of enzyme and make up transfer vector pMHA.
3. the structure of recombinant virus and purifying
Adopt the method for coprecipitation of calcium phosphate, DNA that will from MDV Rispens CVI 988 vaccine strain cells infecteds, extract and transfer vector pMHA plasmid DNA cotransfection CEF, homologous recombination takes place in both, thereby REV LTR, loxP-lac/smGFP-loxP and HA gene are inserted into MDV Rispens CVI 988 vaccine strain genomes.Picking has the virus plaque that screens marker gene, and the purifying that goes down to posterity on CEF repeatedly all sends green fluorescence until all virus infected cells under ultraviolet ray.Recombinant virus called after rMDV-HA/GFP virus strain with purifying.
Extract the DNA that the rMDV-HA/GFP virus strain infects CEF, under the homologous recombination between the loxP site of cre enzyme mediation, remove the screening marker gene, and make REV LTR directly be in the upstream of HA gene.With the coprecipitation of calcium phosphate method, transfection CEF again; Select the virus plaque of not being with the screening marker gene, the culture purified that goes down to posterity is not repeatedly all sent green fluorescence until all virus infected cells under ultraviolet ray.Recombinant virus called after rMDV-HA virus strain with purifying.
The DNA that infects CEF with the rMDV-HA virus strain is a template, adopts pcr amplification to go out the HA gene and the REV LTR promotor of complete H5 hypotype AIV SY strain, illustrates that HA gene and REV LTR promotor have been inserted into MDV Rispens CVI 988 vaccine strain genomes.
3. the rMDV-HA virus strain is expressed the detection of AIV HA
The rMDV-HA virus strain is infected CEF, use monoclonal antibody and sheep anti-mouse igg/IgM fluorescence antibody to carry out indirect immunofluorescence assay (IFA), occur specificity fluorescent in the cells infected at AIV HA.
The rMDV-HA virus strain was uploaded for 5 generations in the CEF cultivation, and its replication is identical with MDV Rispens CVI988 vaccine strain, and IFA detects still positive.
After the 1 age in days SPF chicken inoculation rMDV-HA virus strain, tiring at the hemagglutination inhibition antibody of AIV in the serum during 15 ages in days is 1: 2
4～1: 2
5
Be concrete steps of the present invention below:
(1) amplification of H5 hypotype AIV SY strain HA gene
1, the extraction of AIV geneome RNA
10 age in days SPF chicken embryos are inoculated in H5 hypotype AIV SY strain, collected the allantoic fluid of dead chicken embryo in 24～72 hours.Get 250 μ L allantoic fluids, add 750 μ L Trizol LS Reagent, mixing, room temperature is placed 5min; Add 200 μ L chloroforms, mixing, 4 ℃, the centrifugal 10min of 12000g; Get honest and upright and thrifty 500 μ L, add isopyknic Virahol, mixing, room temperature is placed 10min; 4 ℃, the centrifugal 10min of 12000g; Precipitation is used 70% washing with alcohol, and 4 ℃, the centrifugal 10min of 12000g are dissolved in 30 μ L in the DEPC treated water.
2, reverse transcription-polymerase chain reaction (RT-PCR)
1 pair of design dna primer, two ends have NotI and AvrII restriction enzyme site respectively, and sequence is:
P1
GCGGCCGCTATTGGTCTCAGGGAGCAAAGC，
NotI
P2
CCTAGGATATGGTCTCGTATTAGTAGAAC。
AvrII
Reverse transcription: get AIV geneome RNA 15 μ L, add P1 primer 1 μ L (25pmol/ μ L); 72 ℃ of effects 10min, ice bath 5min then; Add 5 * AMV damping fluid, 5 μ L, dNTPs (10mmol/L) 2 μ L, RNasin 1 μ L (20U), AMV 5 μ L (10U) successively; 42 ℃ of effect 90min; 95 ℃, 5min deactivation AMV.
PCR reaction system: 10 * dna polymerase buffer liquid, 5 μ L, dNTPs (10mmol/L) 1 μ L, each 1 μ L of P1 and P2 primer (25pmol/ μ L), Expand High Fidelity Polymerase 1 μ L (3.5U/ μ L), reverse transcription product 2 μ L, H
2O 39 μ L.
