CN101402998B - Ring mediated isothermality amplification fast detecting method for producing toxin B clostridium difficile - Google Patents

Ring mediated isothermality amplification fast detecting method for producing toxin B clostridium difficile Download PDF

Info

Publication number
CN101402998B
CN101402998B CN2008101579020A CN200810157902A CN101402998B CN 101402998 B CN101402998 B CN 101402998B CN 2008101579020 A CN2008101579020 A CN 2008101579020A CN 200810157902 A CN200810157902 A CN 200810157902A CN 101402998 B CN101402998 B CN 101402998B
Authority
CN
China
Prior art keywords
clostridium difficile
primer
mol
downstream
outer primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN2008101579020A
Other languages
Chinese (zh)
Other versions
CN101402998A (en
Inventor
雷质文
贺楠
马维兴
祝素珍
张健
姜英辉
李正义
房保海
唐静
贾俊涛
刘云国
赵丽青
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Inspection and Quarantine Technology Center of Shandong Entry Exit Inspection and Quarantine Bureau
Original Assignee
Inspection and Quarantine Technology Center of Shandong Entry Exit Inspection and Quarantine Bureau
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Inspection and Quarantine Technology Center of Shandong Entry Exit Inspection and Quarantine Bureau filed Critical Inspection and Quarantine Technology Center of Shandong Entry Exit Inspection and Quarantine Bureau
Priority to CN2008101579020A priority Critical patent/CN101402998B/en
Publication of CN101402998A publication Critical patent/CN101402998A/en
Application granted granted Critical
Publication of CN101402998B publication Critical patent/CN101402998B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a rapid detection method of the loop-mediated isothermal amplification of the clostridium difficile of a toxin producer B. Reagents thereof comprise a reaction solution of the loop-mediated isothermal amplification, Bst DNA polymerase and a color development reagent; wherein, the reaction solution comprises reaction buffer solution, dNTP, bitter salt, an upstream inner primer 5-AGGAGAAGCAATTGATTTTACTGGA-TACAGCTCCTCTATAATTATCTTCA-3, a downstream inner primer 5-AAGTGTATTAGCTGGGGCAAAATAT-TATTTCAACCAAAGTGGAGTGT-3, an upstream outer primer 5-TTCACCATCTAATTCTTTCCATTC-3 and a downstream outer primer 5-CAATTGGAGAGACAATAATTGATG-3 and lycine. The detection method of the clostridium difficile of the toxin producer B includes the extraction of bacterial DNA, the loop-mediated isothermal amplification of the clostridium difficile of the toxin producer B and color development detection. The method has the advantages of fast speed, strong specificity, high sensitivity and low cost.