PCR reaction conditions: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 20s, 56 ℃ of annealing 30s, 72 ℃ of extension 2min carry out 25 circulations altogether.
(2) amplification of REV LTR
1, the extraction of chicken lymphocyte DNA
The anticoagulation of aseptic collection 5mL commercial chicken, the centrifugal 5min of 1000g; Get the buffycoat cell, add 5mLPBS, the centrifugal 5min of 1000g; Add 500 μ L PK solution (20mM Tris, pH7.5 in the sedimentary cell; 150mM NaCl; 2mM EDTA, pH8.0; 0.5%SDS; 0.2mg/mL 37 ℃ of effect 2h proteolytic enzyme k); Add 500 μ L Tris balance phenols, add 500 μ L chloroform/primary isoamyl alcohol (24: 1), the centrifugal 5min of 3000g behind the mixing; Supernatant adds 1mL chloroform/primary isoamyl alcohol, mixing gently, the centrifugal 5min of 3000g; Get 500 μ L waters, add 50 μ L 3mol/L sodium-acetates (pH5.2) and 1mL 95% ethanol, mixing, the centrifugal 5min of 3000g; Precipitation is used 70% washing with alcohol, and is centrifugal, is dissolved in 500 μ L TE (10mM Tris, pH7.0 after the drying; 1mM EDTA, pH 8.0).
2, polymerase chain reaction (PCR)
1 pair of design dna primer; Two ends have NotI and AscI restriction enzyme site respectively, and sequence is:
P1
GCGGCCGCGGTTAACCTCTCTATAGGCGGG，
NotI
P2
GGCGCGCCGTGCACTCGCCAATATAAGAGA。
AscI
PCR reaction system: 10 * dna polymerase buffer liquid, 5 μ L, dNTPs (10mmol/L) 1 μ L, each 1 μ L of P1 and P2 primer (25pmol/ μ L), Expand High Fidelity Polymerase 1 μ L (3.5U/ μ L), chicken lymphocyte DNA 2 μ L (2 μ g), H
2O 39 μ L.
PCR reaction conditions: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 20s, 52 ℃ of annealing 30s, 72 ℃ of extension 1min carry out 25 circulations altogether.
(3) two ends have the amplification of the screening marker gene in loxP site
1 pair of design dna primer, two ends have AscI-loxP and NotI-loxP site respectively, and sequence is:
P1
GGCGCGCCataacttcgtataatgtatgctatacgaagttatAGCGCCCAATACGCAAACCGCC，
AscI loxP
P2
GCGGCCGCataacttcgtataatgtatgctatacgaagttatgGAGCTCTTATTTGTATAGTTCATC。
NotI loxP
PCR reaction system: 10 * dna polymerase buffer liquid, 5 μ L, dNTPs (10mmol/L) 1 μ L, each 1 μ L of P1 and P2 primer (25pmol/ μ L), Expand High Fidelity Polymerase 1 μ L (3.5U/ μ L), pBKlacP/lac/smGFP plasmid DNA (100ng/ μ L) 1 μ L, H
2O 40 μ L.
PCR reaction conditions: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 20s, 54 ℃ of annealing 1min, 72 ℃ of extension 2min carry out 25 circulations altogether.
(4) amplification of the genomic foreign gene insertion of MDV both sides, site sequence
1, the preparation of MDV cells infected DNA
Cultivate CEF to forming cell monolayer, inoculation MDV Rispens CVI 988 vaccine strains, treat that pathology appears in 70% cell after, harvested cell.All the other steps are with the extraction of chicken lymphocyte DNA.