Description

Toxin producing B clostridium difficile loop-mediated isothermal amplification fast detection method
Technical field
The present invention relates to a kind of method of utilizing ring mediated isothermal amplification (LAMP) technology to carry out the rapid detection of bacterium sample, specifically is a kind of toxin producing B clostridium difficile loop-mediated isothermal amplification fast detection method.
Background technology
Clostridium difficile (Clostridium difficile) is the member of fusobacterium, has become one of cause of disease of most important hospital infection since nineteen nineties.Clostridium difficile belongs to Anaerobic Bacteria, just be meant the bacterium that those are better than growth in aerobic environment under oxygen free condition, and people's enteron aisle just in time is the environment of a relative anaerobic.Clostridium difficile is distributed widely in the natural habitat, ight soil as soil, hay, sand, some macrofaunas (ox, donkey and horse), and dog, cat, rodent and people's ight soil, often contain clostridium difficile in baby's the ight soil, in about 50%12 monthly age babies' the enteron aisle clostridium difficile is arranged, children's bacterial bearing rate is approximately 3% more than 2 years old, but this bacterium frequency of occurrences in health adult is lower, asymptomatic germ-carrying adult is 1.9% in Sweden, is 15.4% in Japan.The bacterium of clostridium difficile sporeformer colonizes among the human intestine at ordinary times, if the excessive use microbiotic causes the flora rate of growth too fast, will cause serious inflammation.A report is given an example with the Quebec, CAN area, and 1703 patients' case history shows that all this germ has high mortality in the 12 tame hospitals.Recent studies show that clostridium difficile is second common pathogen in the intestinal tract infections, is only second to Campylobacter, easily causes with heating, stomachache, water sample and rushes down and pseudomembranous enteritis.Why clostridium difficile can cause a disease, and is because it has 3 kinds of virulence factors: toxin A, toxin B and a kind of material that can suppress intestines peristalsis.Toxin A has intestines toxicity, and toxin B has cytotoxicity.Toxin A also has certain cytotoxic effect, but littler than toxin B.Toxin A and B are the main virulence factors of clostridium difficile, can disturb the actin cytoskeleton of intestinal epithelial cell, make the cell loss of function.
The detection method that has clostridium difficile and toxin thereof now mainly contains the toxin neutralization test of toxin detection, culturing cell, PCR etc., and the toxin neutralization test of culturing cell may have false negative, makes patient dead because of malpractice.Have not yet to see the report that detects clostridium difficile with loop-mediated isothermal amplification method.
Summary of the invention
The purpose of this invention is to provide a kind of toxin producing B clostridium difficile loop-mediated isothermal amplification fast detection method, overcoming the shortcoming of prior art, thereby provide the foundation and the directive function of science for food safety.
Cardinal principle of the present invention is: (1) particular design can be discerned six not homotactic two inner primers of target DNA (upstream inner primer and downstream inner primer) and two outer primers (upstream outer primer and downstream outer primer) for one group, and inner primer comprises the positive-sense strand and the antisense strand of target DNA; (2) one of them inner primer is at first hybridized with target DNA, strand displacement DNA subsequently synthesizes in the presence with the active archaeal dna polymerase of height strand displacement by an outer primer startup, discharge single stranded DNA, and, produce a primary stem circular DNA as an inner primer and the synthetic template of DNA that outer primer starts by the other end that hybridizes to target; (3) inner primer is done template with original stem circular DNA, starts the synthetic of strand displacement DNA, produces a primary stem circular DNA and the new stem circular DNA by twice stem length; (4) under isothermal condition, inner primer is a template with the stem circular DNA, forms a plurality of stem circular DNAs that contain the target DNA tumor-necrosis factor glycoproteins by strand displacement, and this circulating reaction can make target DNA be accumulated to 10 in one hour 9Copy can be observed amplification by fluorescence dye.
In the toxin producing B clostridium difficile loop-mediated isothermal amplification fast detection method that the present invention relates to, the reagent that comprises following (1)-(4):