2, polymerase chain reaction (PCR)
Design dna primer P1 and the P2 UP sequence that is used to increase, P2 has the NotI restriction enzyme site, and sequence is:
P1 GCCCTTTTTGGATGTGTCCCAG，
P2：
GCGGCCGCGGTTAACCTCTCTATAGCGGCCGC。
NotI
Design dna primer P3 and the P4 DOWN sequence that is used to increase, P3 has NotI and AvrII restriction enzyme site, and sequence is:
P3：
GCGGCCGCcctaggGCGGCCGCAAGTCCCTCTTATA，
NotI AvrII
P4：GCCCTTATAAAAATATACCTCTAC。
PCR reaction system: 10 * dna polymerase buffer liquid, 5 μ L, dNTPs (10mmol/I) 1 μ L, each 1 μ L of P1 (or P3) and P2 (or P4) primer (25pmol/ μ L), Expand High Fidelity Polymerase1 μ L (3.5U/ μ L), MDV cells infected DNA 2 μ L (2 μ g), H
2O 39 μ L.
PCR reaction conditions: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 20s, 54 ℃ of annealing 1min, 72 ℃ of extension 1min carry out 25 circulations altogether.
(5) clone of dna fragmentation
RT-PCR is connected with pCR2.1-TOPO TA Cloning plasmid vector (Invitrogen company) with the PCR product, transformed competence colibacillus intestinal bacteria TOP10, coating contains the LB culture plate of kantlex; Select positive bacterium colony, extract plasmid DNA; Enzyme is cut the segmental direction of insertion of identification of dna, measures its nucleotide sequence.
HA gene, REV LTR, the two ends that will contain H5 hypotype AIV SY strain have screening marker gene lac/smGFP, the UP in loxP site and plasmid difference called after pHA, pLTR, ploxP-lac/smGFP-loxP, pUP and the pDOWN of DOWN sequence.
(6) structure of metastasis transplanting physique grain pMHA and preparation
Plasmid pUP and pDOWN are cut with the NotI enzyme, extract respective segments, be built into plasmid pUP/DOWN.In the pUP/DOWN plasmid, form UP-NotI-AvrII-DOWN and insert segment.
Plasmid ploxP-lac/smGFP-loxP with AscI and XbaI cutting, is extracted and inserts fragment, be cloned into Ascl and the Xbal site of plasmid pLTR again, be built into plasmid pLTR-GFP.The arrangement mode of external source fragment in pLTR-GFP is: NotI-LTR-AscI-loxP-lac/smGFP-loxP-NotI, promptly two ends have the LTR/GFP fragment in NotI site.
PUP/DOWN plasmid with NotI and AvrII cutting is a carrier, inserts NotI-HA-AvrII and the NotI-LTR-AscI-loxP-lac/smGFP-loxP-NotI segment extracted from pHA and pLTR-GFP plasmid, is built into transfer vector pMHA.It is UP-NotI-LTR-AscI-loxP-lac/smGFP-loxP-NotI-HA-AvrII-DOWN that pMHA contains the insertion fragment.
Extract transfer vector pMHA plasmid DNA with QIAprep spin Midi-prep kit (QIAGEN company), be dissolved in TE damping fluid (10mM Tris, pH7.0 with endotoxin-free water preparation; 1mM EDTA pH8.0), is diluted to the solution of 100ng/ μ L.
(7) structure of recombinant virus and purifying
1, the preparation of CEF
Get 9～10 age in days SPF chicken embryos, prepare former generation CEF; Be diluted to every milliliter of 1,000,000 cells with the M199 substratum that contains 4% calf serum, put 37 ℃, 5%CO in the T150 Tissue Culture Flask
2Cultivated 24 hours; During cell monolayer to be formed, preparation is time for CEF.
2, the preparation of MDV cells infected DNA
Each T150 Tissue Culture Flask time for CEF in, inoculation 2.5 * 10
5MDV Rispens CVI 988 vaccine strains of plaque forming unit (PFU) were cultivated 4～6 days; Extract DNA (method is with the extraction of chicken lymphocyte DNA), become the solution of 100～500 μ g/ μ L with TE damping fluid dilution DNA.
3, the transfection of CEF
In preceding 30 minutes of on-test of transfection, preparation is time for CEF; Be diluted to every milliliter 800,000 cell with the M199 substratum that contains 4% calf serum, put (each culture dish adds 5mL enchylema) in the 60mm culture dish 37 ℃, 5%CO
2Cultivate under the condition.