(1) ring mediated isothermal amplification (LAMP) reaction solution:
Draw interior thing (FIP), 0.8-1.6 μ mol/L downstream inner primers (BIP), 0.2-0.3 μ mol/L upstream outer primer (F3), 0.2-0.3 μ mol/L downstream outer primer (B3) and 1-1.5mol/L trimethyl-glycine comprising 10 * Thermopol reaction buffer, 1.0-1.4mmol/L dNTP, 4-8mmol/L sal epsom (MgSO4), 0.8-1.6 μ mol/L upstreams;
The upstream inner primer:
5-AGGAGAAGCAATTGATTTTACTGGA-TACAGCTCCTCTATAATTATCTTCA-3、
The downstream inner primer:
5-AAGTGTATTAGCTGGGGCAAAATAT-TATTTCAACCAAAGTGGAGTGT-3、
Upstream outer primer: 5-TTCACCATCTAATTCTTTCCATTC-3,
Downstream outer primer: 5-CAATTGGAGAGACAATAATTGATG-3,
Wherein the mass ratio of four kinds of thymus nucleic acids in the mixture dNTP is dUTP:dATP:dGTP:dCTP=2:1:1:1.
Trihydroxy methyl aminomethane-the hydrochloric acid (Tris-HCl), 100mmol/L Repone K (KCl), 100mmol/L the ammonium sulfate ((NH that contain 200mmol pH8.8 in wherein said 10 * Thermopol reaction buffer 4) 2SO 4), 20mmol/L sal epsom (MgSO 4) and 1% Triton X-100 (Triton X-100);
(2) UNG enzyme: 1U/ μ L;
(3) Bst archaeal dna polymerase: 8U/ μ L;
(4) developer: be 10% fluorescence dye SYBR GREEN I or DNAGreen.
Above the every pipe of described ring mediated isothermal amplification (LAMP) reaction solution have 22 μ L, its best group becomes: 2.5 μ L10 * Thermopol reaction buffer, 1.4 μ L25mmol/L dNTP (mixtures of four kinds of thymus nucleic acids), 4.0 μ L10 μ mol/L upstream inner primers (FIP), 4.0 μ L10 μ mol/L downstream inner primers (BIP), 0.5 μ L10 μ mol/L upstream outer primer (F3), 0.5 μ L10 μ mol/L downstream outer primer (B3), 2 μ L100mmol/LMgSO 4, 5 μ L5M trimethyl-glycines and 2.1 μ L ddH 2O (sterilization distilled water).
Use aforesaid method to detect toxin producing B clostridium difficile, comprise the following steps successively (1)-(3):
(1) extraction of sample to be checked or DNA of bacteria:
Extract sample nucleic acid to be checked, wherein the sample DNA OD of Ti Quing 260/ OD 280In the 1.6-2.0 scope, concentration is in 10-100ng/ μ L scope.
(2) carry out the loop-mediated isothermal amplification of toxin producing B clostridium difficile:
A. the UNG enzyme that adds 2 μ L template DNA to be checked and 0.5 μ L in the reaction tubes that 22 μ L LAMP reaction solutions are housed is placed 3min for 50 ℃ in water bath with thermostatic control, place 3-5min, place 1-3min on ice immediately for 95 ℃;
B. in reaction tubes, add 1 μ LBst archaeal dna polymerase, and in water-bath 60-65 ℃ of amplified reaction 45-90min in the water bath with thermostatic control;
C. water-bath is transferred to 80-85 ℃ of termination reactions, is taken out to be checked behind 3-5min;
(3) color developing detection
In each reaction tubes to be checked, add 1 μ L developer, the colour-change that directly detects by an unaided eye, the reaction solution color becomes green, illustrates that sample to be checked contains or is toxin producing B clostridium difficile.
The present invention be according to six sequences Design of the tcdB gene of toxin producing B clostridium difficile two specificity inner primers and two specificity outer primers, this conservative gene sequence is that toxin producing B clostridium difficile is common, detects the reliability of the toxin producing B clostridium difficile of different sources with assurance.The present invention adopts ring mediated isothermal amplification (LAMP) technology, this technology high specificity, with the PCR detection method identical highly sensitive is arranged, but do not need expensive PCR instrument, only need common water-bath get final product, and the result needn't observe with gel electrophoresis method, the use fluorescence dye is observed and is got final product, simple and quick, be specially adapted to basic medical unit.
Embodiment
The following example further specifies the present invention, but the restriction of the present invention of should not opposing.
Embodiment 1
Make the loop-mediated isothermal amplification liquid of toxin producing B clostridium difficile by following prescription:
(1) LAMP reaction solution:
Contain 2.5 μ L10 * Thermopol reaction buffer, 1.4 μ L25mmol/L dNTP (mixtures of four kinds of thymus nucleic acids), 4.0 μ L10 μ mol/L upstream inner primers (FIP), 4.0 μ L10 μ mol/L downstream inner primers (BIP), 0.5 μ L10 μ mol/L upstream outer primer (F3), 0.5 μ L10 μ mol/L downstream outer primer (B3), 2 μ L100mmol/L MgSO 4, 5 μ L5M trimethyl-glycines and 2.1 μ LddH 2O (sterilization distilled water).
Wherein said upstream inner primer:
5-AGGAGAAGCAATTGATTTTACTGGA-TACAGCTCCTCTATAATTATCTTCA-3、
The downstream inner primer:
5-AAGTGTATTAGCTGGGGCAAAATAT-TATTTCAACCAAAGTGGAGTGT-3、
Upstream outer primer: 5-TTCACCATCTAATTCTTTCCATTC-3,
Downstream outer primer: 5-CAATTGGAGAGACAATAATTGATG-3;
Wherein the mass ratio of four kinds of thymus nucleic acids in the mixture dNTP is dUTP:dATP:dGTP:dCTP=2:1:1:1.
(2) UNG enzyme: 1U/ μ L;
(3) Bst archaeal dna polymerase: 8U/ μ L;
(4) developer: be 10% fluorescence dye SYBR GREEN I.
Detect according to following (1)-(3) program:
(1) extraction of sample DNA
Detect bacterial classification clostridium difficile (Clostridium difficile), bacterial classification source American type culture collection, numbering ATCC43593.
Use the bacterial nucleic acid of sky, Beijing root bio-engineering corporation to extract test kit extraction sample DNA, DNA OD 260/ OD 280Can reach 1.8, concentration reaches 20ng/ μ L.
(2) carry out the loop-mediated isothermal amplification of toxin producing B clostridium difficile:
A. the UNG enzyme that adds 2 μ L template DNA to be checked and 0.5 μ L in the reaction tubes that 22 μ L LAMP reaction solutions are housed is placed 3min for 50 ℃ in water bath with thermostatic control, place 5min, place 1min on ice immediately for 95 ℃;
B. in each reaction tubes, add 1 μ LBst archaeal dna polymerase, and in water bath with thermostatic control 65 ℃ of amplified reactions 1 hour;
C. water-bath is transferred to 80 ℃ of termination reactions, is taken out to be checked behind the 3min;
(3) color developing detection
In each reaction tubes to be checked, add 1 μ L developer, the colour-change that directly detects by an unaided eye, the reaction solution color becomes green, illustrates that sample to be checked is a toxin producing B clostridium difficile.
Embodiment 2
Make the loop-mediated isothermal amplification liquid of toxin producing B clostridium difficile by following prescription:
(1) LAMP reaction solution:
Contain 2.5 μ L10 * Thermopol reaction buffer, 1.4 μ L25mmol/L dNTP, 4.0 μ L10 μ mol/L upstream inner primers (FIP), 4.0 μ L10 μ mol/L downstream inner primers (BIP), 0.5 μ L10 μ mol/L upstream outer primer (F3), 0.5 μ L10 μ mol/L downstream outer primer (B3), 2 μ L100mmol/L MgSO 4, 5 μ L5mol/L trimethyl-glycines and 2.1 μ LddH 2O (sterilization distilled water).
Wherein said upstream inner primer, downstream inner primer, upstream outer primer, downstream outer primer are the same.
The mass ratio of four kinds of thymus nucleic acids in the said mixture dNTP is dUTP:dATP:dGTP:dCTP=2:1:1:1.
(2) UNG enzyme: 1U/ μ L;
(3) Bst archaeal dna polymerase: 8U/ μ L;
(4) developer: be 10% fluorescence dye DNAGreen.
Detect according to following (1)-(3) program:
(1) extraction of sample DNA
Detect bacterial classification clostridium difficile (Clostridium difficile), bacterial classification source American type culture collection, numbering ATCC9689.
Use the plant nucleic acid of Dalian Bao Bio-Engineering Company to extract test kit extraction sample DNA, DNA OD260/OD280 can reach 1.8, and concentration reaches 20ng/ μ L.
(2) carry out the loop-mediated isothermal amplification of toxin producing B clostridium difficile:
A. the UNG enzyme that adds 2 μ L template DNA to be checked and 0.5 μ L in the reaction tubes that 22 μ L LAMP reaction solutions are housed is placed 3min for 50 ℃ in water bath with thermostatic control, place 5min, place 1min on ice immediately for 95 ℃;
B. in each reaction tubes, add 1 μ L Bst archaeal dna polymerase, and in water bath with thermostatic control 65 ℃ of amplified reaction 1h;
C. water-bath is transferred to 80 ℃ of termination reactions, is taken out to be checked behind the 3min;
(3) color developing detection
In each reaction tubes to be checked, add 1 μ L developer, the colour-change that directly detects by an unaided eye, the reaction solution color becomes green, and sample then to be checked also is a toxin producing B clostridium difficile.
The nucleotides sequence tabulation
＜110〉Inspection and Quarantine Technology Center, Shandong Inspection and Quarantine
＜120〉toxin producing B clostridium difficile loop-mediated isothermal amplification fast detection method
<160>4
<210>1
<211>50
<212>DNA
＜213〉artificial sequence
<221>prim_bind
<222>(1)...(50)
<400>1
AGGAGAAGCAATTGATTTTACTGGA-TACAGCTCCTCTATAATTATCTTCA50
<210>2
<211>47
<212>DNA
＜213〉artificial sequence
<221>prim_bind
<222>(1)...(47)
<400>2
AAGTGTATTAGCTGGGGCAAAATAT-TATTTCAACCAAAGTGGAGTGT47
<210>3
<211>24
<212>DNA
＜213〉artificial sequence
<221>prim_bind
<222>(1)...(24)
<400>3
TTCACCATCTAATTCTTTCCATTC24
<210>4
<211>24
<212>DNA
＜213〉artificial sequence
<221>prim_bind
<222>(1)...(24)
<400>4
CAATTGGAGAGACAATAATTGATG24