In 15 milliliter cuvettes, add 388 μ L water, 10 μ g MDV cells infected DNA and a certain amount of pMHA plasmid DNA (3 test group of 50ng, 100ng and 500ng are set), add the TE damping fluid to cumulative volume 50 μ L, mixing; At the bottom of test tube, slowly add 62 μ L 2mol/L CaCl
2(500mL 2 * HBSP solution contains 5g Hepes, 8g NaCl, 0.37g KCl, 0.125g Na with 500 μ L, 2 * HBSP solution
2HPO4,1g glucose are regulated pH value to 7.05, filtration sterilization), go out several bubbles from the test tube bottom blowing gently with suction pipe; Place 30min, be split into calcium phosphate-DNA mixture.
Add 500 μ L calcium phosphate-DNA mixtures at each 60mm culture dish in time for CEF, continue to cultivate 4 hours, abandon nutrient solution; With the M199 nutrient solution washed cell individual layer that does not contain calf serum, abandon nutrient solution; Glycerol shock liquid (the compound method: 18mL H that in each culture dish, slowly adds the new preparation of 2mL
2O+7mL glycerine+25mL 2 * HBSP) acts on 2 minutes, inhales and removes liquid; With the M199 nutrient solution washed cell individual layer that does not contain calf serum, add the M199 nutrient solution that contains 4% calf serum, continue to cultivate 5-7 days.
4, the screening of recombinant mdv and purifying
The CEF of transfection is put observation under the fluorescent microscope, seek the virus plaque that has fluorescence.With the suction pipe picking virus plaque that has a little pancreatin, put and contain in the 4% calf serum M199 nutrient solution, be inoculated in time for the CEF individual layer 37 ℃, 5%CO
2Cultivate under the condition.Repeat above-mentioned steps, all have fluorescence up to all cells of forming virus plaque, naming this virus is rMDV-HA/GFP.
Homologous recombination between the loxP site of employing cre enzyme mediation is removed the screening marker gene lac/smGFP that rMDV-HA/GFP has.Method is as follows: extract the DNA that rMDV-HA/GFP infects CEF; Get 20 μ gDNA, add 5 cre of unit enzyme and damping fluids, 37 ℃ act on 1 hour; Transfection is inferior to CEF, 37 ℃, 5%CO
2Cultivated 5-7 days under the condition; Screening is not with the virus plaque of fluorescence under fluorescent microscope; Purified virus does not have fluorescence up to all cells of forming virus plaque repeatedly, and naming this virus is rMDV-HA.
5, rMDV-HA expresses the detection of AIV HA
1. indirect immunofluorescence assay (IFA)
Inferior with the rMDV-HA infection for CEF, 3-4 days formation virus plaques; With cold methanol fixed cell 5～10 minutes, PBS washing 1 time; The anti-AIV HA monoclonal antibody that adds work concentration, 37 ℃ act on 1 hour, PBS washing 2-3 time; The monoclonal antibody mouse IgG/IgM fluorescence antibody that adds work concentration, 37 ℃ act on 1 hour, with PBS washing 2-3 time; Put under the fluoroscope and observe, the result forms all cells of virus plaque and all is with fluorescence.
2. blood clotting suppresses (HI) antibody test
10 1 age in days SPF chickens are divided into 2 groups, every group of 5 chickens; The rMDV-HA of the 1st group of every chicken abdominal cavity inoculation 2500PFU, the rMDV-HA/GFP of the 2nd group of every chicken abdominal cavity inoculation 2500PFU; During 15 ages in days, with the antibody in the hemagglutination-inhibition test detection serum.The 1st group of test chicken all can detect HI antibody and (tire at 1: 2
4-1: 2
5Between), the 2nd group of test chicken only has 1 to detect HI antibody only (tire is 1: 2
1).
3. the Detection of Stability of rMDV-HA virus strain
The rMDV-HA virus strain was uploaded for 5 generations in the CEF cultivation, and its replication is identical with MDV RispensCVI988 vaccine strain, detects still stably express AIV HA with IFA.
Biological material specimens preservation of the present invention:
Depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center
Address: Datun Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica
(100101)
Preservation date: on October 19th, 2007
Deposit number: CGMCC No.2219
Classification name: Marek ' s disease virus
Sequence table electronic file .txt
＜110〉Wu Yantao, Li Xiaoqiong, Zhang Xiaorong, Xu Xiaojing
＜120〉the recombinant marek's disease toxic vaccine strain of expression avian influenza virus blood clotting rope
<140>200710133953.5
<141>2007-10-25
<160>5
<170>PatenIn Version 3.3
<210>1
<211>1805
<212>DNA
＜213〉avian influenza virus (Avian influenza virus, AIV)
<220>
<221>CDS
<222>(1)…(1805)
＜400〉nucleotide sequence of the HA gene of H5 hypotype AIV SY strain
tattggtctc agggagcaaa agcaggggtt taatctgtca aaatggagaa aatagtgctt 60
tttcttgcaa tagtcagcct tgttaaaagt gatcagattt gcattggtta ccatgcaaac 120
aactcgacag agcaggttga cacaataatg gaaaagaatg ttactgttac acatgcccaa 180
gacatactgg aaaagacaca caacgggaag ctctgcgatc tagatggagt gaagcctctg 240
attttaagag attgtagtgt agctggatgg ctcctcggaa acccaatgtg tgacgaattc 300
atcaatgtgc cggaatggtc ttacatagtg gagaaggcca acccagccaa tgacctctgt 360
tacccaggga atttcaacga ctatgaagaa ctgaaacacc tattgagcag aataaaccat 420
tttgagaaaa ttcagatcat ccccaaaagt tcttggtccg atcatgaagc ctcatcaggg 480
gtgagctcag catgtcctta ccagggaacg ccctcctttt tcagaaatgt ggtatggctt 540
atcaaaaaga acaatacata cccaacaata aagagaagct acaataatac caaccaggaa 600
gatcttttga tactgtgggg gattcatcat tctaatgatg cggcagagca gacaaagctc 660
tatcaaaacc caaccaccta tatttccgtt gggacatcaa cactaaacca gagattagta 720
ccaaaaatag ctactagatc caaagtaaac gggcaaagtg gaaggatgga tttcttctgg 780
acaattttaa aaccgaatga tgcaatcaac ttcgagagta atggaaattt cattgctcca 840
gaatatgcat acaaaattgt caagaaaggg gactcagcaa ttatgaaaag tgaagtggaa 900
tatggtaact gcaacaccaa gtgtcaaact ccaatagggg cgataaactc tagtatgcca 960
ttccacaaca tacaccctct caccatcggg gaatgcccaa aatatgtgaa atcaaacaaa 1020
ttagtccttg cgactgggct cagaaatagt cctctaagag aaagaagaag aaaaagagga 1080
ctatttggag ctatagcagg ttttatagag ggaggatggc agggaatggt agatggttgg 1140
tatgggtacc accatagcaa tgagcagggg agtgggtacg ctgcagacaa agaatccact 1200
caaaaggcaa tagatggagt taccaataag gtcaactcga tcattgacaa aatgaacact 1260
cagtttgagg ccgttggaag ggaatttaat aacttagaaa ggagaataga gaatttaaac 1320
aagaaaatgg aagacggatt cctagatgtc tggacttata atgctgaact tctggttctc 1380
atggaaaatg agagaactct agacttccat gactcaaatg tcaagaacct ctacgacaag 1440
gtccgactac agcttaggga taatgcaaag gaactgggta acggttgttt cgagttctat 1500
cacaaatgtg ataatgaatg tatggaaagt gtaagaaacg gaacgtatga ctacccgcag 1560
tattcagaag aagcaagatt aaaaagagag gaaataagtg gagtaaaatt ggaatcaata 1620
ggaacttacc aaatactgtc aatttattca acagtggcga gttctctagc actggcaatc 1680
atggtggctg gtctatcttt atggatgtgc tccaatgggt cgttacaatg cagaatttgc 1740
atttaaattt gtgagttcag attgtagtta aaaacaccct tgtttctact aatacgagac 1800
catat 1805
<210>2
<211>578
<212>DNA
＜213〉reticuloendotheliosis's syndrome virus (Reticuendotheliosis virus, REV)
<220>
<221>LTR
<222>(1)…(578)
＜400〉nucleotide sequence of REV LTR
gcggccgcgg ttaacctctc tataggcggg ggtgtgggag ggagctccgg gggaatgtgg 60
gagggagctc cggggggaat agcgctggct cgctaactgc catattagct tctgtaatca 120
tgcttgcttg ccttagccgc cattgtactt gatatatttc gctgatatca tttctcggaa 180
tcggcatcaa gagcaggctc ataaaccata aaaggaaatg tttgttgaag gcaagcatca 240