Claims (1)

1. toxin producing B clostridium difficile constant-temperature amplification quick detection kit is characterized in that reagent wherein comprises (1)-(4):
(1) loop-mediated isothermal amplification liquid:
Comprise 10 * Thermopol reaction buffer, 1.0-1.4mmol/L dNTP, 4-8mmol/L sal epsom (MgSO4), 0.8-1.6 μ mol/L upstream inner primer (FIP), 0.8-1.6 μ mol/L downstream inner primer (BIP), 0.2-0.3 μ mol/L upstream outer primer (F3), 0.2-0.3 μ mol/L downstream outer primer (B3) and 1-1.5mol/L trimethyl-glycine; Wherein 10 * Thermopol reaction buffer contains trihydroxy methyl aminomethane-hydrochloric acid, 100mmol/L Repone K, 100mmol/L ammonium sulfate, 20mmol/L sal epsom and 1% triton x-100 of 200mmol/L pH8.8;
Its middle and upper reaches inner primer:
5-AGGAGAAGCAATTGATTTTACTGGA-TACAGCTCCTCTATAATTATCTTCA-3, downstream inner primer:
5-AAGTGTATTAGCTGGGGCAAAATAT-TATTTCAACCAAAGTGGAGTGT-3、
Upstream outer primer: 5-TTCACCATCTAATTCTTTCCATTC-3,
Downstream outer primer: 5-CAATTGGAGAGACAATAATTGATG-3,
(2) UNG enzyme: 1U/ μ L;
(3) Bst archaeal dna polymerase: 8U/ μ L;
(4) developer: be 10% fluorescence dye SYBR GREEN I or DNAGreen.
CN2008101579020A 2008-10-15 2008-10-15 Ring mediated isothermality amplification fast detecting method for producing toxin B clostridium difficile Expired - Fee Related CN101402998B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2008101579020A CN101402998B (en) 2008-10-15 2008-10-15 Ring mediated isothermality amplification fast detecting method for producing toxin B clostridium difficile