gaccacttgc accatccaat cacgaacaaa cacgagatcg aactatcata ctgagccaat 300
ggttgtaaag ggcagatgct atcctccaat gagggaaaat gtcatgcaac atcctgtaag 360
cggctatata agccaggtgc atctcttgct cggggtcgcc gtcctacaca ttgttgtgac 420
gtgcggccca gattcgaatc tgtaataaaa gctttttctt ctatatcctc agattggcag 480
tgagaggaga ttttgttcgt ggtgttggct ggcctactgg gtggggtagg gatccggact 540
gaatccgtag tatttcggta caacaggcgc gcc 573
<210>3
<211>1032
<212>DNA
＜213〉artificial sequence
<220>
<222>(1)…(1032)
＜400〉two ends have the nucleotide sequence of the screening marker gene lac/smGFP in loxP site
ggcgcgccat aacttcgtat aatgtatgct atacgaagtt atagcgccca atacgcaaac 60
cgcctctccc cgcgcgttgg ccgattcatt aatgcagctg gcacgacagg tttcccgact 120
ggaaagcggg cagtgagcgc aacgcaatta atgtgagtta gctcactcat taggcacccc 180
Sequence table electronic file .txt
aggctttaca ctttatgctt ccggctcgta tgttgtgtgg aattgtgagc ggataacaat 240
ttcacaggat ccaaggagat ataacaatga gtaaaggaga agaacttttc actggagttg 300
tcccaattct tgttgaatta gatggtgatg ttaatgggca caaattttct gtcagtggag 360
agggtgaagg tgatgcaaca tacggaaaac ttacccttaa atttatttgc actactggaa 420
aactacctgt tccatggcca acacttgtca ctactttctc ttatggtgtt caatgctttt 480
caagataccc agatcatatg aagcggcacg acttcttcaa gagcgccatg cctgagggat 540
acgtgcagga gaggaccatc tctttcaagg acgacgggaa ctacaagaca cgtgctgaag 600
tcaagtttga gggagacacc ctcgtcaaca ggatcgagct taagggaatc gatttcaagg 660
aggacggaaa catcctcggc cacaagttgg aatacaacta caactcccac aacgtataca 720
tcacggcaga caaacaaaag aatggaatca aagctaactt caaaattaga cacaacattg 780
aagatggaag cgttcaacta gcagaccatt atcaacaaaa tactccaatt ggcgatggcc 840
ctgtcctttt accagacaac cattacctgt ccacacaatc tgccctttcg aaagatccca 900
acgaaaagag agaccacatg gtccttcttg agtttgtaac agctgctggg attacacatg 960
gcatggatga actatacaaa taagagctcc ataacttcgt atagcataca ttatacgaag 1020
ttatgcggcc gc 1032
<210>4
<211>737
<212>DNA
＜213〉Mareks disease virus (Marek ' s disease virus type 1, MDV)
<220>
<221>misc_feature
<222>(1)…(737)
＜400〉nucleotide sequence of UP
gccctttttg gatgtgtccc agggcaatgg gaacagcaat cactttcgaa ttccttcagc 60
ccaaagcaca accgcgggtc caccgggact ctccgacata gctcgagcca aaagggaatt 120
gtagcccagg caagtgcaat gttttaattt gttcttctcc ctcccccaca taaaaaaacc 180
actggatcgt acaagtatac gagtatatgg gtggggtgcc gttttatata aacacagctt 240
agtttgtttg ccacgtcaag gaagggcggt gcatatctgc aagtaaacaa aactcggggt 300
tctgtacgat tggccggggt cttacatgct cgccgaattg gatttgagaa tcaatcttcc 360
gatttgccac gtcaaggaag ggcggtgcat atctgcaagt aaacaaaact cggggttctg 420
tacgattggc cggggtctta catgctcgcc gaattggatt tgagaatcaa tcttccgacg 480
ggtttcctga cttgaacagg ggaaagggga gggggggaag tgtgttatct tgtcgcgaac 540
caataaaata gatttgtggc ctaacgagtt ctcttttttt ttatatcgca agtgttaacg 600
aagctatggg actagtcttt tcgtacaagt ctcagacaaa ccgcgaccaa aaaagcgcgg 660
ccctgtcgaa gaggaaatac tgaatcgacg agctaaccac agcgtgtctc ctgggttaac 720
ctctctatag cggccgc 737
<210>5
<211>353
<212>DNA
＜213〉Mareks disease virus (Marek ' s disease virus, MDV)
<220>
<221>misc_feature
<222>(1)…(353)
＜400〉nucleotide sequence of DOWN
gcggccgcaa gtccctctta tattggcgag tggcctagga ttgaatatta gacctcagtt 60
ccctacggcg ctttgaggta gagggaagtt ctcagagctt gcatatgcaa acgagatgtt 120
gtaggggaaa aaaaagagga accgtgcctt tctctacgca gatgggtccc ccccccccaa 180
aaaaaaagga accgtgcctt cctccgcgca aataggtgcc ccacgaggcc tcggggtccg 240
cggggcggag aggggaaaaa gagtacggtt caggggatat gagaacagct gcgtattttc 300
cccgtgcatc tcataccgcc catttttggg tagaggtata tttttataag ggc 353
Claims (2)
1. bird flu and Marek bigeminal live vaccine rMDV-HA virus strain, CGMCC No.2219.
2. the construction process of bird flu as claimed in claim 1 and Marek bigeminal live vaccine rMDV-HA virus strain, technological step is: adopt increase the respectively hemagglutinin gene of H5 subtype avian influenza virus SY strain of reverse transcription-polymerase chain reaction or polymerase chain reaction, RE hyperplasia syndrome virus LTR, screening marker gene lac/smGFP and the genomic foreign gene of Mareks disease virus Rispens CVI 988 vaccine strains that two ends have the loxP site insert both sides, site sequence, and these dna fragmentations are cloned in the plasmid vector, obtain recombinant plasmid pHA, pLTR, ploxP-lac/smGFP-loxP, pUP and pDOWN; Utilize these recombinant plasmids, cut with ligation through a series of enzyme and make up transfer vector pMHA; With transfer vector pMHA plasmid DNA and the DNA cotransfection chick embryo fibroblast of extracting from Mareks disease virus Rispens CVI 988 vaccine strain cells infecteds, by homologous recombination foreign gene is inserted into Mareks disease virus Rispens CVI 988 vaccine strain genomes, obtains recombinant virus rMDV-HA/GFP with the screening marker gene; Screening marker gene lac/smGFP by sequence reorganization removal rMDV-HA/GFP between the loxP site of cre enzyme mediation obtains the rMDV-HA virus strain behind the purifying.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007101339535A CN101575616B (en) | 2007-10-25 | 2007-10-25 | Avian influenza and MD bivalent vaccine rMDV-HA virus strain and construction method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007101339535A CN101575616B (en) | 2007-10-25 | 2007-10-25 | Avian influenza and MD bivalent vaccine rMDV-HA virus strain and construction method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101575616A CN101575616A (en) | 2009-11-11 |
| CN101575616B true CN101575616B (en) | 2011-08-31 |
Family
ID=41270689
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007101339535A Expired - Fee Related CN101575616B (en) | 2007-10-25 | 2007-10-25 | Avian influenza and MD bivalent vaccine rMDV-HA virus strain and construction method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101575616B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102373180B (en) * | 2011-09-26 | 2013-06-19 | 中国农业科学院哈尔滨兽医研究所 | Recombinant duck enteritis virus (DEV) vaccine strain for expressing avian influenza virus haemagglutinin (HA) gene and constructing method and application thereof |
| CN103055310B (en) * | 2013-02-04 | 2014-01-08 | 齐鲁动物保健品有限公司 | Bigeminal inactivated vaccine for avian influenza (H9 sub type) and Escherichia coli and preparation method thereof |
| EP2845904A1 (en) * | 2013-09-06 | 2015-03-11 | Ceva Sante Animale | Recombinant Marek's disease viruses and uses thereof |
| CN105002146A (en) * | 2015-08-11 | 2015-10-28 | 扬州大学 | RHVT (recombinant Herpesvirus of Turkey)-H9HA (H9 hemagglutinin) and construction method thereof |
| CN109666656A (en) * | 2019-01-23 | 2019-04-23 | 北京市农林科学院 | A method of CVI988 plants of marek's disease virus of purifying recombination chicken infectious bursal disease virus VP 2 gene |
-
2007