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2008101579020A CN101402998B (en) 2008-10-15 2008-10-15 Ring mediated isothermality amplification fast detecting method for producing toxin B clostridium difficile

Publications (2)

Publication Number Publication Date
CN101402998A CN101402998A (en) 2009-04-08
CN101402998B true CN101402998B (en) 2011-12-14

Family

ID=40537157

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2008101579020A Expired - Fee Related CN101402998B (en) 2008-10-15 2008-10-15 Ring mediated isothermality amplification fast detecting method for producing toxin B clostridium difficile

Country Status (1)

Country Link
CN (1) CN101402998B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108384837A (en) * 2018-03-28 2018-08-10 厦门蓝特生物科技有限公司 A kind of LAMP quantitative approach based on fluorescent quantitation system

Also Published As

Publication number Publication date
CN101402998A (en) 2009-04-08

Similar Documents

Publication Publication Date Title
Loubinoux et al. Bacteremia caused by a strain of Desulfovibrio related to the provisionally named Desulfovibrio fairfieldensis
Lindberg et al. Real-time PCR for Clostridium botulinum type C neurotoxin (BoNTC) gene, also covering a chimeric C/D sequence—Application on outbreaks of botulism in poultry
CN101381775B (en) Loop-mediated isothermal amplification fast detection method of producing candida albicans fungi
Vántus et al. The rabbit caecal microbiota: development, composition and its role in the prevention of digestive diseases–a review on recent literature in the light of molecular genetic methods
CN101319249B (en) Fast detecting reagent kit for enterobacter sakazakii and detecting method thereof
CN101386885B (en) Toxigenous commabacillus cholera vibrio ring mediated isothermal amplification rapid detection method
CN101381771B (en) Loop-mediated isothermal amplification fast detection method of producing ariatoxin fungi
CN101255460A (en) Preparation and detection method of Bacterium typhosum rapid detection reagent kit
CN104372099B (en) A kind of LAMP detection primer compositionss of Phytophthora cactorum bacterium and its LAMP detection kit and LAMP detection method
Pilchová et al. Development and validation of a loop-mediated isothermal amplification (LAMP) assay for rapid detection of Glaesserella (Haemophilus) parasuis
CN101020926A (en) Reagent kit and process for detecting cholera vibrio in circular mediated constant temperature amplification method
CN101402998B (en) Ring mediated isothermality amplification fast detecting method for producing toxin B clostridium difficile
CN101260427A (en) Preparation and using method for colibacillus fast checking kit
CN101255459A (en) Preparation and detection method of jejunum vibrio coli rapid detection reagent kit
CN101381774B (en) Loop-mediated isothermal amplification fast detection method of producing clostridium botulinum fungi
CN104099407B (en) The amphenicols Drug-resistant gene Quadruple-PCR detection kit of animal derived bacterium
CN104561267A (en) Loop-mediated isothermal amplification reaction primer for detecting streptococcus agalactiae of tilapias
Rule et al. Genome sequence of a clinical Salmonella Enteritidis sequence type 11 strain from South Africa
CN101200760A (en) Preparation and utilization method of yersinia genus rapid detection reagent kit
CN101245375A (en) Method for producing and using trauma vibrio fast detection kit
CN101200761B (en) Preparation and utilization method of clostridium perfringens rapid detection reagent kit
CN105368951B (en) For detecting the LAMP kit and its primer special of the tetracycline resistance gene (tet M) of clostridium difficile
Parra-Laca et al. Isolation of actinomycetes from Nile tilapia (Oreochromis niloticus) cultivated in semi-intensive systems from Morelos, Mexico central zone
CN101260426A (en) Preparation and using method for pig streptococcus fast checking kit
CN101403014A (en) Ring mediated isothermality amplification fast detecting method for norovirus

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C17 Cessation of patent right
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20111214

Termination date: 20131015