- 2007-10-25 CN CN2007101339535A patent/CN101575616B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN101575616A (en) | 2009-11-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101575616B (en) | Avian influenza and MD bivalent vaccine rMDV-HA virus strain and construction method | |
| KR102132730B1 (en) | Foot-and-mouth disease virus-like particle vaccine and its manufacturing method | |
| JP2010532157A (en) | Recombinant turkey herpesvirus containing avian influenza gene | |
| CN102807970B (en) | Canine distemper virus (CDV) sensitive cell line and establishment method and application thereof | |
| CN100425291C (en) | O-type foot-and-mouth disease virus poly-gene duplication defect type adenovirus active carrier vaccine and process for preparing the same | |
| CN103509761B (en) | Recombinant porcine pseudorabies virus strain used for expression of porcine circovirus type II (PCV2) ORF2 gene, and preparation method thereof | |
| US20140286979A1 (en) | Canine influenza recombinant virus, preparation method therefor and application thereof | |
| CN113061587A (en) | Antigen spectrum expanded O-type foot-and-mouth disease virus strain and construction method and application thereof | |
| CN104928261A (en) | Pseudo-rabies virus LA-A strain and establishing method and application thereof | |
| CN107267532A (en) | The construction method of JS2008 plants of full-length infectious CDNAs of PEDV and application | |
| CN102776156A (en) | Gene VIb subtype Rubulavirus Newcastle disease virus attenuated strain VIbI4 and construction method thereof | |
| CN113025653A (en) | Whole-avian-source genetic system and application thereof in preparation of H7N9 avian influenza vaccine | |
| CN105039411A (en) | Attached type lentiviral vector as well as preparation method and application thereof | |
| CN102206645A (en) | Mediating method of RNAi (ribonucleic acid interference) utilizing lentiviral vector | |
| CN106399267A (en) | Recombinant turkey herpesvirus virus strain rHOH expressing H7N9 subtype avian influenza virus haemagglutinin protein and construction method | |
| CN109136200A (en) | A kind of recombination infectious hematopoietic necrosis poison and its construction method and application | |
| US10894081B2 (en) | Recombinant bivalent inactivated vaccine against foot-and-mouth disease virus, preparation method and use thereof | |
| ES2795040T3 (en) | Methods to produce viruses | |
| CN104357460B (en) | Restructuring duck enteritis virus, preparation method and application | |
| KR101757331B1 (en) | Korean porcine epidemic diarrhea virus isolate and use thereof | |
| CN1242065C (en) | Pig breeding and respiratory syndrome recombined adenovirus and vaccine | |
| CN109679952B (en) | Porcine-derived miR-c89 for resisting PRRSV infection and application thereof | |
| CN112342244B (en) | Cell strain for expressing Furin protein and application of cell strain in avian infectious bronchitis virus culture | |
| CN110144331B (en) | HuNoV GII.4 clinical isolate sequence and construction and application of infectious clone thereof | |
| CN104195119B (en) | Virus-like particle and vaccine of a kind of infectivity resistant spleen and kidney necrosis virus and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110831 Termination date: 20161025 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |